Application of ALPK2 gene missense mutation marker in breeding of pigs with dominant production traits

Abstract

The invention discloses application of an ALPK2 gene missense mutation marker in breeding of pigs with dominant production traits, and belongs to the technical field of molecular genetics and livestock breeding. By detecting ALPK2 gene mutation and screening individuals carrying mutation rs327271406 as a GG genotype, individuals with excellent growth traits (fast growth and high meat production performance) of European pig breeds can be rapidly screened out, the breeding period is shortened, the meat production efficiency of pig herds is improved, the breeding cost is reduced, the method is used for early screening of pig breeds with fast growth and high meat yield, high-quality pig herd breeding is accelerated, and the economic benefit is increased. The method evaluates the pig muscle development potential, guides molecular marker assisted breeding, and is especially used for commercialized lean type pig production.

Description

Technical Field

[0001] This invention belongs to the field of molecular genetics and livestock breeding technology, specifically involving the application of ALPK2 gene missense mutation markers in the selection of pigs with superior production traits. Background Technology

[0002] A missense mutation occurs when a codon encoding a specific amino acid in a DNA molecule is replaced by a codon encoding a different amino acid, thus altering the amino acid composition and sequence of the polypeptide chain. Missense mutations typically result in the polypeptide chain losing its original function, and many protein abnormalities are caused by missense mutations. The effects of missense mutations are diverse: from a functional perspective, if the mutation results in amino acids with similar properties (e.g., similar polarity or charge), the impact on protein structure and function may be small or even negligible; however, if the replacement with amino acids with significantly different properties, it may alter the protein's spatial structure, active site, or binding ability to other molecules, thereby affecting protein function. From a genetic disease perspective, many single-gene inherited diseases are caused by missense mutations, such as cystic fibrosis and mutations in certain types of cancer-related genes. At the evolutionary level, missense mutations can provide raw materials for natural selection; if the mutated protein is advantageous in a specific environment, it may be preserved and drive species evolution, but in most cases, harmful missense mutations are eliminated by natural selection. In addition, missense mutations can also affect the subcellular localization, stability, or interaction networks of proteins with other proteins, thereby triggering a series of chain reactions at the cellular or individual level.

[0003] Pigs are not only important economic animals but also important biomedical model animals. The two main lineages of domestic pig origin are the Asian wild boar and the European wild boar, and existing pig breeds are believed to have been independently domesticated from wild boars in their respective regions. Through natural and artificial selection, European and Asian pig breeds differ significantly in growth performance, carcass quality, and meat characteristics. European pigs (such as Landrace, Large White, and Duroc) are modern commercial breeds that have undergone long-term, highly selective breeding. Their main characteristics are rapid growth, high feed conversion efficiency, high lean meat percentage, and large body size, making them very suitable for intensive, large-scale farming to meet the large market demand for lean meat. Asian pigs (such as Meishan pigs, Jinhua pigs, Rongchang pigs, and Tibetan pigs) are distinctive local breeds that have been developed in East Asia over a long period. Their main characteristics are high reproductive capacity (especially high litter size), tolerance to roughage, strong adaptability, delicious and flavorful meat, and high fat deposition capacity (especially abundant intramuscular fat). However, their disadvantages include slow growth rate, lower feed conversion efficiency, low lean meat percentage, and relatively small body size, making them less suitable for the demands of modern large-scale, rapid lean meat production. Therefore, their economic benefits may be lower under purebred farming models. In pig breeding, missense mutations can significantly affect key traits such as growth performance, meat quality, disease resistance, and reproductive capacity by altering the amino acid sequences encoded by genes. For example, missense mutations can affect growth rate and body size by regulating genes related to muscle growth and fat deposition, and they can affect the taste and lean-to-fat ratio of pork by altering genes related to fat synthesis and muscle fiber type. Since growth rate and meat production traits are core indicators affecting the economic benefits of pig farming, European pig breeds are significantly better than Asian breeds in terms of growth rate and meat production performance. To improve production efficiency and economic benefits, it is necessary to carry out precise genetic improvement of Asian pig breeds.

[0004] The ALPK2 gene encodes an α-kinase protein that is highly expressed in heart and muscle tissue, and may affect meat production traits by regulating muscle development or energy metabolism. However, there are currently no reports on the association between the ALPK2 gene missense mutation (rs327271406) and the meat production trait in pigs, and there is also a lack of applications of molecular markers based on such mutations in breeding. Summary of the Invention

[0005] In order to overcome the shortcomings of the prior art, the purpose of this invention is to provide the application of ALPK2 gene missense mutation markers in the breeding of pigs with advantageous production traits.

[0006] To achieve the above objectives, the present invention employs the following technical solution:

[0007] The first aspect of the present invention discloses the application of the ALPK2 gene missense mutation marker in the selection of pigs with superior production traits, the marker being rs327271406, located at 162,265,882 bp on chromosome 1 of the pig genome, and the mutation being a GG genotype carrying the mutation rs327271406.

[0008] Preferably, the productive traits are the growth rate and meat yield of the pig.

[0009] Preferably, the breeding process includes: amplifying a gene fragment containing the missense mutation marker of the ALPK2 gene to obtain an amplification product; performing genotyping on the obtained amplification product using sequencing technology; and screening pigs whose ALPK2 gene missense mutation marker site is the GG genotype.

[0010] More preferably, the amplification primer pair is as shown in SEQ ID NO.1 and SEQ ID NO.1.

[0011] A second aspect of the present invention discloses a method for breeding pigs with advantageous production traits, comprising the following steps:

[0012] 1) Detection of missense mutation markers in the ALPK2 gene in piglets;

[0013] 2) Select individuals with the GG genotype obtained in step 1) and breed them to obtain pigs with superior production traits.

[0014] Preferably, the productive traits are the growth rate and meat yield of the pig.

[0015] A third aspect of the present invention discloses a method for breeding pigs with advantageous production traits, comprising the following steps:

[0016] 1) Detect ALPK2 gene missense mutation markers in candidate pigs to be kept for breeding;

[0017] 2) Select individuals with the GG genotype obtained in step 1);

[0018] 3) The individuals selected in step 2) are used as breeding pigs for breeding to obtain pigs with superior production traits.

[0019] Preferably, the productive traits are the growth rate and meat yield of the pig.

[0020] A fourth aspect of the present invention discloses a method for improving dominant production traits in pigs, comprising the following steps:

[0021] 1) Detect ALPK2 gene missense mutation markers in candidate pigs to be kept for breeding;

[0022] 2) Select individuals with the GG genotype obtained in step 1);

[0023] 3) Use the individuals selected in step 2) as breeding pigs, continue to select GG genotype pigs in the offspring, and eliminate other genotype pigs, thereby increasing the frequency of the GG dominant allele in each generation, thereby improving and enhancing the production traits of the offspring pigs.

[0024] A fifth aspect of the present invention discloses a kit for screening pigs with advantageous production traits, comprising an upstream primer, the sequence of which is shown in SEQ ID NO.1; and a downstream primer, the sequence of which is shown in SEQ ID NO.2.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The application of the ALPK2 gene missense mutation marker provided by this invention in the breeding of pigs with superior production traits: By detecting ALPK2 gene mutations, individuals carrying the mutation rs327271406 with the GG genotype can be screened, which can quickly screen individuals with excellent growth traits of European pig breeds (fast growth and high meat production performance), shorten the breeding cycle, improve the meat production efficiency of pig herds, and reduce breeding costs. It can be used for early screening of fast-growing and high-meat-yielding pig breeds, accelerate the breeding of high-quality pig herds, assess the muscle development potential of pigs, and guide molecular marker-assisted breeding, especially for commercial lean-type pig production. Attached Figure Description

[0027] Figure 1 This is a distribution map of the allele frequency of rs327271406 in European and Asian pig populations according to the present invention;

[0028] Figure 2 The graph shows the correlation analysis results between the ALPK2 gene and meat yield traits of this invention; where ADG represents the daily weight gain phenotype; DAYS_100 represents the age phenotype at 100kg.

[0029] Figure 3 This is a graph showing the expression levels of the ALPK2 gene in various pig tissues according to the present invention. Detailed Implementation

[0030] To enable those skilled in the art to understand the features and effects of the present invention, the following descriptions and definitions are only general descriptions of the terms and expressions mentioned in the specification and claims. Unless otherwise specified, all technical and scientific terms used herein have the ordinary meaning understood by those skilled in the art regarding the present invention, and in the event of any conflict, the definitions in this specification shall prevail.

[0031] The theories or mechanisms described and disclosed herein, whether right or wrong, should not in any way limit the scope of the invention, that is, the contents of the invention can be implemented without being limited by any particular theory or mechanism.

[0032] In this document, all features defined by numerical ranges or percentage ranges, such as numerical values, quantities, contents, and concentrations, are for the sake of brevity and convenience only. Accordingly, descriptions of numerical ranges or percentage ranges should be considered as covering and specifically disclosing all possible sub-ranges and individual numerical values ​​(including integers and fractions) within those ranges.

[0033] In this article, unless otherwise specified, “contains,” “includes,” “containing,” “has,” or similar terms cover the meanings of “composed of” and “mainly composed of,” for example, “A contains a” covers the meanings of “A contains a and others” and “A contains only a.”

[0034] For the sake of brevity, not all possible combinations of the technical features in each implementation scheme or embodiment are described herein. Therefore, as long as there is no contradiction in the combination of these technical features, the technical features in each implementation scheme or embodiment can be combined arbitrarily, and all possible combinations should be considered within the scope of this specification.

[0035] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading this description, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0036] The following examples use instruments and equipment conventional in the art. Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer. All raw materials used in the following examples are conventional commercially available products with specifications in the art, unless otherwise stated.

[0037] Example 1: Discovery of Mutation Sites

[0038] 1. Analysis of differences in selection signals among groups

[0039] The PigGTEx (2024) collected genomic data from 839 pigs from Europe and Asia. Among them, 373 were European commercial pigs, including Duroc, Yorkshire, Landrace, and Hampshire breeds. The Asian pigs were mainly local Chinese pigs, including Wuzhishan pig, Luchuan pig, Meishan pig, Bama pig, Rongchang pig, Tibetan pig, Northeast Min pig, Anqing black pig, and Dahua white pig breeds, totaling 463 pigs.

[0040] By calculating the selective difference signal (XP-EHH) of SNPs between the two populations, and selecting the top 1% of the XP-EHH signal as the threshold, 18,582 SNP sites with selective signal differences between the two populations were obtained.

[0041] 2. SNP locus annotation and functional gene mining analysis

[0042] The 18,582 SNP sites obtained in step 1 were annotated using SNPeff software. Analysis revealed several missense mutation sites that lead to amino acid alterations. Through in-depth literature review and analysis of the functions of the genes corresponding to these sites, the ALPK2 gene was identified as a key candidate gene highly correlated with the trait of pork yield in pigs.

[0043] 3. Group Analysis

[0044] In the ALPK2 gene region, we identified a missense mutation site (rs327271406) exhibiting extreme frequency differences between Eurasian populations. This site is located at 162,265,882 bp on chromosome 1 of the pig reference genome (Sscrofa11.1). In European pig populations, the G allele frequency at rs327271406 is as high as 0.9 (nearly fixed), while in Asian pig populations, the allele frequency is below 0.1. Figure 1 Further analysis confirmed that this locus was significantly associated with meat production traits in pigs. Figure 2 ).

[0045] Example 2: Phenotypic Association Analysis

[0046] 1. Sample collection and DNA extraction:

[0047] Twenty pigs with significant differences in lean meat percentage were selected as research subjects, including: a high lean meat percentage group: 10 commercial pigs (Large White pigs); and a low lean meat percentage group: 10 local Chinese pigs (Tongcheng pigs).

[0048] Ear tissue samples were collected from the above-mentioned pig breeds, and porcine genomic DNA was extracted using the Genome DNA Extraction Kit (Tiangen Biotech Co., Ltd.).

[0049] 2. Using the extracted porcine genomic DNA as a template, specific primers were designed. The primer sequences are shown in SEQ ID NO.1 and SEQ ID NO.2 in Table 1. The ALPK2 gene region containing the target mutation was amplified. The PCR amplification system is shown in Table 2. The PCR amplification program was: 94℃ for 3 minutes → 28 cycles (94℃ for 30 seconds → 55℃ for 30 seconds → 72℃ for 1 minute) → 72℃ for 5 minutes.

[0050] Table 1 Sequence List

[0051] name Sequence (5'-3') Serial Number upstream primer TGCCAACAACAGAGACATCCAT SEQ ID NO.1 Downstream primer CCGCCTTCTACTGGGCTTC SEQ ID NO.2

[0052] Table 2 PCR amplification system

[0053] reagents volume 2×Taq PCR premixed reagent (Tiangen Biotech, catalog number KT201) 10μL upstream primer 0.5μL Downstream primer 0.5μL Pig genomic DNA template (containing the ALPK2 gene region) 1μL <![CDATA[ddH2O]]> 8μL

[0054] 3. The obtained PCR products were subjected to Sanger sequencing. The sequencing peaks were analyzed using SnaPgene software to identify and statistically analyze the genotype (G or A) of each sample at the rs327271406 locus. The results are shown in Table 3:

[0055] Table 3. Genotype frequencies of the rs327271406 locus in the two pig groups.

[0056] Pig breeds (groups) Sample size Allele G frequency frequency of allele A Major alleles Large White pig (high lean meat percentage) 10 1.00 0.00 G Tongcheng pig (low lean meat percentage) 10 0.00 1.00 A

[0057] Table 3 shows that this locus exhibited extreme differences in allele frequency between the two pig groups, and this difference completely co-segregated with its lean meat percentage phenotype (high vs. low). Large White pigs (high lean meat percentage) consistently carried the G allele, while Tongcheng pigs (low lean meat percentage) consistently carried the A allele.

[0058] The phenotypic association analysis results of this embodiment show that the rs327271406 locus (G / A) on the ALPK2 gene is strongly associated with the lean meat percentage trait in pigs. The G allele is fixed in selected high-lean-percentage commercial pigs (Large White pigs), while the A allele is fixed in Chinese local pigs with lower lean meat percentage (Tongcheng pigs). This finding is highly consistent with previous findings based on population selection (the frequency of the G allele is extremely high in European high-lean-percentage pigs, and the frequency of the A allele is high in Asian local pigs), further supporting the possibility that the rs327271406 locus is a key functional site affecting pig meat yield / lean meat percentage, and has the potential to be used as a molecular marker for the breeding of pigs with the lean meat percentage trait.

[0059] Example 3: Genome-Wide Association Study (phWAS) of Gene-Level Phenotypic Analysis

[0060] Data on 32 phenotypes and ALPK2 gene expression levels from 1557 pigs were collected from the PigBiobank database (https: / / pigbiobank.farmgtex.org / ). Association analysis between phenotypes and gene expression was performed using a linear mixture model in MAGMA (v1.0) software.

[0061] Gene-level phWAS analysis results are as follows Figure 2As shown, the change in ALPK2 gene expression level was related to the decrease in the number of days to reach 100 kg in age (P = 3.2 × 10⁻⁶). -6 ) and daily weight gain increase (P = 1.8 × 10) -10 The correlation was significant, indicating that the ALPK2 gene is highly associated with meat production traits in pigs.

[0062] Example 4: Expression Analysis

[0063] The expression levels (number per million transcripts) of the ALPK2 gene in 32 different tissues, including heart, skeletal muscle, lymph, oocyte, blood, spleen, frontal cortex, thymus, lung, kidney, ovary, uterus, brain, hypothalamus, small intestine, duodenum, jejunum, colon, large intestine, ileum, pituitary gland, macrophage, adipose tissue, artery, placenta, blastocyst, liver, testis, morula, embryo, cartilage, and blastomeres, were collected and downloaded from the PigGTEx database (https: / / piggtex.farmgtex.org / ).

[0064] Analysis results as follows Figure 3 As shown, ALPK2 expression in muscle tissue is five times higher than in other tissues. This result indicates that the ALPK2 gene has significant tissue specificity in pigs, with its core functional site located in the skeletal muscle system. The ultrahigh expression of the ALPK2 gene in skeletal muscle is highly consistent with its strong association with increased daily weight gain and reduced days to 100 kg age (i.e., promoting muscle growth and deposition efficiency) in phWAS analysis.

[0065] Combining Example 2 (the strong association between the rs327271406 locus and lean meat percentage, and the fact that this locus is located within the ALPK2 gene) and Example 3 (phWAS results), the tissue expression evidence in this example together constructs a solid chain of evidence: the ALPK2 gene is a key gene regulating muscle growth and meat production performance in pigs, and its specific high expression in skeletal muscle is the basis for its growth-promoting and lean meat-increasing functions. The rs327271406 locus may ultimately affect the meat production traits of pigs by influencing the function or expression level of the ALPK2 gene.

[0066] Example 5: A kit for screening pig breeds with dominant production traits

[0067] Kits for screening pig breeds with advantageous production traits include:

[0068] Primers: including the upstream primer, whose nucleotide sequence is shown in SEQ ID NO.1 in Table 1; and the downstream primer, whose nucleotide sequence is shown in SEQ ID NO.2 in Table 1.

[0069] PCR premixed reagents: Taq DNA polymerase, dNTPs, MgCl2, PCR reaction buffer, PCR reaction enhancer, PCR reaction optimizer, and PCR reaction stabilizer.

[0070] The above content is only for illustrating the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. Any modifications made to the technical solution based on the technical concept proposed in this invention shall fall within the scope of protection of the claims of this invention.

Claims

1. The application of ALPK2 gene missense mutation markers in the selection of pigs with superior production traits, characterized in that, The marker is rs327271406, located at 162,265,882 bp on chromosome 1 of the pig genome, and the mutation is that the person carrying the rs327271406 mutation is of the GG genotype.

2. The application according to claim 1, characterized in that, The production traits refer to the growth rate and meat yield of pigs.

3. The application according to claim 1, characterized in that, The breeding process includes: amplifying the gene fragment containing the missense mutation marker of the ALPK2 gene to obtain the amplification product; using sequencing technology to genotype the obtained amplification product; and screening pigs whose ALPK2 gene missense mutation marker site is the GG genotype.

4. The application according to claim 3, characterized in that, The amplification primer pairs are shown in SEQ ID NO.1 and SEQ ID NO.

1.

5. A method for breeding pigs with advantageous production traits, characterized in that, Includes the following steps: 1) Detection of missense mutation markers in the ALPK2 gene in piglets; 2) Select individuals with the GG genotype obtained in step 1) and breed them to obtain pigs with superior production traits.

6. The method for breeding pigs with advantageous production traits according to claim 5, characterized in that, The production traits refer to the growth rate and meat yield of pigs.

7. A method for breeding pigs with advantageous production traits, characterized in that, Includes the following steps: 1) Detect ALPK2 gene missense mutation markers in candidate pigs to be kept for breeding; 2) Select individuals with the GG genotype obtained in step 1); 3) The individuals selected in step 2) are used as breeding pigs for breeding to obtain pigs with superior production traits.

8. The method for breeding pigs with advantageous production traits according to claim 7, characterized in that, The production traits refer to the growth rate and meat yield of pigs.

9. A method for improving dominant productive traits in pigs, characterized in that, Includes the following steps: 1) Detect ALPK2 gene missense mutation markers in candidate pigs to be kept for breeding; 2) Select individuals with the GG genotype obtained in step 1); 3) Use the individuals selected in step 2) as breeding pigs, continue to select GG genotype pigs in the offspring, and eliminate other genotype pigs, thereby increasing the frequency of the GG dominant allele in each generation, thereby improving and enhancing the production traits of the offspring pigs.

10. A kit for screening pigs with dominant production traits, characterized in that, It includes an upstream primer, the sequence of which is shown in SEQ ID NO.1; and a downstream primer, the sequence of which is shown in SEQ ID NO.2.

Images