Primers for amplifying gender-related molecular markers of bellamya aeruginosa in the identification of bellamya aeruginosa gender

By designing sex-specific molecular marker primers through whole-genome resequencing and GWAS analysis, and combining PCR amplification and gel electrophoresis, the accuracy and efficiency issues of sex identification in Bellamya chinensis were solved, achieving rapid and accurate genetic sex identification, which is suitable for Bellamya chinensis breeding and sex-related research.

CN120945073BActive Publication Date: 2026-03-17HUAZHONG AGRI UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511405080.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-29
Publication Date
2026-03-17
Estimated Expiration
2045-09-29

AI Technical Summary

Technical Problem

Existing methods for sex identification in Bellamya chinensis mainly rely on morphological characteristics, which suffer from low accuracy and efficiency, making them particularly difficult to apply in breeding practices. Furthermore, no reports have been found on sex molecular markers in Bellamya chinensis, hindering the development of its aquaculture industry.

Method used

Primers for amplifying sex-related molecular markers in *Bellamya piriformis* were developed. Specific primers were designed for PCR amplification using whole-genome resequencing and GWAS analysis, and sex was identified by agarose gel electrophoresis. Primer sequences and identification methods for sex-specific molecular markers were provided.

Benefits of technology

It enables rapid and accurate identification of the genetic sex of Bellamya chinensis, avoiding the influence of environment and individual behavior. It is suitable for breeding operations and can identify the sex of immature individuals and newborn snail seedlings, thus improving identification efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120945073B_ABST
    Figure CN120945073B_ABST
Patent Text Reader

Abstract

The application discloses a primer for amplifying a Bellamya aeruginosa gender-related molecular marker and application of the primer in Bellamya aeruginosa gender identification, and belongs to the technical field of aquatic animal genetics and breeding. The Bellamya aeruginosa gender-related molecular marker disclosed by the application is obtained by whole genome resequencing and GWAS analysis screening; the molecular marker is SEQ ID NO. 1 and SEQ ID NO. 2; and the gender identification method is, on the basis of designing specific primers for the molecular marker, taking genomic DNA as a template, performing PCR amplification and 3% agarose gel electrophoresis, and on an electrophoretogram, a band for a female and two bands for a male. The application can accurately and quickly identify the genetic gender of the Bellamya aeruginosa and does not need sequencing. The application has important application value in gender identification in Bellamya aeruginosa artificial breeding and breeding practice and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of aquatic animal genetic breeding technology, and more specifically to the application of primers for amplifying sex-related molecular markers in *Bellamya piriformis* in sex identification. Background Technology

[0002] Bellamya purificata is the fastest growing, largest, and most promising species among the major freshwater bellamya species, and it is also the species most widely cultivated and researched.

[0003] Accurate and rapid sex determination is the first step in breeding new varieties of Bellamya chinensis. However, current methods for sex determination in Bellamya chinensis are based on differences in morphological characteristics between males and females, mainly including two types of methods: The first method is to observe the differences in the morphology of the tentacles of male and female individuals. Females have two slender, symmetrical tentacles that extend forward; males have a thick, short right tentacle that curls inward and is specialized as a copulatory organ (Zhang Xi & Liu Yueying, 1960). However, in breeding practice, using tentacle morphology to determine sex is impractical because Bellamya chinensis, when slightly stimulated, quickly retracts its tentacles, along with its viscera and foot, into its shell and seals the shell opening with its operculum. It then senses the external environment for a long time, ensuring safety before extending its tentacles and foot again to begin movement. Therefore, this method is difficult to apply in breeding practice. The second method involves observing differences in gonadal structure through the shell. A representative example is the "A Rapid Method for Identifying the Sex of the Chinese Round Snail" (CN110074025B) developed by Bin Shiyu et al. (2019). This method uses strong light to illuminate the junction of the spiral and the body whorl; snails exhibiting a crescent-shaped shadow (testes) are male, while those without shadow or exhibiting a granular shadow (embryo) are female. However, this method has three main problems: 1) it cannot distinguish between sexually immature individuals; 2) the distinction between crescent-shaped shadows (testes) and granular shadows (embryo) is prone to human error; 3) the shell of the *Bellamya affinis* is much thicker and darker than that of the *Viviparus sinensis*, making it difficult for light to penetrate. Furthermore, wild *Bellamya affinis* are often covered with thick moss, further affecting light penetration. Therefore, using this method to identify the sex of *Bellamya affinis* also affects accuracy and efficiency. In summary, existing methods for distinguishing the sex of *Bellamya affinis* using morphological characteristics all have certain limitations.

[0004] Sex-specific molecular markers are unaffected by animal developmental stage, living environment, or individual phenotypic differences, making them the most accurate and convincing method for identifying the genetic sex of individuals within a species. Furthermore, sex-specific molecular markers are fundamental tools for studying the sex determination mechanisms of specific species and for sex-controlled breeding. However, the cultivation of Bellamya chinensis is an emerging industry with a currently weak genetic background; sex-specific molecular markers have not yet been reported, hindering the progress of large-scale artificial breeding, new variety selection, and sex-related research.

[0005] Therefore, providing primers for amplifying sex-related molecular markers in *Bellamya pyriformis* and applying them to sex identification in *Bellamya pyriformis* is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides a molecular marker, identification primer and application of sex-related properties of Bellamya piriformis. The molecular marker can be widely used and can accurately identify the sex of Bellamya piriformis.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] The first objective of this invention is to provide a sex molecular marker for *Bellamya pulvinata*, wherein the nucleotide sequence of this marker in males is as shown in SEQ ID NO.1. Specifically:

[0009] 5'-GCAATGATGGCAATAGGATTCTCAAATGCATTT G A GAACACAT CTTAAAACAGATGTGTTAATGCAAACTGGTAAAAGTG C G-3'; SEQ ID NO.1.

[0010] In females, as shown in SEQ ID NO.2. Specifically:

[0011] 5'-GCAATGATGGCAATAGGATTCTCAAATGCATTTACTTAAAACAGATGTGTTAATGCAAACTGGTAAAAGTG G G-3'; SEQ ID NO.2.

[0012] Compared to the male sequence (SEQ ID NO.1), the female sequence (SEQ ID NO.2) has a 9bp deletion, specifically at positions 34 and 36–43, and there is a gender difference at position 81: the female has G, and the male has C. Figure 1 ).

[0013] PCR amplification of this sequence revealed significant differences in the gel electrophoresis patterns: females showed one band, while males showed two bands. Figure 2 ).

[0014] A second objective of this invention is to provide primer sequences for amplifying sex molecular markers in *Bellamya pearica*.

[0015] The nucleotide sequences of the upstream and downstream primers used to amplify the sex molecular marker of *Bellamya pearica* are shown in SEQ ID NO. 3 and SEQ ID NO. 4. Specifically:

[0016] Upstream primer: 5'-GCAATGATGGCAATAGGATTCTCAA-3'; SEQ ID NO.3;

[0017] Downstream primer: 5'-CGCACTTTTACCAGTTTGCAT-3'; SEQ ID NO.4.

[0018] The third objective of this invention is to provide a method for applying the above-mentioned sex molecular markers and their primers in sex identification of *Bellamya pyriformis*.

[0019] Furthermore, a method for sex determination of *Bellamya pear-shaped* snails includes the following steps:

[0020] (1) Extract genomic DNA from the individual to be tested;

[0021] (2) Using genomic DNA as a template, PCR amplification was performed using SEQ ID NO.3 and SEQ ID NO.4. The PCR products were electrophoresed on a 3% agarose gel for 1 hour at an electrophoresis voltage of 150V.

[0022] (3) The sex of the individual to be tested is determined according to the band type on the gel electrophoresis image: if a single band is shown on the electrophoresis image, it is determined to be female; if two bands are shown on the gel electrophoresis image, it is determined to be male.

[0023] Furthermore, the PCR amplification system in step (2) is as follows: 2.5 μL DNA template (10-20 ng / μL), 1 μL each of upstream and downstream primers (10 μmol / μL), 12.5 μL 2×Taq PCR Mix, and RNase-free ddH2O added to 25 μL.

[0024] Furthermore, the PCR amplification program in step (2) is as follows: 94℃ pre-denaturation for 5 min; 94℃ pre-denaturation for 30 s, 60℃ annealing for 25 s, 72℃ extension for 10 s, 35 cycles; 72℃ extension for 5 min.

[0025] As can be seen from the above technical solution, compared with the prior art, the present invention discloses the application of primers for amplifying sex-related molecular markers in *Bellamya pyriformis* for sex identification, which has the following beneficial effects:

[0026] (1) This invention obtains sex molecular markers for *Bellamya piriformis* through whole-genome resequencing and GWAS analysis, and develops specific primers for these markers for sex identification. This method requires only a small amount of tissue, genomic DNA extraction, PCR amplification, 3% agarose gel electrophoresis, and reading the electrophoresis image. Sequencing of the PCR products is not required. Therefore, it can quickly and accurately identify the sex of an individual.

[0027] (2) In existing methods for sex identification of Bellamya chinensis, the antennal morphology observation method is difficult to apply in breeding practice due to the snail's defensive behavior; the method of observing the gonadal structure through the shell cannot be used for sex identification of immature individuals, and this method is also affected by factors such as shell thickness, the tester's experience, and the observation angle. The sex molecular marker and identification method provided by this invention is not affected by the above factors and has accuracy and wide applicability.

[0028] (3) It can identify the genetic sex of an individual. Existing methods for observing antennae morphology and gonadal structure only yield phenotypic sex results. However, as a lower animal, the phenotypic sex of Bellamya is easily influenced by the environment. Therefore, its phenotypic sex and genetic sex may not be the same. The sex-specific molecular marker developed in this invention can accurately identify the genetic sex of an individual, which is more suitable for the actual needs of breeding operations. Attached Figure Description

[0029] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0030] Figure 1 Sanger sequencing peak diagrams for the pear-shaped spiral snail sequences SEQ ID NO.1 (male) and SEQ ID NO.2 (female). Compared with the male (SEQ ID NO.1), the female sequence (SEQ ID NO.2) has a 9bp deletion, at positions 34 and 36-43, respectively, and there is a sex difference at position 81, with G in female and C in male.

[0031] Figure 2The image shows partial electrophoresis results of PCR products from *Bellamya pear-shaped snails*, obtained using the sex molecular marker primers of this invention to distinguish between male and female individuals. Numbers 1-8 represent the electrophoresis results of PCR products from female individuals, showing one band; numbers 9-18 represent the electrophoresis results of PCR products from male individuals, showing two bands. Detailed Implementation

[0032] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0033] The reagents required in the embodiments of this invention are conventional experimental reagents, purchased from commercial channels; the experimental methods not mentioned in detail in the embodiments are conventional experimental methods, and will not be described in detail here.

[0034] Example 1

[0035] 1) Extraction of genomic DNA from Bellamya pear-shaped snail

[0036] Twenty-seven randomly selected male and female *Bellamya pear-shaped* snails were included, comprising 215 females and 72 males. Genomic DNA was extracted from the abdominal foot muscle of each individual using the ammonium acetate / isopropanol method.

[0037] ① Take about 0.2g of tissue, cut it into small pieces, add 500μL of cell lysis buffer SDS and 20μL of proteinase K, mix well and then incubate in water for 3 hours;

[0038] ② Add 200 μL of ammonium acetate, let stand for 10 min, and centrifuge at 12000 r / min for 10 min;

[0039] ③ Transfer the supernatant to a new EP tube and centrifuge at 12000 r / min for 10 min;

[0040] ④ Take the supernatant into a new EP tube, add 400 μL of isopropanol, mix well, let stand for 2 min, and centrifuge at 12000 r / min for 10 min;

[0041] ⑤ Discard the supernatant and wash the DNA with 75% and 100% ethanol in sequence;

[0042] ⑥ Add an appropriate amount of DEPC water to dissolve the DNA.

[0043] 2) Screening of SNPs and InDels for sex-significant association in *Bellamya pear-shaped* snails

[0044] ① Perform whole-genome resequencing on the genomic DNA of each individual, and use the Haplotyper tool of GATK4.0 to detect SNPs & InDels to obtain high-quality SNPs & InDels;

[0045] ② Through GWAS (based on GLM model) analysis, we identified SNPs and InDels that were significantly associated with sex in *Bellamya pear-shaped*.

[0046] 3) Screening for sex-specific SNPs & InDels

[0047] ① Primer design for amplifying sex-significantly associated SNPs & InDels

[0048] Extract 500bp flanking sequences upstream and downstream of sex-significantly associated SNPs and InDels, and design PCR primers for amplifying each SNP / InDel using Primer 5.

[0049] ② Amplification of sex-significantly related SNPs & InDels

[0050] The PCR system consisted of: 2.5 μL DNA template (10–20 ng / μL), 1 μL each of forward and reverse primers (10 μmol / μL), 10 μL 2×Taq PCR Mix, and RNase-free ddH2O to a final volume of 25 μL. The PCR program was as follows: 94℃ pre-denaturation for 5 min; 94℃ pre-denaturation for 30 s, 60℃ annealing for 25 s, 72℃ extension for 10 s, for a total of 35 cycles; and a final extension at 72℃ for 5 min.

[0051] ③Sanger sequencing and genotyping

[0052] The PCR amplification products were subjected to Sanger sequencing, and the sequencing peak chromatogram was read using Snapgene software. Figure 1 Comparison of sequencing peaks and actual sex revealed significant sexual dimorphism in the 34795208-34795289nt region of the Scaffold2 genome of *Bellamya pyriformis* (sequence shown in SEQ ID NO.1). Females exhibited a 9bp deletion, and numerous SNP sites were found near this region (sequence shown in SEQ ID NO.2). PCR primers SEQ ID NO.3 and SEQ ID NO.4, designed using Primer 5, were used to amplify this region; their sequences are as follows:

[0053] 5'- GCAATGATGGCAATAGGATTCTCAA ATGCATTTGAGAACACATCTTAAAACAGATGTGTTA ATGC AAACTGGTAAAAGTGCG -3';SEQ ID NO.1.

[0054] 5'-GCAATGATGGCAATAGGATTCTCAAATGCATTTACTTAAAACAGATGTGTTAATGCAAACTGGTAAAAGTGGG-3'; SEQ ID NO. 2.

[0055] 5'-GCAATGATGGCAATAGGATTCTCAA-3'; SEQ ID NO.3;

[0056] 5'-CGCACTTTTACCAGTTTGCAT-3'; SEQ ID NO. 4.

[0057] In male individuals, the nucleotide sequence containing the molecular marker is shown in SEQ ID NO.1. Compared to males (SEQ ID NO.1), female individuals (SEQ ID NO.2) have a 9bp deletion at positions 34 and 36–43, respectively, and there is a sex difference at position 81: G in females and C in males.

[0058] ④ Gel electrophoresis

[0059] The fragments of SEQ ID NO.1 / SEQ ID NO.2 were amplified using SEQ ID NO.3 and SEQ ID NO.4. The PCR products were then subjected to 3% agarose gel electrophoresis for 1 hour at a voltage of 150V. The results showed that female individuals amplified only one band, while male individuals amplified two bands. Because this result shows a clear sexual dimorphism and is easily detected, it can be used as a molecular marker for the sex of *Bellamya piriformis*.

[0060] 4) Validation of sex molecular markers in *Bellamya pear-shaped*

[0061] Another 150 *Bellamya pear-shaped* snails from Honghu, Hubei Province, were used to extract DNA from their abdominal foot muscles. PCR amplification was performed using primers SEQ ID NO.3 and SEQ ID NO.4. The PCR products were electrophoresed on a 3% agarose gel for 1 hour at 150V. The electrophoresis pattern was read, and the accuracy of the sex molecular marker of this invention was verified using actual sex as a control.

[0062] The results showed that all tested female individuals had only one band on the electrophoresis image of their PCR products. Figure 2 (1-8), all tested male individuals showed two bands on the electrophoresis diagram of their PCR products ( Figure 2 (9-18). Therefore, the sex molecular markers of the present invention can accurately identify the sex of *Bellamya przewalskii* in Honghu, Hubei Province with 100% accuracy (Table 1).

[0063] Table 1. Sex identification results of the *Bellamya pyriformis* population in Honghu, Hubei Province, based on sex molecular markers.

[0064]

[0065]

[0066] Example 2

[0067] 174 pear-shaped bell-shaped snails from the Huaihe River in Anhui Province were used to verify the accuracy of the molecular markers of the present invention. The specific steps were the same as step 4 in Example 1.

[0068] The results showed that the molecular markers of the present invention could accurately identify the sex of *Bellamya purpurea* from the Huaihe River in Anhui Province with 100% accuracy (Table 2).

[0069] Table 2. Sex identification results of *Bellamya pyriformis* population in the Huaihe River basin of Anhui Province based on sex molecular markers.

[0070]

[0071] Example 3

[0072] 138 pear-shaped ring-bellied snails from Tianmen, Hubei Province were used to verify the accuracy of the molecular markers of the present invention. The specific steps were the same as step 4) in Example 1.

[0073] The analysis results show that the molecular markers of the present invention can accurately identify the sex of *Bellamya przewalskii* from Tianmen, Hubei Province with 100% accuracy (Table 3).

[0074] Table 3. Sex identification results of *Bellamya pyriformis* population from Tianmen, Hubei Province, based on sex molecular markers.

[0075]

[0076] The molecular markers, identification primers, and their applications related to sex in *Bellamya pear-shaped snails* provided in this invention overcome the limitations of existing sex identification technologies and can accurately identify the genetic sex of *Bellamya pear-shaped snails*. This method does not require sequencing and is unaffected by individual defensive behaviors, developmental stages, living environments, or subjective factors of the tester. It can identify not only the sex of adult snails but also the sex of newly hatched snails, offering advantages such as accuracy and wide applicability. It has significant application value in the artificial breeding, new variety selection, and sex identification of *Bellamya pear-shaped snails* in sex-related research.

[0077] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The use of primers in the sex identification of Bellamya aeruginosa, characterized in that, The nucleotide sequence of the primer is SEQ ID NO. 3 and SEQ ID NO.

4. The gender of the individual to be tested is identified according to the band type on the gel electrophoresis map: single band on the electrophoresis map is determined as female; two bands on the electrophoresis map are determined as male.

2. A method for gender identification of Bellamya purificata, characterized in that, The method comprises the following steps: (1) extracting the genomic DNA of the individual to be tested; (2) using the genomic DNA as a template, performing PCR amplification with the primer in claim 1, and performing 3% agarose gel electrophoresis on the PCR product for 1 h; (3) identifying the gender of the individual to be tested according to the band type on the gel electrophoresis map: single band on the electrophoresis map is determined as female; two bands on the electrophoresis map are determined as male.

Citation Information

Patent Citations

  • A method for quickly identifying the sex of the Chinese round snail

    CN110074025B

  • Method for rapidly identifying male and female bellamya

    CN117898239A

  • Bellamya piriformis gender prediction method based on machine learning and application

    CN120105200A