Composition for diagnosing dengue virus and chikungunya virus and application thereof

Abstract

The invention relates to the technical field of molecular diagnosis, in particular to a composition for visually detecting a dengue virus and a chikungunya fever virus based on an RT-ERA-LbCas12a system and application of the composition. The invention provides a composition for detecting the dengue virus and the chikungunya virus, the composition comprises an RT-ERA primer, crRNA, LbCas12a protease and an ssDNA fluorescent probe based on the composition, and the invention further provides a method for detecting the dengue virus and the chikungunya virus. According to the method, through the combination of RT-ERA amplification and a CRISPR-Cas12a system, the sensitivity with the lower detection limits of 1 copy / [mu] L, 2.4 copy / [mu] L and 1.5 copy / [mu] L and higher specificity are obtained respectively, whether a sample contains the dengue virus and the chikungunya fever virus or not can be detected within 1 h, and rapid diagnosis and screening of the dengue virus and the chikungunya fever virus are facilitated.

Description

Technical Field

[0001] This invention relates to the field of molecular diagnostics technology, specifically to a composition for visual detection of dengue virus and chikungunya virus based on the RT-ERA-LbCas12a system and its application. Background Technology

[0002] Dengue virus (DENV) and chikungunya virus (CHIKV) are both mosquito-borne vector viruses with highly overlapping endemic areas. Patients in non-endemic areas who have recently been exposed to endemic areas and experience fever should be alert to the possibility of travel-related infection. Both viruses can be co-infected through different mosquito vectors or a single bite. Although both present with acute fever, their clinical management strategies differ significantly: CHIKV infection is mostly self-limiting, primarily causing chronic joint problems, with rare fatalities; nonsteroidal anti-inflammatory drugs (NSAIDs) are the first-line treatment. In contrast, dengue fever is contraindicated with NSAIDs; although usually self-limiting, it requires close monitoring as it can progress to highly fatal hemorrhagic fever or shock syndrome. Dengue infection only provides lifelong immunity to the same serotype; reinfection with other serotypes significantly increases the risk of severe illness. Typical symptoms may indicate a specific viral infection, but atypical presentations require rapid, specific diagnostic techniques to identify the pathogen.

[0003] Currently, laboratory diagnostic methods for melioidosis mainly include virus isolation and culture, serological testing, and molecular biological methods. While virus isolation and culture is the gold standard for infection diagnosis, it is time-consuming and can easily miss the optimal treatment window. Serological testing is prone to false negatives or false positives due to the window period and background interference from epidemic populations. Currently reported molecular biological methods are mainly based on RT-PCR and Lamp (loop-mediated isothermal amplification). PCR requires high standards in terms of instrumentation and personnel operation, making it unsuitable for rapid point-of-care diagnosis (rapid field testing). Furthermore, Lamp methods are prone to aerosol contamination, leading to false positives. Although there are RPA-CRISPR-based detection methods for CHIKV, the similar infection symptoms and drastically different treatment and clinical management strategies of dengue virus and chikungunya virus necessitate simultaneous differential detection of these two viruses. Summary of the Invention

[0004] The purpose of this invention is to overcome the above-mentioned defects and deficiencies in the prior art and provide a composition for detecting dengue virus and chikungunya virus, so as to meet the need for rapid and accurate diagnosis of dengue virus and chikungunya virus infection and effectively avoid missed detection and false detection.

[0005] This invention first provides a composition for diagnosing dengue virus and chikungunya virus, comprising a dengue virus RT-ERA primer pair, a chikungunya virus RT-ERA primer pair, crRNA, LbCas12a protease, and an ssDNA fluorescent probe; the chikungunya virus RT-ERA primer pair is designed based on the target sequence SEQ ID NO:65; the dengue virus RT-ERA primer pair is designed based on the dengue virus type I target sequence and / or the dengue virus type II target sequence, wherein the dengue virus type I target sequence is SEQ ID NO:63, and the dengue virus type II target sequence is SEQ ID NO:64.

[0006] In one embodiment of the present invention, the chipovirus RT-ERA primer pair contains the nucleotide sequence SEQ ID.

[0007] Primers with SEQ ID NO:27 and / or SEQ ID NO:32; preferably, the dengue type I virus EPA primer pair contains primers with nucleotide sequences of SEQ ID NO:12 and / or SEQ ID NO:14; preferably, the dengue type II virus EPA primer pair contains primers with nucleotide sequences of SEQ ID NO:17 and / or SEQ ID NO:18.

[0008] In one embodiment of the present invention, the crRNA is a dengue virus type I crRNA transcription template with the nucleotide sequence SEQ ID NO:45; and / or,

[0009] The crRNA is a dengue virus type II crRNA transcription template with the nucleotide sequence SEQ ID NO:48; and / or,

[0010] The crRNA is a transcription template for chipovirus crRNA with the nucleotide sequence SEQ ID NO:56.

[0011] In one embodiment of the present invention, the sequence of the ssDNA fluorescent probe is TTATT (SEQ ID NO: 85), with a FAM (FITC) fluorescent reporter group labeled at its 5' end and a BHQ1 quencher group or a biotin reporter gene labeled at its 3' end.

[0012] In one embodiment of the invention, it further includes universal reagents required for the enzyme-catalyzed recombination isothermal amplification (RT-ERA) reaction system, and / or universal reagents required for the CRISPR-Cas12a cleavage system.

[0013] The present invention also provides the use of the above-described composition in the preparation of reagents or kits for detecting dengue virus and / or chikungunya virus.

[0014] The present invention further provides the use of the above-described composition in the preparation of diagnostic reagents or kits for diagnosing dengue virus and / or chikungunya virus infection.

[0015] Another aspect of the present invention provides a method for detecting dengue virus and chikungunya virus, comprising the following steps:

[0016] S1. Extract nucleic acid from the sample to be tested;

[0017] S2. Using the nucleic acid of the sample to be tested as a template, an enzymatic recombination isothermal amplification reaction is performed using the RT-ERA primer pair in the above composition to obtain the EPA product;

[0018] S3. The above-mentioned crRNA, LbCas12a protease and ssDNA fluorescent probe are mixed with the ERA product obtained in step S2 and then subjected to CRISPR-Cas12a cleavage reaction to obtain the enzyme digestion product.

[0019] S4. Detect the fluorescence signal of the enzyme digestion product obtained in step S3; if the enzyme digestion product produces fluorescence, it is determined that the sample to be tested contains dengue virus and chikungunya virus; if the enzyme digestion product does not produce fluorescence, it is determined that the sample to be tested does not contain dengue virus and chikungunya virus.

[0020] Preferably, the enzyme digestion product is placed in a BIO-RAD FX 96 fluorescence quantitative analyzer to detect the fluorescence intensity. If the relative fluorescence unit is higher than 886557, the sample is determined to contain dengue virus type I; if the relative fluorescence unit is lower than 886557, the sample is determined not to contain dengue virus type I. If the relative fluorescence unit is higher than 742307, the sample is determined to contain dengue virus type II; if the relative fluorescence unit is lower than 742307, the sample is determined not to contain dengue virus type II. If the relative fluorescence unit is higher than 970330, the sample is determined to contain chikungunya virus; if the relative fluorescence unit is lower than 970330, the sample is determined not to contain chikungunya virus.

[0021] In one embodiment of the invention, it further includes:

[0022] S5. Detect the enzyme digestion product obtained in step S3 using a colloidal gold test strip. If both the control band and the test band show obvious red lines, the sample is considered to contain dengue virus and chikungunya virus, and the test result is positive. If only the control band shows a red line, the sample is considered to not contain dengue virus and chikungunya virus, and the test result is negative. If no red line appears on the control band, the test result is invalid.

[0023] In one embodiment of the present invention, the system and conditions for the enzymatic recombination isothermal amplification reaction include:

[0024] Bottom of PCR tube: 8 μL of premixed solvent, 9.2 μL of nucleic acid sample, and 1 μL each of 10 μM RT-ERA forward and reverse primers.

[0025] 280mM MgOAc 0.8μL;

[0026] PCR tube cap: LbCas12a (10μM) 1.251μL, crRNA (40μM) 0.625μL, 10*Reaction Buffer

[0027] 2.5 μL, 0.625 μL of ssDNA (40 μM) fluorescent probe;

[0028] Mix the PCR tube thoroughly, then cap it and incubate at 39°C for 30 minutes. Then, briefly centrifuge the reagent on the cap and add it to the bottom of the PCR tube. Mix well and incubate at 39°C for 30 minutes.

[0029] The beneficial effects of the above-described technical solution of the present invention are as follows:

[0030] The method of this invention, through RT-ERA amplification and continuous trans-cleavage of LbCas12a, can detect dengue virus nucleic acid at concentrations as low as 2.4 copies / μL and chikungunya virus nucleic acid at 1.5 copies / μL. The dual recognition by RT-ERA primers and crRNA significantly improves the specificity of dengue virus and chikungunya virus detection. Furthermore, the one-pot reaction system of this invention can be completed without opening the reaction tubes, thus eliminating the risk of cross-contamination. The method of this invention yielded negative results for malaria falciparum, malaria vivax, Staphylococcus aureus, and Acinetobacter baumannii. Through optimization of reaction conditions, the method of this invention can rapidly detect the presence of dengue virus and chikungunya virus in samples within 1 hour, without the need for large-scale instruments, thus facilitating the rapid detection and screening of dengue virus and chikungunya virus. Attached Figure Description

[0031] Figure 1a , Figure 1b and Figure 1c The images show the agarose gel electrophoresis results of recombinant isothermal amplification products using different RT-ERA primers; among them...

[0032] Figure 1aThe lanes in the swimming pool, from left to right, are: DNA marker, DENV1-ERA-F1 / R1, DENV1-ERA-F1 / R1-1, DENV1-ERA-F1-1 / R1, DENV1-ERA-F1-1 / R1-1, DENV1-ERA-F2 / R2, DENV1-ERA-F2 / R2-1, DENV1-ERA-F2-1 / R2, DENV1-ERA-F2-1 / R2-1, DNA marker, DENV1-ERA-F3 / R3, DENV1-ERA-F4 / R4, DENV1-ERA-F4 / R4-1, DENV1-ERA-F4-1 / R4, DENV1-ERA-F4-1 / R4-1;

[0033] Figure 1b The lanes in the swim bladder, from left to right, are: DNA marker, DENV2-ERA-F1 / R1, DENV2-ERA-F2 / R2, DENV2-ERA-F3 / R3, DENV2-ERA-F3 / R3-1, DENV2-ERA-F3-1 / R3, DENV2-ERA-F3-1 / R3-1, DENV2-ERA-F4 / R4, DENV2-ERA-F4 / R4-1, DENV2-ERA-F4-1 / R4, DENV2-ERA-F4-1 / R4, DNA marker;

[0034] Figure 1c The lanes in from left to right are: DNA marker, CHIKV-ERA-F1 / R1, CHIKV-ERA-F1-1 / R1, CHIKV-ERA-F2 / R1, CHIKV-ERA-F2-1 / R1, CHI KV-ERA-F1 / R2, CHIKV-ERA-F1-1 / R2, CHIKV-ERA-F2 / R2, CHIKV-ERA-F2-1 / R2, CHIKV-ERA-F1 / R 2-1, CHIKV-ERA-F1-1 / R2-1, CHIKV-ERA-F2 / R2-1, CHIKV-ERA-F2-1 / R2-1, CHIKV-ERA-F1 / R2-2, CHIKV-ERA-F1-1 / R2-2, CHIKV-ERA-F2 / R2-2, CHIKV-ERA-F2-1 / R2-2, CHIKV-ERA-F3 / R3, DNA marker; the molecular weight standards of the DNA marker from top to bottom are 500bp, 400bp, 300bp, 200bp, and 100bp.

[0035] Figure 2This is a fluorescence curve of the RT-ERA-LbCas12a reaction between the optimal RT-ERA primer pair and crRNA. The horizontal axis represents the RT-ERA-LbCas12a reaction time (min), and the vertical axis represents the relative fluorescence units (RFU).

[0036] DENV1-ERA-F4-1 / R4-1-crRNA6 represents the reaction combination of the ERA product amplified by the DENV1-ERA-F4-1 / R4-1 primer and DENV1-crRNA6. DENV1-ERA-F4-1 / R4-1-crRNA6-NC is the negative control group. DENV2-ERA-F2 / R2-crRNA2 represents the reaction combination of the ERA product amplified by the DENV2-ERA-F2 / R2 primer and DENV2-crRNA2. DENV2-ERA-F2 / R2-crRNA2-NC is the negative control group. CHIKV-ERA-F1 / R2-crRNA2 represents the reaction combination of the ERA product amplified by the CHIKV-ERA-F1 / R2 primer and CHIKV-crRNA2. CHIKV-ERA-F1 / R2-crRNA2-NC is the negative control group.

[0037] Figure 3a , Figure 3b and Figure 3c These are visualization results of plasmid sensitivity testing of the dengue virus and chikungunya virus RT-ERA-LbCas12a detection systems. The horizontal axis represents the RT-ERA-LbCas12a reaction time (min), and the vertical axis represents relative fluorescence units (RFU).

[0038] Figure 3a The concentrations of DENV1 plasmid DNA from left to right are: 1000 copies / μL, 100 copies / μL, 10 copies / μL, 5 copies / μL, 2.5 copies / μL, 1 copy / μL, 0.1 copies / μL, and NC.

[0039] Figure 3b The concentrations of DENV2 plasmid DNA from left to right are: 2400 copies / μL, 240 copies / μL, 24 copies / μL, 12 copies / μL, 6 copies / μL, 2.4 copies / μL, 0.24 copies / μL, and NC.

[0040] Figure 3c The CHIKV plasmid DNA concentrations from left to right are: 600 copies / μL, 60 copies / μL, 6 copies / μL, 3 copies / μL, 1.5 copies / μL, 0.6 copies / μL, 0.06 copies / μL, and NC.

[0041] Figure 4a, Figure 4b and Figure 4c The figures show the results of the clinical RNA sample sensitivity evaluation experiment of the dengue virus and chikungunya virus RT-ERA-LbCas12a detection system. Figure 4a : Sensitivity fluorescence curves and visualized LED blue light plots of DENV1 clinical samples; Figure 4b : Sensitivity fluorescence curves and visualized LED blue light plots for DENV2 clinical samples; Figure 4c CHIKV clinical sample sensitivity fluorescence curve and LED blue light visualization. The horizontal axis represents the RT-ERA-LbCas12a reaction time (min), and the vertical axis represents the relative fluorescence units (RFU). 0.000001-10 ng / μL represents the RNA concentration of dengue virus and chikungunya virus in the clinical sample.

[0042] Figure 5a , Figure 5b and Figure 5c These are visualizations of the specificity evaluation results of the RT-ERA-LbCas12a detection system for dengue virus and chikungunya virus, respectively.

[0043] Figure 5a From left to right: Dengue virus type I clinical specimen, Dengue virus type I plasmid sample, Dengue virus type II clinical specimen, Chikungunya virus clinical specimen, national standard for malignant malaria, national standard for vivax malaria, Staphylococcus aureus, Acinetobacter baumannii, negative control;

[0044] Figure 5b From left to right: Dengue virus type II clinical specimen, Dengue virus type II plasmid sample, Dengue virus type I clinical specimen, Chikungunya virus clinical specimen, national standard for malignant malaria, national standard for vivax malaria, Staphylococcus aureus, Acinetobacter baumannii, negative control;

[0045] Figure 5c From left to right: Chikungunya virus clinical specimen, Chikungunya virus plasmid sample, dengue virus type I clinical specimen, dengue virus type II clinical specimen, national standard for falciparum malaria, national standard for vivax malaria, Staphylococcus aureus, Acinetobacter baumannii, and negative control.

[0046] Figure 6a , Figure 6b and Figure 6c The figures show the sensitivity results of colloidal gold test strips for detecting dengue virus and chikungunya virus in clinical samples, respectively.

[0047] Figure 6aDENV1 from left to right is 10 ng / μL, 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, 0.001 ng / μL, 0.0001 ng / μL, 0.00001 ng / μL, 0.000001 ng / μL, NC;

[0048] Figure 6b DENV2 from left to right is 10 ng / μL, 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, 0.001 ng / μL, NC;

[0049] Figure 6c The CHIKV levels from left to right are 10 ng / μL, 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, 0.001 ng / μL, and NC.

[0050] Figure 7 shows the ROC curves for the one-step detection method of dengue virus type I, dengue virus type II, and chikungunya virus using RT-ERA-LbCas12a. Detailed Implementation

[0051] To make the technical problems, technical solutions and advantages of the present invention clearer, a detailed description will be given below in conjunction with the accompanying drawings and specific embodiments.

[0052] Unless otherwise specified, all reagents used in the following examples are conventional reagents in the art, commercially available or prepared according to conventional methods in the art; the experimental methods and conditions used are conventional experimental methods and conditions in the art, and can be found in relevant experimental manuals, public literature, or manufacturer's instructions. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0053] The dengue virus type I and dengue virus type II nucleic acid samples used in the following examples were provided by the Laboratory of Microbiology, Department of Basic Medical Sciences, Army Medical University. The chikungunya virus nucleic acid samples were provided by the Eighth Affiliated Hospital of Southern Medical University. The dengue virus type I, dengue virus type II, and chikungunya virus plasmids were synthesized by Shanghai Sangon Biotech.

[0054] The Staphylococcus aureus strain used in the following examples is ATCC25923, provided by the Laboratory of Clinical Microbiology and Immunology, Department of Pharmacy and Laboratory Medicine, Army Medical University.

[0055] The Acinetobacter baumannii strain used in the following examples is ATCC19606, provided by the Laboratory of Clinical Microbiology and Immunology, Department of Pharmacy and Laboratory Medicine, Army Medical University.

[0056] The falciparum malaria (PF) and vivax malaria (PV) used in the following examples were purchased from the National Institutes for Food and Drug Control, China. PF: batch number 230037-20140501, PV: batch number 230038-20140502.

[0057] Main reagents and consumables:

[0058] Quick DNA / RNA Pathogen miniprep Kit: ZYMO RESEARCH, catalog number R1042; Viral Genomic DNA / RNA Extraction Kit: Tiangen Biotech, catalog number DP315; Human DNA Quantitation Standard: NIST, catalog number SRM2372a; Basic Nucleic Acid Amplification Kit (RT-ERA method), Suzhou Xianda Gene Technology Co., Ltd., catalog number KS101; RT-Basic Nucleic Acid Amplification Kit (RT-ERA method), Suzhou Xianda Gene Technology Co., Ltd., catalog number KS102; T7 RiboMAX TM Express Large Scale RNA Production System: Promega, catalog number P1320; RNA Clean & Concentrator Kits: ZYMO RESEARCH, catalog number R1015; DNase I Reaction Buffer: NEB, catalog number B0303S; Lb cas12a: Suzhou Xianda Gene Technology Co., Ltd., catalog number: Lot C23B08; PREMIXEX TAQ TM (PROBE QPCR), Takara, Catalog No.: RR390A; Dengue Virus Type I Probe Method Fluorescent Quantitative PCR Kit (Shanghai Jining, JN27518A); Dengue Virus Type II Probe Method Fluorescent Quantitative PCR Kit (Shanghai Jining, JN28039A); Chikungunya Virus Probe Method Fluorescent Quantitative PCR Kit (Shanghai Jining, JN28081A).

[0059] Example 1: Establishment of an ERA-LbCas12a detection system for dengue virus and chikungunya virus.

[0060] 1. Target sequence selection

[0061] Through analysis, this invention selected the nucleic acid sequences of dengue virus type I / II and chikungunya virus located at 9985-10226bp on GenBank:NC_001477.1, 8677-8952 on GenBank:NC_001474.2, and 5798-6117 on GenBank:NC_004162.2, respectively, as target sequences for dengue virus and chikungunya virus gene detection, as shown in SEQ ID NO:63-65.

[0062] SEQ ID NO:63

[0063] AACAGAAGACATGTTGTCAGTGTGGAATAGGGTTTGGATAGAGGAAAACCCATGGATGGAGGACAAGACTCATGTGTCCAGTTGGGAAGACGTTCCATACCTAGGAAAAAGGGAAGATCAATGGTGTGGTTCCCTAATAGGCTTAACAGCACGAGCCACCTGGGCCACCAACATACAAGTGGCCATAAACCAAGTGAGAAGGCTCATTGGGAATGAGAATTATCTAGACTTCATGACATCAA

[0064] SEQ ID NO:64

[0065] ACGAAGAAACTAATGAAAATAACAGCAGAGTGGCTTTGGAAAGAATTAGGGAAGAAAAAGACACCCAGGATGTGCACCAGAGAAGAATTCACAAGAAAGGTGAGAAGCAATGCAGCCTTGGGGGCCATATTCACTGAT GAGAACAAGTGGAAGTCGGCACGTGAGGCTGTTGAAGATAGTAGGTTTTGGGAGCTGGTTGACAAGGAAAGGAATCTCCATCTTGAAGGAAAGTGTGAAACATGTGTGTACAACATGATGGGAAAAAGAGAGAAGAAG

[0066] SEQ ID NO:65

[0067] gagcaactactacttaagaaactccaggagagtgcatccatggccaacagaagcaggtatcagtcgcgcaaagtagaaaacatgaaagcaacaatcatccagagactaaagagaggctgtagattatacttaatgtcagagaccccaaaagtccctacct accggaccacatatccggcgcctgtgtactcgcctccgattaacgtccgactgtccaaccccgagtccgcagtggcagcatgcaatgagttcttggctagaaactatccaactgtttcatcataccaaatcaccgacgagtatgatgcatatctagacat

[0068] 2. Design of ERA primers and crRNA

[0069] For the selected target sequences (SEQ ID NO:63-65), this invention designed several theoretically feasible pairs of ERA primers and crRNAs. However, experimental verification showed that most of them were not effective. Some of the usable sequences are shown in Tables 1 and 2.

[0070] Table 1 Candidate ERA primers

[0071]

[0072]

[0073] Table 2. Transcription templates for candidate crRNAs

[0074]

[0075]

[0076]

[0077] Note: In the transcription template sequence of crRNA, the underlined part is the anchoring sequence and transcription promoter sequence that binds to LbCas12a protein, and the rest is the guide sequence that binds to the bases of the RT-ERA amplification product.

[0078] Universal reporter probe (ssDNA): 5'-FAM-TTATT-BHQ1-3'. The 5' end FAM is a fluorescent reporter group, and the 3' end BHQ1 is a quencher group or a biotin reporter gene.

[0079] Shanghai Sangon Biotech Co., Ltd. was commissioned to synthesize the RT-ERA primers in Table 1, the transcription templates for crRNA in Table 2, and the aforementioned universal reporter probe (ssDNA).

[0080] 3. Preparation and quantitative detection of viral nucleic acid

[0081] Tested viruses and bacteria: dengue virus type I, type II and chikungunya virus cell culture supernatant, Staphylococcus aureus, Acinetobacter baumannii, malaria falciparum (PF), malaria vivax (PV).

[0082] Nucleic acid was extracted from each of the tested bacteria and viruses using the Quick DNA / RNA Pathogen miniprep Kit (Zymo, R1042) and the viral genomic DNA / RNA extraction kit (Tiangen, DP315) according to the kit instructions. Dengue virus type I, type II, and chikungunya virus cell culture supernatant nucleic acid samples were quantitatively detected using the dengue virus type I probe fluorescent quantitative PCR kit (Shanghai Jining, JN27518A), dengue virus type II probe fluorescent quantitative PCR kit (Shanghai Jining, JN28039A), and chikungunya virus probe fluorescent quantitative PCR kit (Shanghai Jining, JN28081A) according to the kit instructions. The Human DNA Quantitation Standard (NIST, SRM2372a) was used as the international standard. Dengue virus and chikungunya virus plasmids were serially diluted, with 10-fold dilutions labeled as 10⁻¹, and so on. Real-time quantitative PCR was used to quantify the nucleic acid at each dilution concentration of dengue virus and chikungunya virus plasmids. The fluorescent quantitative PCR system (25 μL) consisted of 2*Premix Ex Taq. TM 12.5 μL of primer and probe mixture, 7.5 μL of primer and probe solution, and 5 μL of sample to be tested. The primer and probe mixture consisted of: 2.5 μL of upstream primer (100 μM), 2.5 μL of downstream primer (100 μM), 5 μL of probe (100 μM), and 365 μL of DEPC water. The quantitative PCR program was as follows: 37℃ for 10 minutes; 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 10 seconds; 58℃ annealing for 40 seconds, for 40 cycles. Fluorescence signals were collected after each cycle to complete the PCR amplification reaction and analyze the collected fluorescence signals.

[0083] Table 3. Quantitative primer and probe sequences for dengue virus and chikungunya virus QP.

[0084] sequence name Sequence (5'-3') Serial Number DENV1-QP-F1 CTGACTACGCTTTGGGAGGG SEQ ID NO:66 DENV1-QP-R ATGAAAAGGCCAGACCTGCT SEQ ID NO:67 DENV1-QP-P1 ATAGCGGTGTCCATGGCAAA SEQ ID NO:68 DENV2-QP-F1-1 ATGACACCGCAGGATGGGAT SEQ ID NO:69 DENV2-QP-R1 ACACGCACCACCTTGTTTTG SEQ ID NO:70 DENV2-QP-P1 CAAGAAACTAGCCGAGGCCA SEQ ID NO:71 CHIKV-QP-F1 CAAGTGGAGCTGCTGGATGA SEQ ID NO:72 CHIKV-QP-R1 CGTTTGGTGAAAACGGGTCC SEQ ID NO:73 CHIKV-QP-P1 CAGCTTGGCAGGCAGAAAAG SEQ ID NO:74

[0085] The results of plasmid quantification experiments for dengue virus and chikungunya virus are shown in Table 3. Based on the relationship between the CT value and copy number of dengue 1 plasmid, the quantitative calculation formula is CT = -3.35*log(copies) + 37.27 (R²>0.99). Substituting the CT value of the sample into the formula CT = -3.35*log(copies) + 37.27 (R²>0.99), the copy number of the dengue 1 plasmid in the sample can be calculated. Similarly, based on the relationship between the CT value and copy number of dengue 2 plasmid, the quantitative calculation formula is CT = -3.41*log(copies) + 37.27. The copy number of the dengue 2 plasmid in the sample can be calculated by substituting the CT value of the sample into the formula CT=-3.41*log(copies)+37.25(R2>0.99). Based on the relationship between the CT value and copy number of the base pore plasmid, the quantitative calculation formula CT=-3.58*log(copies)+37.52(R2>0.99) is obtained. Substituting the CT value of the sample into the formula CT=-3.58*log(copies)+37.52(R2>0.99), the copy number of the base pore plasmid in the sample can be calculated.

[0086] Table 4. Results of Quantitative Analysis of Plasmid DNA from Dengue Virus and Chikungunya Virus

[0087]

[0088] 4. Screening of ERA primer pairs and crRNA

[0089] (1) Preparation of ERA products

[0090] Prepare a 10 μM solution of ERA primers (sequences shown in SEQ ID NO:1-SEQ ID NO:39). Dilute the dengue virus and chikungunya virus plasmid DNA solutions 10 μM. 3 The sample was used as template DNA, with ddH2O used as a negative control. ERA amplification was performed using a basic nucleic acid amplification kit (ERA method, KS101) according to the kit instructions. 8 μL of premixed solvent, 9.2 μL of nucleic acid sample, 1 μL each of 10 μM RT-ERA forward and reverse primers, and 0.8 μL of 280 mM MgOAc were added to the bottom of the PCR tube. The mixture was incubated at 39°C for 30 min. After the reaction, the products were subjected to agarose gel electrophoresis to detect the amplification.

[0091] The results are as follows Figure 1a , Figure 1b , Figure 1cAs shown, primer pair combinations 4: DENV1-ERA-F1-1 / R1-1, 8: DENV1-ERA-F2-1 / R2-1, 10: DENV1-ERA-F4 / R4, 11: DENV1-ERA-F4 / R4-1, and 13: DENV1-ERA-F4-1 / R4-1 showed higher ERA product detection lines than other groups, and these combinations will be selected for further screening. The primer pairs were able to amplify bands of 303bp, 254bp, 248bp, 365bp, and 242bp, respectively. These five ERA products were then used in the ERA-LbCas12a reaction. Primer pair combinations 1: DENV2-ERA-F1 / R1, 2: DENV2-ERA-F2 / R2, 5: DENV2-ERA-F3-1 / R3, 6: DENV2-ERA-F3-1 / R3-1, 7: DENV2-ERA-F4 / R4, 8: DENV2-ERA-F4 / R4-1, and 9: DENV2-ERA-F4-1 / R4 were able to amplify bands of 303bp, 254bp, 248bp, 365bp, and 242bp, respectively. The target bands with sizes of 269bp, 276bp, 141bp, 160bp, 208bp, 276bp, and 210bp were increased. Seven ERA products were used in the ERA-LbCas12a reaction; Combination 1: CHIKV-ERA-F1 / R1, Combination 2: CHIKV-ERA-F1-1 / R1, Combination 4: CHIKV-ERA-F2-1 / R1, Combination 5: CHIKV-ERA-F1 / R2, Combination 6: CHIKV-ERA-F1-1 / R2, Combination 7: CHIKV-ERA-F2 / R2, Combination 8: CHIKV-ERA-F2-1 / R2 The ERA products showed target bands without non-specific amplification, and could amplify target bands of sizes 384bp, 381bp, 281bp, 320bp, 317bp, 221bp, and 217bp, respectively. These bands will be selected for further screening in the later stages.

[0092] (2) Preparation of crRNA

[0093] Mix 1 μL of crRNA transcription template (10 μM) and 1.5 μL of crRNA transcription template (10 μM) to prepare an annealing reaction system. Place the annealing reaction system in a PCR instrument and preheat at 95 °C for 2 min; then slowly cool to 25 °C at a cooling rate of 0.1 °C / s. A linear DNA template is obtained.

[0094] Using T7 RiboMAX TMThe in vitro transcription reaction system of the Promega Express Large Scale RNA Production System (P1320) was prepared according to the product instructions: 10 μL Ribomax express T7 2×buffer, 2.5 μL linear DNA template, 2 μL Enzyme Mix T7 express, and Nuclease-free water to a final volume of 20 μL. The in vitro transcription reaction system was incubated at 37°C for 30 min to obtain the in vitro transcription reaction solution. Then, the following mixture was prepared: 5 μL NEB buffer (B7203S), 4 μL DNase I, 20 μL in vitro transcription reaction solution, and DEPC-treated water to a final volume of 100 μL. The mixture was incubated at 37°C for 20-30 min, then 1 μL of 0.5M EDTA was added to the mixture, and after centrifugation, the mixture was incubated at 75°C for 10 min. The crRNA in the mixture was purified using RNA Clean & Concentrator Kits (ZYMO RESEARCH, R1015) according to the product instructions to obtain purified Bp-crRNA1 and Bp-crRNA2, which were then quantified and stored at -80℃ for later use.

[0095] (3) ERA-LbCas12a reaction

[0096] The selected ERA products were used as cleavage substrates and combined with crRNA to prepare an ERA-LbCas12a reaction system (20 μL): 20 μL ERA product, 0.625 μL crRNA (40 μM), 2.5 μL DNase I Reaction Buffer (NEB, B0303S), 1.25 μL LbCas12a (10 μM), and 0.625 μL reporter probe ssDNA (40 μM). After vortexing and mixing, the mixture was briefly centrifuged and placed in a Bio-Rad CFX 96 real-time quantitative PCR instrument. The reaction was carried out at 39℃ for 30 min, and the fluorescence signal intensity (RFU) was detected. For the negative control, the ERA product and crRNA prepared using the elution buffer of the Quick DNA / RNA Pathogen miniprep Kit as the ERA reaction template were subjected to the ERA-LbCas12a reaction.

[0097] The results are as follows Figure 2As shown, the ERA products of the DENV1-ERA-F4-1 / R4-1 primer pair combined with DENV1-crRNA6, the ERA products of the DENV2-ERA-F2 / R2 primer pair combined with DENV2-crRNA2, and the ERA products of the CHIKV-ERA-F1 / R2 primer pair combined with CHIKV-crRNA2 exhibit the highest fluorescence signal values ​​and the shortest plateau time in the ERA-LbCas12a reaction. Therefore, the preferred combinations are DENV1-ERA-F4-1 / R4-1 with DENV1-crRNA6, DENV2-ERA-F2 / R2 with DENV2-crRNA2, and CHIKV-ERA-F1 / R2 with CHIKV-crRNA2, which are considered the optimal reaction combinations for the ERA-CRISPR reaction system.

[0098] 7. Optimization experiment of RTS-ERA reaction time for weak positive samples

[0099] Approximately 100 copies / μL of dengue virus and chikungunya virus RNA were used as template nucleic acids, with ddH2O used as a negative control. RT-ERA amplification was performed using a basic nucleic acid amplification kit (ERA method, KS102) according to the kit instructions. First, a 20μL premix was prepared as follows: 8μL of premixed solvent, 9.2μL of nucleic acid sample, 1μL each of 10μM RT-ERA forward and reverse primers, and 0.8μL of 280mM MgOAc. The mixture was then incubated at 39℃ for 20-40 minutes.

[0100] CRISPR reaction was performed using: 0.625 μL crRNA (40 μM), 2.5 μL DNase I Reaction Buffer (NEB, B0303S), 1.25 μL LbCas12a (10 μM), and 0.625 μL reporter probe ssDNA (40 μM). The mixture was briefly centrifuged and added to the bottom of the PCR tube after the ERA reaction. The mixture was then vortexed and placed in a Bio-Rad CFX 96 real-time quantitative PCR instrument. The reaction was incubated at 37°C for 30 min, and the fluorescence signal intensity (RFU) was measured.

[0101] Table 5. Experimental results of optimized reaction time for DENV1 RT-ERA-CRISPR

[0102]

[0103] Table 6. Experimental results of optimized reaction time for DENV2 RT-ERA-CRISPR

[0104]

[0105] Table 7. Optimization results of CHIKV RT-ERA-CRISPR reaction time

[0106]

[0107] Based on the above screening and optimization experiments, the following detection system for dengue virus and chikungunya virus ERA-LbCas12a was established:

[0108] Step S1: RT-ERA reaction

[0109] RT-ERA amplification was performed using a basic nucleic acid amplification kit (ERA method, KS102). 8 μL of premixed solvent, 9.2 μL of nucleic acid sample, 1 μL each of 10 μM RT-ERA forward and reverse primers, and 0.8 μL of 280 mM MgOAc were added to the bottom of the PCR tube. After mixing, the mixture was incubated at 39°C for 30 min.

[0110] Step S2: ERA-LbCas12a reaction

[0111] The reaction mixture on the tube cap consists of: 0.625 μL crRNA (40 μM), 2.5 μL DNase I Reaction Buffer (NEB, B0303S), 1.25 μL LbCas12a (10 μM), and 0.625 μL reporter probe ssDNA (40 μM). After brief centrifugation, add this mixture to the bottom of the PCR tube after the ERA reaction, vortex to mix, and place in a Bio-Rad CFX 96 real-time quantitative PCR instrument. Incubate at 39°C for 30 min and detect the fluorescence signal intensity (RFU). Alternatively, incubate at 37°C for 30 min and visualize the results under an LED blue light (UV flashlight), or place the reaction product on a colloidal gold test strip for observation.

[0112] Example 2: Sensitivity and specificity evaluation of the dengue virus and chikungunya virus ERA-LbCas12a detection system

[0113] Normal blood genomic DNA was extracted from normal human blood samples using the Quick DNA / RNA Pathogen miniprep Kit (ZYMO RESEARCH, R1042) for the following sensitivity and specificity evaluation experiments. Normal human blood samples were provided by the Laboratory of Clinical Microbiology and Immunology, Department of Pharmacy and Laboratory Medicine, Army Medical University.

[0114] 1. Sensitivity Evaluation

[0115] 1.1 Plasmid Sample Sensitivity

[0116] Plasmid DNA of dengue virus and chikungunya virus, quantified by real-time quantitative PCR in Example 1, was added to normal blood genomic DNA solution to obtain dengue type I virus at concentrations of 0.1 copies / μL, 1 copy / μL, 2.5 copies / μL, 5 copies / μL, 10 copies / μL, 100 copies / μL, and 1000 copies / μL; dengue type II virus at concentrations of 0.24 copies / μL, 2.4 copies / μL, 6 copies / μL, 12 copies / μL, 24 copies / μL, 240 copies / μL, and 2400 copies / μL; and chikungunya virus nucleic acid samples at concentrations of 0.06 copies / μL, 0.6 copies / μL, 1.5 copies / μL, 3 copies / μL, 6 copies / μL, 60 copies / μL, and 600 copies / μL. 9.2 μL of dengue virus and chikungunya virus nucleic acid samples of various concentrations were used as templates for ERA amplification. Simultaneously, ERA amplification was performed using the elution buffer of the Quick DNA / RNA Pathogen miniprep Kit as a template as a negative control. The dengue virus and chikungunya virus ERA-LbCas12a detection system established in Example 1 was used for detection. The reporter probe ssDNA was labeled with a FAM (FITC) fluorescent reporter group at the 5' end and a BHQ1 quencher group at the 3' end.

[0117] The results are as follows Figure 3a , Figure 3b , Figure 3c As shown, the detection limits of the dengue virus type I, dengue virus type II, and chikungunya virus ERA-LbCas12a detection system of the present invention are 1 copy / μL, 2.4 copies / μL, and 1.5 copies / μL, respectively, which have high sensitivity.

[0118] 1.2 RNA sample sensitivity

[0119] RNA was extracted from dengue virus and chikungunya virus cell culture supernatants using a viral genomic DNA / RNA extraction kit. RNA samples were quantified using nanodrop and diluted to 10 ng / μL, 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, 0.001 ng / μL, 0.0001 ng / μL, 0.00001 ng / μL, and 0.000001 ng / μL. The reaction was performed using the RT-ERA-LbCas12a reaction system and steps described in Example 1, wherein the ssDNA was labeled with a FAM (FITC) fluorescent reporter group at the 5' end and a BHQ1 quencher group at the 3' end. The dengue virus type I, dengue virus type II, and chikungunya virus cell culture supernatant nucleic acid samples were quantitatively detected using the dengue virus type I probe fluorescent quantitative PCR kit (Shanghai Jining, JN27518A), the dengue virus type II probe fluorescent quantitative PCR kit (Shanghai Jining, JN28039A), and the chikungunya virus probe fluorescent quantitative PCR kit (Shanghai Jining, JN28081A) according to the kit instructions.

[0120] The results are as follows Figure 4a , Figure 4b , Figure 4c As shown, the detection limits of the RT-ERA-LbCas12a detection system for dengue type I virus, dengue type II virus, and chikungunya virus of the present invention are 0.0001 ng / μl (2.9 copies / μL), 0.01 ng / μl (1 copy / μL), and 0.01 ng / μl (3.2 copies / μL), respectively, which have very high sensitivity.

[0121] 2. Specificity evaluation

[0122] Using normal blood genomic DNA as a negative control and clinical samples and plasmid samples of dengue virus and chikungunya virus as positive controls, the specificity of the dengue virus and chikungunya virus RT-ERA-LbCas12a detection system was evaluated using genomic DNA samples of falciparum malaria, vivax malaria, Staphylococcus aureus (Sa), and Acinetobacter baumannii.

[0123] The results are as follows Figure 5a , Figure 5b , Figure 5cAs shown, the negative control and two other viral samples besides the positive sample—malaria falciparum (PF), malaria vivax (PV), Staphylococcus aureus (Sauria), and Acinetobacter baumannii genomic DNA—all tested negative, while the positive control tested positive. This demonstrates that the established ERA-LbCas12a detection system exhibits good specificity for dengue virus and chikungunya virus, with good specificity among the three viruses.

[0124] Example 3: Sensitivity results of colloidal gold test strips for detecting dengue virus and chikungunya virus in clinical samples using RT-ERA-LbCas12a.

[0125] Using the quantified RNA sample from Example 2, the reaction was carried out according to the following steps.

[0126] Step S1: RT-ERA reaction

[0127] RT-ERA amplification was performed using a basic nucleic acid amplification kit (ERA method, KS102). 8 μL of premixed solvent, 9.2 μL of nucleic acid sample, 1 μL each of 10 μM RT-ERA forward and reverse primers, and 0.8 μL of 280 mM MgOAc were added to the bottom of the PCR tube. After mixing, the mixture was incubated at 39°C for 20 min.

[0128] Step S2: RT-ERA-LbCas12a reaction

[0129] Prepare the reaction mixture from the tube cap: 0.625 μL crRNA (40 μM), 2.5 μL DNase I Reaction Buffer (NEB, B0303S), 1.25 μL LbCas12a (10 μM), and 0.625 μL reporter probe ssDNA (40 μM). The reporter probe ssDNA is labeled with a FAM (FITC) fluorescent reporter group at the 5' end and a biotin reporter gene at the 3' end. After brief centrifugation, add this mixture to the bottom of the PCR tube after the ERA reaction, vortex to mix, and incubate at 39°C for 30 min. Dilute the sample supernatant with 30 μL of sample diluent. Place the test strip on a horizontal surface (use as soon as possible), being careful not to touch the NC membrane. Using a pipette or dropper, slowly add 80 μL of the sample to the well of the test strip dropwise. Read the results after 7-10 minutes.

[0130] Result Interpretation

[0131] Positive result: Both the control band and the test band show obvious red lines. Note: Weak staining of the test band is also considered a positive result. A positive result may be visible within 1-2 minutes.

[0132] Negative result: Only the control band shows a red line.

[0133] Invalid result: No red line appeared on the control band.

[0134] The results are as follows Figure 6a , Figure 6b , Figure 6c As shown, the detection limits of the RT-ERA-LbCas12a detection system for dengue type I virus, dengue type II virus, and chikungunya virus of the present invention are 0.001 ng / μl (29 copies / μL), 0.1 ng / μl (10 copies / μL), and 0.1 ng / μl (32 copies / μL), respectively, which have very high sensitivity.

[0135] Example 4: ROC curve validation of the dengue virus and chikungunya virus ERA-LbCas12a detection system

[0136] The normal serum samples used in this experiment were provided by the Laboratory of Clinical Microbiology and Immunology, Department of Pharmacy and Laboratory Medicine, Army Medical University. The dengue virus and chikungunya virus solutions used in this experiment were clinically isolated samples.

[0137] First, prepare the following samples:

[0138] Sample 1: Genomic DNA was extracted from 10 normal serum samples.

[0139] Sample 2: Twenty normal serum samples were taken, and a certain amount of dengue virus and chikungunya virus solution were added to each sample. Genomic DNA was then extracted from each sample. The copy number of melioidosis genomic DNA in the extracted genomic DNA was approximately 1-10 copies / μL.

[0140] Sample 3: Twenty normal serum samples were taken, and a certain amount of dengue virus and chikungunya virus solution were added to each sample. Genomic DNA was then extracted from each sample. The copy number of melioidosis genomic DNA in the extracted genomic DNA was approximately 10-100 copies / μL.

[0141] Sample 4: Twenty normal serum samples were taken, and a certain amount of dengue virus and chikungunya virus solution were added to each sample. Genomic DNA was then extracted from each sample. The copy number of melioidosis genomic DNA in the extracted genomic DNA was approximately 100-1000 copies / μL.

[0142] Sample 5: Ten cases of Staphylococcus aureus, ten cases of Acinetobacter baumannii, ten cases of Malaria falciparum, and ten cases of Malaria vivax. Genomic DNA was extracted from each of them.

[0143] Then, each sample was tested according to the dengue virus and chikungunya virus ERA-LbCas12a detection system established in Example 1. The obtained fluorescence signal values ​​(RFU) were input into SPSS software to generate ROC curves (Figure 7). The results of SPSS software analysis of the Ct values ​​of each sample are shown in Table 8. The AUC (area under ROC) were 0.996, 0.995, and 0.998, respectively, and the maximum Youden index (correctness index) were 0.96, 0.92, and 0.95, respectively. The RFU values ​​corresponding to the maximum Youden index were 886557, 742307, and 970330, respectively, which are the positive judgment cutoff values.

[0144] Table 8

[0145]

[0146] Notes: a. Assume nonparametric conditions; b. Null assumption: true region = 0.5.

[0147] Example 5: Composition and method for visual detection of dengue virus and chikungunya virus based on ERA-LbCas12a system

[0148] 1. Visual detection of dengue virus and chikungunya virus combinations based on the ERA-LbCas12a system

[0149] The composition includes reagents required for ERA primers, crRNA, ssDNA fluorescent probes, ERA reaction system, and CRISPR / Cas12a cleavage detection system.

[0150] The ERA primers for dengue type I are as follows:

[0151] DENV-1-ERA-F4-1:

[0152] 5'-AACAGAAGACATGTTGTCAGTGTGGAATAG-3' (SEQ ID NO:12), DENV-1-ERA-R4-1:

[0153] 5'-TTGATGTCATGAAGTCTAGATAATTCTCATT-3' (SEQ ID NO: 14),

[0154] The ERA primers for dengue type II are as follows:

[0155] DENV2-ERA-F2: 5'-ACGAAGAAACTAATGAAAATAACAGCAGAGT-3' (SEQ ID NO: 17),

[0156] DENV2-ERA-R2: 5'-CTTCTTCTCTCTTTTTCCCATCATGTTGTA-3' (SEQ ID NO: 18),

[0157] The ERA primers for the base pores are as follows:

[0158] CHIKV-ERA-F1: (SEQ ID NO:27)

[0159] 5'-GAGCAACTATTACTTAAGAAACTCCAGGAGAG-3',

[0160] CHIKV-ERA-R2: 5'-ATGTCTAGATATGCATCATACTCGTCGGTAAT-3' (SEQ ID NO: 32),

[0161] The transcription template sequence of the DENV1 crRNA is as follows:

[0162] Upstream template: 5'-TAATACGACTCACTATAGG-3' (SEQ ID NO:75);

[0163] Downstream template:

[0164] 5'-TCCATCCATGGGTTTTCCTCTATC ATCTACACTTAGTAGAAATTACCTATAGTGAGTCGTATTA -3'

[0165] (SEQ ID NO:76);

[0166] The transcription template sequence of the DENV2 crRNA is as follows:

[0167] Upstream template: 5'-TAATACGACTCACTATAGG-3' (SEQ ID NO:77);

[0168] Downstream template:

[0169] 5'-TTCCTTTCCTTGTCAACCAGCTCC ATCTACACTTAGTAGAAATTACCTATAGTGAGTCGTATTA -3'

[0170] (SEQ ID NO:78);

[0171] The transcription template sequence of the CHIKV crRNA is as follows:

[0172] Upstream template: 5'-TAATACGACTCACTATAGG-3' (SEQ ID NO:79);

[0173] Downstream template:

[0174] 5'-AACTATCCAACTGTCTCGTCATAC ATCTACACTTAGTAGAAATTACCTATAGTGAGTCGTATTA -3'

[0175] (SEQ ID NO:80);

[0176] The ssDNA fluorescent probe is as follows:

[0177] 5'-FAM-TTATT-BHQ1-3' (SEQ ID NO:81);

[0178] The FAM and BHQ1 modified ssDNA fluorescent probes are used to determine the presence of dengue virus and chikungunya virus in the target system under naked-eye detection under LED blue light.

[0179] Among them, the ssDNA fluorescent probe modified with FAM and biotin reporter gene is used in colloidal gold test strips to determine whether dengue virus and chikungunya virus are present in the target detection system.

[0180] 2. A method for visual detection of dengue virus and chikungunya virus based on the ERA-LbCas12a system

[0181] A method for visually detecting dengue virus and chikungunya virus using the aforementioned composition includes the following steps:

[0182] (1) Extract nucleic acid from the sample to be tested;

[0183] (2) Perform the following ERA reaction: RT-ERA amplification reaction was performed using a basic nucleic acid amplification kit (ERA method, KS102). Add 8 μL of premixed solvent, 9.2 μL of nucleic acid sample, 1 μL each of 10 μM RT-ERA forward and reverse primers, and 0.8 μL of 280 mM MgOAc to the bottom of the PCR tube. Mix well and incubate at 39℃ for 30 min to obtain the ERA product.

[0184] (3) Perform the following ERA-LbCas12a reaction: Add the following reaction mixture to the bottom of the PCR tube after ERA reaction: 0.625 μL crRNA (40 μM), 2.5 μL DNase I Reaction Buffer (NEB, B0303S), 1.25 μL LbCas12a (10 μM), and 0.625 μL reporter probe ssDNA (40 μM). After a brief centrifugation, add the mixture to the bottom of the PCR tube after the ERA reaction, vortex to mix, and place in a Bio-Rad CFX 96 real-time quantitative PCR instrument. Incubate at 39℃ for 30 min and detect the fluorescence signal intensity (RFU). Alternatively, after incubating at 39℃ for 30 min, place the tube under an LED blue light (UV flashlight) to visualize the results.

[0185] (4) The ERA-LbCas12a product is placed under LED blue light for naked-eye assessment, or the ERA-LbCas12a product is placed in a real-time quantitative PCR instrument for detection; if the ERA-LbCas12a product has no fluorescence or the fluorescence intensity is lower than the critical value (RFU = 886557), it indicates that the sample to be tested is not infected with dengue type I or the amount of dengue type I infection is lower than the detection limit; if the ERA-LbCas12a product has fluorescence or the fluorescence intensity is higher than the critical value (RFU = 886557), it indicates that the sample to be tested is infected with dengue type I virus; if the ERA-LbCas12a product has no fluorescence or the fluorescence intensity is lower than the critical value... If the fluorescence intensity of the ERA-LbCas12a product is above the threshold (RFU = 742307), it indicates that the sample is not infected with dengue type II or the amount of dengue type II infection is below the detection limit. If the ERA-LbCas12a product has fluorescence brightness or fluorescence intensity above the threshold (RFU = 742307), it indicates that the sample is infected with dengue type II virus. If the fluorescence intensity of the ERA-LbCas12a product is below the threshold (RFU = 970330), it indicates that the sample is not infected with biopores or the amount of biopore infection is below the detection limit. If the fluorescence intensity of the ERA-LbCas12a product is above the threshold (RFU = 970330), it indicates that the sample is infected with biopore virus.

[0186] (5) Add 30 μL of sample diluent to the ERA-LbCas12a product to dilute the sample. Take out the test strip and place it on a horizontal table (use as soon as possible). Be careful not to touch the NC membrane. Use a pipette or dropper to slowly add 80 μL of the sample to be tested drop by drop onto the sample well of the test strip. Read the results in 7-10 minutes.

[0187] Positive result: Both the control band and the test band show obvious red lines. Note: Weak staining of the test band is also considered a positive result. A positive result may be visible within 1-2 minutes.

[0188] Negative result: Only the control band shows a red line;

[0189] Invalid result: No red line appeared on the control band.

[0190] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A composition for diagnosing dengue virus and chikungunya virus, comprising a dengue virus RT-ERA primer pair, a chikungunya virus RT-ERA primer pair, crRNA, LbCas12a protease, and an ssDNA fluorescent probe; wherein the chikungunya virus RT-ERA primer pair is designed based on the target sequence SEQ ID NO:65; and the dengue virus RT-ERA primer pair is designed based on dengue virus type I target sequences and / or dengue virus type II target sequences, wherein... The dengue virus type I target sequence is SEQ ID NO:63, and the dengue virus type II target sequence is SEQ ID NO:

64.

2. The composition of claim 1, wherein, The chipovirus RT-ERA primer pair contains primers with nucleotide sequences of SEQ ID NO:27 and / or SEQ ID NO:32; preferably, the dengue type I virus EPA primer pair contains primers with nucleotide sequences of SEQ ID NO:12 and / or SEQ ID NO:14; preferably, the dengue type II virus EPA primer pair contains primers with nucleotide sequences of SEQ ID NO:17 and / or SEQ ID NO:

18.

3. The composition of claim 1, wherein, The crRNA is a dengue virus type I crRNA transcription template with the nucleotide sequence SEQ ID NO:45; and / or, The crRNA is a dengue virus type II crRNA transcription template with the nucleotide sequence SEQ ID NO:48; and / or, The crRNA is a transcription template for chipovirus crRNA with the nucleotide sequence SEQ ID NO:

56.

4. The composition according to any one of claims 1-3, wherein, The sequence of the ssDNA fluorescent probe is TTATT (SEQ ID NO:81), with a FAM (FITC) fluorescent reporter group at its 5' end and a BHQ1 quencher group or biotin reporter gene at its 3' end.

5. The composition according to any one of claims 1-4, further comprising universal reagents required for enzyme-catalyzed recombination isothermal amplification (RT-ERA) reaction systems, and / or universal reagents required for CRISPR-Cas12a cleavage systems.

6. Use of the composition according to any one of claims 1-5 in the preparation of reagents or kits for detecting dengue virus and / or chikungunya virus.

7. The use of the composition according to any one of claims 1-5 in the preparation of diagnostic reagents or kits for diagnosing dengue virus and / or chikungunya virus infection.

8. A method for detecting dengue virus and chikungunya virus, characterized in that, Includes the following steps: S1. Extract nucleic acid from the sample to be tested; S2. Using the nucleic acid of the sample to be tested as a template, an enzymatic recombination isothermal amplification reaction is performed using the RT-ERA primer pair in any one of claims 1-5 to obtain the EPA product; S3. Mix the crRNA, LbCas12a protease and ssDNA fluorescent probe described in claim 1 with the ERA product obtained in step S2 and perform a CRISPR-Cas12a cleavage reaction to obtain the enzyme digestion product. S4. Detect the fluorescence signal of the enzyme digestion product obtained in step S3; if the enzyme digestion product produces fluorescence, it is determined that the sample to be tested contains dengue virus and chikungunya virus; if the enzyme digestion product does not produce fluorescence, it is determined that the sample to be tested does not contain dengue virus and chikungunya virus. Preferably, the enzyme digestion product is placed in a BIO-RAD FX 96 fluorescence quantitative analyzer to detect the fluorescence intensity. If the relative fluorescence unit is higher than 886557, the sample is determined to contain dengue virus type I; if the relative fluorescence unit is lower than 886557, the sample is determined not to contain dengue virus type I. If the relative fluorescence unit is higher than 742307, the sample is determined to contain dengue virus type II; if the relative fluorescence unit is lower than 742307, the sample is determined not to contain dengue virus type II. If the relative fluorescence unit is higher than 970330, the sample is determined to contain chikungunya virus; if the relative fluorescence unit is lower than 970330, the sample is determined not to contain chikungunya virus.

9. The method of claim 8, further comprising: S5. Detect the enzyme digestion product obtained in step S3 using a colloidal gold test strip. If both the control band and the test band show obvious red lines, the sample is considered to contain dengue virus and chikungunya virus, and the test result is positive. If only the control band shows a red line, the sample is considered to not contain dengue virus and chikungunya virus, and the test result is negative. If no red line appears on the control band, the test result is invalid.

10. The method of claim 8 or 9, wherein, The system and conditions for the enzymatic recombination isothermal amplification reaction include: Bottom of PCR tube: 8 μL of premixed solvent, 9.2 μL of nucleic acid sample, 1 μL each of 10 μM RT-ERA forward and reverse primers, and 0.8 μL of 280 mM MgOAc; On the PCR tube cap: 1.251 μL LbCas12a (10 μM), 0.625 μL crRNA (40 μM), 2.5 μL 10*Reaction Buffer, 0.625 μL ssDNA (40 μM) fluorescent probe; mix the PCR tube well, then cap it and incubate at 39℃ for 30 min. Then, briefly centrifuge to add the reagents from the cap to the bottom of the PCR tube, mix well, and incubate at 39℃ for 30 min.

Images