Porcine reproductive and respiratory syndrome virus receptor CD163 key SRCR5 structural domain epitope peptide, epitope peptide vaccine and application

Abstract

The invention discloses a porcine reproductive and respiratory syndrome virus CD163 key SRCR5 structural domain epitope peptide, an epitope peptide vaccine and application. The epitope vaccine is good in safety, has no safety problems of virulence reversion, generation of viremia, recombination with other PRRSV strains and the like, has good immunogenicity, and can induce a pig to generate a specific antibody aiming at the CD163 SRCR5-FP14 epitope with the highest agglutination titer of 1: 16 14 days after secondary immunization, and the immunized pig can resist attack of a highly pathogenic PRRSV JAX1 strain. Each subtype strain of the PRRSV is dependent on interaction with a CD163 receptor so as to infect a host susceptible cell, and CD163 molecules are conservative, so that the epitope vaccine for blocking PRRSV infection also has a broad-spectrum protection effect on various subtype strains, the production performance of pigs is not influenced, and the novel epitope vaccine has a wide potential application prospect in PRRS prevention and control.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of veterinary biological products, and particularly relates to a porcine reproductive and respiratory syndrome virus receptor CD163 key SRCR5 domain epitope peptide and application thereof, in particular to an epitope vaccine capable of directly targeting a B cell epitope of a key SRCR5 domain of a porcine reproductive and respiratory syndrome virus CD163 receptor. BACKGROUND

[0002] Porcine reproductive and respiratory syndrome (PRRS) is a disease characterized by reproductive disorders in late pregnant sows and respiratory symptoms in pigs of all ages, which has caused significant economic losses to the global pig industry. The pathogen of PRRS, porcine reproductive and respiratory syndrome virus (PRRSV), is a single-stranded RNA virus with a capsule, which is classified into the order of Nidovirales, the family of Arteriviridae, and the genus of Betacoronavirus. According to the genomic variation of PRRSV, PRRSV is divided into PRRSV-1 (original European type PRRSV) and PRRSV-2 (original North American type PRRSV), and PRRSV-2 is currently prevalent in China.

[0003] At present, the main prevention and control measures for PRRSV in China are to use corresponding vaccines. There are various commercial vaccines for PRRSV in China, mainly including attenuated live vaccines and inactivated vaccines. Although these vaccines play an indispensable role in PRRS prevention and control, these vaccines still need to be optimized and improved in terms of safety and effectiveness. In terms of safety, PRRSV live vaccines can cause viremia in vaccinated pigs for up to four weeks; it is worth noting that attenuated live vaccines can have a virulence return; and attenuated live vaccine strains can recombine with wild-type strains; and attenuated live vaccines can also spread from vaccinated pigs to unvaccinated pigs, causing the spread of vaccine viruses. In terms of effectiveness, more and more reports indicate that the attenuated live vaccines with HP-PRRSV as the parent strain cannot provide complete protection against other subtypes of strains, such as how to target the prevention and control of NADC30-like strain infection which is currently prevalent. In addition, although PRRSV inactivated vaccines are relatively safe, they need to be repeatedly inoculated, and their effectiveness is controversial. Therefore, it is urgent to develop a more safe and effective PRRSV vaccine.

[0004] CD163 is a type I transmembrane glycoprotein with a short cytoplasmic tail, a transmembrane segment and 9 scavenger receptor cysteine-rich (SRCR) domains with a size of 130 kDa. Porcine CD163 is identified as the main receptor of PRRSV, which plays a crucial role in PRRSV infection. It is reported that the expression of CD163 in PRRSV non-susceptible cell lines such as 3D4 / 21, CHO, PK-15, BHK-21 can enable these originally non-PRRSV susceptible cells to allow PRRSV infection and replication, and gene edited pigs lacking functional CD163 and pulmonary alveolar macrophages (PAM) isolated from the gene edited pigs are resistant to PRRSV. The above evidence shows that CD163 is a key target for effective prevention and control of PRRSV. Targeting the receptor CD163 of PRRSV and blocking the key sites of CD163 of the host susceptible cells to mediate PRRSV infection is a new strategy for directly and effectively preventing and controlling PRRSV.

[0005] Notably, although multiple studies have shown that CD163 knockout pigs can completely resist PRRSV infection, since the CD163 gene is pleiotropic and plays an important role in other physiological processes of the body, complete inactivation of CD163 may affect the normal physiological health of pigs, and it is necessary to find the key site of precise interaction between CD163 protein and PRRSV. Multiple studies have found that the SRCR5 region of pig CD163 is crucial for successful PRRSV infection. For example, by sequentially deleting and replacing the important domains of CD163 protein, it was found that the SRCR5 domain of CD163 is essential in the process of PRRSV infection, while the N-terminal SRCR1-SRCR4 domain and intracellular region are not essential for PRRSV infection; the SRCR5 domain of CD163 protein was precisely deleted by CRISPR / Cas9 technology, and gene knockout pigs lacking this domain were prepared, and it was found that the deletion of SRCR5 domain had no effect on the body weight and blood cell count of pigs, and had no effect on the cell-specific surface markers of PAM cells and peripheral blood mononuclear cells (PBMCs), and PAM cells still had the biological activity of removing haemoglobin-haptoglobin complex (Hb-Hp), proving that the SRCR5-deleted CD163 protein can be correctly expressed, folded and localized on the cell surface to exert its biological function in PAM cells. Cell challenge experiments using PRRSV found that PAM cells lacking the SRCR5 domain could completely resist PRRSV-1 and PRRSV-2 infection. The above studies show that the SRCR5 domain in CD163 is a key region for mediating PRRSV infection.

[0006] Based on the limitations of existing PRRSV vaccines in safety and effectiveness and the key role of PRRSV receptor CD163 SRCR5 domain in PRRSV infection, a vaccine targeting the B cell epitope of the key SRCR5 domain of the CD163 receptor of susceptible cells mediating PRRSV infection is designed, so that the body can produce antibodies that can block and close the key SRCR5 domain of the CD163 receptor, thereby directly blocking PRRSV infection of susceptible cells, so that the epitope vaccine targeting the key SRCR5 domain of the PRRSV receptor CD163 has a broad potential application prospect in PRRSV prevention and control. Compared with the traditional PRRSV live vaccine and inactivated vaccine targeting the virus for vaccine design, the vaccine targeting the viral receptor has the following advantages: 1. It does not involve the virus strain, and there is no safety problem of PRRSV live vaccine causing viremia in vaccinated pigs, virulence returning to strong, recombination with other strains, etc.; 2. Because PRRSV evolves very fast, PRRSV-2 can be divided into at least 9 lineages, and more and more reports point out that the existing commercial PRRSV vaccine with classic PRRSV or HP-PRRSV as the parent strain cannot provide protection against the currently prevalent NADC30-like and NADC34-like strains. However, PRRSV strains of each lineage rely on interaction with CD163 to infect the host, and the pig CD163 gene is conserved, so the epitope vaccine targeting the key SRCR5 domain of the CD163 receptor mediating PRRSV infection also has a broad-spectrum protective effect against PRRSV strains of various lineages. SUMMARY

[0007] The purpose of the application is to overcome the limitations of existing PRRSV vaccines, and the technical problem to be solved by the application is to provide a novel epitope peptide.

[0008] The technical problem to be solved by the application is also to provide a nucleic acid molecule encoding the epitope peptide.

[0009] The technical problem to be solved by the application is also to provide an operon.

[0010] The technical problem to be solved by the application is also to provide an expression cassette, a recombinant expression vector, a recombinant cell or a recombinant strain.

[0011] The technical problem to be solved by the application is also to provide a method for constructing a recombinant expression vector and a recombinant strain.

[0012] The technical problem to be solved by the application is also to provide the use of the epitope peptide, the nucleic acid molecule, the operon, the expression cassette, the recombinant expression vector, the recombinant cell or the recombinant strain in the preparation of a pig PRRSV vaccine or a pig CD163 antibody detection reagent or kit.

[0013] The technical problem solved by the present application is to provide a PRRSV epitope vaccine which is safe, does not cause viremia in pigs, does not cause virulence reversion, does not recombine with other PRRSV strains, does not affect the production performance of pigs, and effectively resists infection of various subtypes of PRRSV strains.

[0014] The technical problem solved by the present application is to provide a PRRSV epitope vaccine which is safe, does not cause viremia in pigs, does not cause virulence reversion, does not recombine with other PRRSV strains, does not affect the production performance of pigs, and effectively resists infection of various subtypes of PRRSV strains.

[0015] Technical solution: In order to achieve the above-mentioned purposes of the present application, the present application provides, in one aspect, a key SRCR5 domain epitope peptide of a CD163 receptor of a host susceptible cell mediated by PRRSV infection, wherein the epitope peptide is a B cell epitope of a loop 5-6 region of a SRCR5 domain of a pig-derived CD163 protein, and the amino acid sequence thereof is shown as SEQ ID NO. 1.

[0016] The present application also includes a nucleic acid molecule encoding the epitope peptide, and the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO. 2.

[0017] The present application also includes an operon obtained by inserting the nucleic acid molecule into a F18 pilus fed operon sequence of Escherichia coli to replace nucleotides 268-309 in the fedA gene.

[0018] As a preferred embodiment, the operon is a fed-CD163-SRCR5-FP14 operon, wherein the nucleotide sequence of the operon is shown as SEQ ID NO. 3.

[0019] The present application also includes an expression cassette, a recombinant expression vector, a recombinant cell or a recombinant strain comprising the nucleic acid molecule or the operon.

[0020] The present application also includes a method for constructing a recombinant expression vector, comprising the following steps:

[0021] (1) obtaining a gene sequence of a key SRCR5 domain epitope peptide of a CD163 receptor of a host susceptible cell mediated by PRRSV infection, wherein the gene sequence is shown as SEQ ID NO. 2;

[0022] (2) inserting the gene sequence obtained in step (1) into a F18 pilus fed operon gene sequence to replace nucleotides 268-309 in the fedA gene to obtain a recombinant gene fragment, and then introducing the recombinant gene fragment into a vector to obtain a recombinant expression vector.

[0023] Preferably, the present application also provides a recombinant expression vector pBR-fed-CD163-SRCR5-FP14, which is obtained by cloning the fed-CD163-SRCR5-FP14 operon into a pBR322 vector for expression.

[0024] The present application also includes a method for constructing the recombinant strain, which comprises introducing the recombinant expression vector into a carrier bacterium by electroporation.

[0025] Preferably, the present application also provides a recombinant bacterium HB101 (pBR-fed-CD163-SRCR5-FP14) that displays and functionally expresses the CD163 receptor key SRCR5 domain FP14 epitope of PRRSV infection, which is obtained by introducing the recombinant expression vector pBR-fed-CD163-SRCR5-FP14 into the engineered bacterium HB101 of Escherichia coli by electroporation, inactivating it with formaldehyde, and verifying the functional display of the FP14 epitope on the surface of the recombinant bacterium HB101 (pBR-fed-CD163-SRCR5-FP14) by plate agglutination test and immunization of pigs.

[0026] The present application also includes the use of the epitope peptide, the nucleic acid molecule, the operon, the expression cassette, the recombinant expression vector, the recombinant cell or the recombinant strain in the preparation of a PRRSV vaccine for pigs or a pig CD163 antibody detection reagent or kit.

[0027] The present application also includes an epitope vaccine targeting the PRRSV CD163 receptor key SRCR5 domain FP14 epitope, which contains the epitope peptide, the nucleic acid molecule, the operon, the expression cassette, the recombinant expression vector, the recombinant cell or the recombinant strain.

[0028] As a preferred embodiment, the epitope vaccine of the present application includes the recombinant bacterium HB101 (pBR-fed-CD163-SRCR5-FP14) expressing FP14.

[0029] The epitope vaccine also includes a suitable immunoadjuvant acceptable to pigs.

[0030] The present application also includes an epitope-specific antibody obtained by immunizing an animal with the epitope vaccine.

[0031] The animal includes but is not limited to pigs.

[0032] The FP14 expressed HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine provided by the application has good immunogenicity, after immunizing the FP14 expressed HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine twice, the specific antibodies against the CD163 SRCR5-FP14 epitope with the highest agglutination titer of 1:16 can be induced in pigs, and meanwhile, the immunized pigs can be protected against the lethal challenge of the high pathogenic PRRSV JXA1 strain, compared with the control group, the immunized group does not appear adverse clinical manifestations, no pigs die, the duration of high fever is short, and the viremia is two orders of magnitude lower.

[0033] Advantages: Compared with the prior art, the present application has the following advantages: since the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressed by FP14 in the present application is inactivated by formaldehyde, and does not involve PRRSV strain pathogens, there is no safety problem of causing pigs to produce viremia, virulence returning to strong, recombination with other PRRSV strains and transmission to unvaccinated pigs, and the like, and the production performance of pigs is not affected after injection of the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressed by FP14, which indicates that the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine has excellent safety; secondly, on the 14th day after the second immunization of the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine, the immune pigs can produce specific antibodies against the CD163 SRCR5-FP14 epitope with the highest agglutination titer of 1:16, and can protect the immune pigs against the lethal challenge of the highly pathogenic PRRSV JXA1 strain to a certain extent, after the challenge, the immune group does not appear adverse clinical manifestations, no pigs die, and the duration of high fever is shorter, and the viremia is two orders of magnitude lower than that of the control group, which indicates that the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressed by FP14 can resist PRRSV infection and disease; in addition, since PRRSV evolves at a very fast speed, PRRSV-2 can be divided into at least 9 lineages, and more and more reports indicate that the existing commercial PRRSV vaccine with a classic PRRSV or HP-PRRSV as a parent strain cannot provide protection against the currently prevalent NADC30-like and NADC34-like strains, however, PRRSV strains of each lineage rely on interaction with CD163 to infect the host, and the pig CD163 gene is conserved, therefore, the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine against the FP14 epitope of the key SRCR5 domain of the CD163 receptor mediated PRRSV infection has a broad-spectrum protective effect against PRRSV strains of various lineages. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 It is a schematic diagram of the recombinant expression vector pBR-fed-CD163-SRCR5-FP14 plasmid.

[0035] Figure 2 It is a schematic diagram of the pUC57-fed recombinant plasmid.

[0036] Figure 3 It is a schematic diagram of the pUC57-fed-CD163-SRCR5-FP14 recombinant plasmid.

[0037] Figure 4 PCR amplification electrophoretogram for fed-CD163-SRCR5-FP14 operon, fed operon, wherein lane M is Trans 2K plus II DNA Marker; lane 1 is the genomic amplification product of DH5α engineering bacteria as a negative control; lane 2 is the genomic amplification product of F18ab pilus standard strain 107 / 86 (O139:K12:H1) as a positive control; lane 3 is the amplification product of pUC57-fed-CD163-SRCR5-FP14 plasmid; lane 4 is the PCR amplification product of pUC57-fed plasmid.

[0038] Figure 5 Restriction enzyme identification map for pBR-fed-CD163-SRCR5-FP14 plasmid, pBR-fed plasmid, wherein lane M is Trans 2K plus II DNA Marker; lane 1 is pBR-fed-CD163-SRCR5-FP14 plasmid; lane 2 is the product after double enzyme digestion of pBR-fed-CD163-SRCR5-FP14 plasmid using EcoR I and Eag I restriction enzymes; lane 3 is pBR-fed plasmid; lane 4 is the product after double enzyme digestion of pBR-fed plasmid using EcoR I and Eag I restriction enzymes.

[0039] Figure 6 PCR identification map for FP14-expressed HB101 (pBR-fed-CD163-SRCR5-FP14) recombinant bacteria, HB101 (pBR-fed) recombinant bacteria, wherein lane M is Trans 2K DNA Marker; lane 1 is a negative control (template is double distilled water ddH2O); lane 2 is the genomic amplification product of F18ab pilus standard strain 107 / 86 (O139:K12:H1) as a positive control; lane 3 is the amplification product of FP14-expressed HB101 (pBR-fed-CD163-SRCR5-FP14) recombinant bacteria; lane 4 is the amplification product of HB101 (pBR-fed) recombinant bacteria.

[0040] Figure 7 Body temperature changes of pigs after injection of FP14-expressed HB101 (pBR-fed-CD163-SRCR5-FP14) recombinant bacteria, wherein the body temperature of the HB101 (pBR-fed-CD163-SRCR5-FP14) injection group, the HB101 (pBR-fed) injection group, and the PBS injection group remained normal during the 14-day observation period.

[0041] Figure 8The weight change of pigs immunized with FP14-expressed HB101 (pBR-fed-CD163-SRCR5-FP14), wherein the weight gain of the pigs in the FP14-expressed HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group and the HB101 (pBR-fed) immunization control group has no significant difference with the weight gain of the pigs in the PBS injection group.

[0042] Figure 9 The titer change of CD163 SRCR5-FP14 epitope-specific antibodies in pigs immunized with FP14-expressed HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine, wherein the pigs immunized with FP14-expressed HB101 (pBR-fed-CD163-SRCR5-FP14) can all produce specific antibodies against the CD163 SRCR5-FP14 epitope, and the agglutination antibody titer of the pigs is the highest of 1:16 and the lowest of 1:4 at 14 days after the second immunization, while the pigs in the HB101 (pBR-fed) control group have no specific antibodies against the CD163 SRCR5-FP14 epitope at 14 days after the second immunization.

[0043] Figure 10 The clinical manifestations of pigs at 7 days post challenge (dpc), wherein the pigs in the FP14-expressed HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group have no abnormalities, while the pigs in the HB101 (pBR-fed) control group have clinical symptoms such as depression, anorexia, systemic redness, lying down, and cough after challenge.

[0044] Figure 11 The survival of pigs after challenge, wherein the pigs in the FP14-expressed HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group have no death within the observation period of 21 days after challenge, while the 5 pigs in the HB101 (pBR-fed) control group all die after challenge, with 1 pig dying at 9 dpc, 1 pig dying at 10 dpc, 2 pigs dying at 11 dpc, and 1 pig dying at 13 dpc.

[0045] Figure 12 The body temperature monitoring result graph of pigs after challenge, wherein only individual pigs in the FP14-expressed HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group have high fever, and the duration is short, while the pigs in the HB101 (pBR-fed) control group have sustained high fever from the second day after challenge, and the duration is long, until the pigs appear moribund.

[0046] Figure 13Figure 6 is a graph of body weight monitoring results after challenge, in which the body weight of the pigs in the HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group expressing FP14 remained increasing after challenge, while the body weight of the pigs in the HB101 (pBR-fed) control group decreased after challenge.

[0047] Figure 14 Figure 7 is a graph of viremia monitoring results after challenge, in which the viremia of the pigs in the HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group expressing FP14 was about two orders of magnitude lower than that of the HB101 (pBR-fed) control group. DETAILED DESCRIPTION

[0048] The embodiments of the present application will be further described below with reference to the examples. Obviously, the examples are intended to describe the present application by way of example only, and should not be considered as limiting the scope of the present application. In addition to the specific methods, devices, and materials described in the examples, any methods, devices, and materials similar or equivalent to those described in the examples of the present application can be used according to the knowledge of those skilled in the art of the present technology and the description of the present application to implement the present application.

[0049] Example 1, Obtaining of a B cell epitope of a key SRCR5 domain of porcine CD163 receptor

[0050] The B cell epitope prediction online website (https: / / www.iedb.org / ) was used to predict the B cell epitope of the amino acid sequence of the porcine CD163 protein uploaded in the National Center for Biotechnology Information (NCBI) (GenBank Accession Number: NP_999141.1). According to the amino acid score results predicted by the website, the B cell epitope in the CD163 SRCR5 loop 5-6 region was selected, the 3 overlapping B cell epitopes in the CD163 SRCR5 loop 5-6 region were optimized, and the finally selected epitope was named WL14 (WAEEFQCEGHESHL), FP14 (SEQ ID NO. 1: FQCEGHESHLSLCP), GR14 (GHESHLSLCPVAPR).

[0051] (WAEEFQCEGHESHL), FP14 (SEQ ID NO. 1: FQCEGHESHLSLCP), GR14

[0052] (GHESHLSLCPVAPR).

[0053] The nucleotide sequence of the B cell epitope of the key SRCR5 domain of the pig CD163 receptor is: WL14 (TGGGCTGAAGAATTCCAGTGTGAGGGGCACGAGTCCCACCTTTCACTCTGCCCAGTAGCACCCCGCCCTGACGGGACATGT), FP14 (SEQ ID NO. 2: TTCCAGTGTGAGGGGCACGAGTCCCACCTTTCACTCTGCCCA), GR14 (GGGCACGAGTCCCACCTTTCACTCTGCCCAGTAGCACCCCGCCCTGACGGGACATGTAGCCACAGCAGGGACGTCGGCGTA). Since the different B cell epitopes only differ in sequence, the recombinant bacteria containing the above epitopes will be constructed as follows.

[0054] Example 2, Construction of recombinant bacteria expressing the B cell epitope of the key SRCR5 domain of the CD163 receptor on the surface (taking the FP14 epitope as an example)

[0055] To use the F18 pilus to present the FP14 epitope of the key SRCR5 domain of the CD163 receptor, and thus construct a pig-derived immune delivery system, the F18 pilus operon fed (GenBank accession number: CP080237.1, location: 18423-23831) of F18ab E. coli (O139:H1:F18ab) uploaded in NCBI and the amino acid sequence of its main subunit FedA were analyzed, and the position with strong immunogenicity in FedA was replaced with the key epitope FP14 of the key SRCR5 domain of the CD163 receptor. The replacement position is aa 90-103 from the N terminus of FedA protein, and the position in the fedA gene is 268-309 bp. A recombinant plasmid pUC57-fed containing the full-length sequence of the fed operon of F18ab E. coli (O139:H1:F18ab) was synthesized by Beijing Qikexin Biotechnology Co., Ltd. (the plasmid map is shown in Figure 2, and the full-length sequence of the fed operon is shown in SEQ ID NO. 1). Figure 2 The fed operon was inserted between the Sal I and EcoR I enzyme digestion sites of the pUC57 plasmid), and a pUC57-fed-CD163-SRCR5-FP14 recombinant plasmid containing the full-length sequence of the fed-CD163-SRCR5-FP14 operon after replacement of fedA (the plasmid map is shown in Figure 3, and the full-length sequence of the fed-CD163-SRCR5-FP14 operon is shown in SEQ ID NO. 3). Figure 3 The fed-CD163-SRCR5-FP14 operon was inserted between the Sal I and EcoR I enzyme digestion sites of the pUC57 plasmid). At the same time, a pair of full-length amplification primers was designed for the fed operon, the upstream primer being fed-F: 5'-CAGC GTCGACGTGAAAAGACTAGTGTTTATTTCTTTTGTT-3', the lower primer is fed-R: 5'-GAT CGGCCG TTACTGTATCTCGAAAACAATGGGC-3', the underlined sequences represent Sal I and Eag I restriction enzyme sites respectively, the primers were synthesized by Beijing Genesee Biotech Co., Ltd. fed and fed-CD163-SRCR5-FP14 full-length were amplified using the pUC57-fed and pUC57-fed-CD163-SRCR5-FP14 synthesized by the company as templates and the upper and lower primers fed-F / R, the amplification system was pfu high-fidelity DNA Polymerase (Beijing Zhenxisi Biological Technology Co., Ltd., Catalog No.: AP221-11) 1 μL, 5×pfu DNA polymerase buffer 10 μL, dNTPs 4 μL, the upper and lower primers (10 μM) 1 μL each, pUC57-fed-CD163-SRCR5-FP14 / pUC57-fed template 1 μL, ultrapure water 32 μL. The above system was mixed uniformly and then PCR amplification was carried out using a PCR instrument (Bio-Rad). The PCR program was 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 5 min, 30 cycles; 72°C extension for 10 min again; after the amplification was completed, the temperature was reduced to 12°C for preservation. The genome of F18ab pilus standard strain 107 / 86 (O139:K12: H1) (donated by the University of Pennsylvania School of Veterinary Medicine Microbiology Laboratory, preserved in the laboratory, Zhang Jianjun. Cloning, expression and preliminary study on biological activity of fed gene of E. coli F18 pilus operon [D]. Yangzhou University, 2005) was used as a positive control; the genome of E. coli engineering bacteria DH5α was used as a negative control.

[0056] The PCR product was electrophoresed in a 1.0% agarose gel at 110 V, and after electrophoresis, the results were observed using a gel imaging instrument (Bio-Rad) after staining with ethidium bromide. The results are shown in Figure 1. Figure 4As shown, F18ab pilus standard strain 107 / 86 (O139:K12:H1) and pUC57-fed-CD163-SRCR5-FP14, pUC57-fed both amplified 5428bp DNA products, while the genome of E. coli engineering strain DH5a did not amplify any band. The full length of fed-CD163-SRCR5-FP14 operon amplified by pUC57-fed-CD163-SRCR5-FP14 and the full length of fed operon amplified by pUC57-fed were purified using universal DNA purification recovery kit (Tiangen Biotech (Beijing) Co., Ltd., Cat No: DP214) and stored at -20℃ for later use.

[0057] The purified fed-CD163-SRCR5-FP14, fed operon and pBR322 plasmid (purchased from Moliol plasmid platform) were double digested by Sal I (NEB, Cat No: R3138L) and Eag I restriction endonuclease (NEB, Cat No: R3505L), 1.0% agarose gel was prepared and electrophoresis was performed at 110V, the target band was cut and purified using universal DNA purification recovery kit, then the purified pBR322 plasmid digestion fragments were respectively connected with fed-CD163-SRCR5-FP14 operon digestion fragments and fed operon digestion fragments at 16℃ metal bath overnight, the next day the ligation products were transformed into DH5a competent cells (Shanghai Blue Sky Bio-Technology Co., Ltd., Cat No: D1031S), and plated on solid medium containing 100 μg / mL ampicillin (Amp; Beijing Solabio Technology Co., Ltd., Cat No: A8180) for resistance screening. After 16h of inverted culture at 37℃, single colonies on the plate were inoculated into 100 μg / mL Amp + LB liquid medium, after overnight culture, the plasmid was extracted using rapid plasmid extraction kit (Tiangen Biotech (Beijing) Co., Ltd., Cat No: DP105), and the plasmid was double digested by EcoR I (NEB, Cat No: R3101S) and Eag I restriction endonuclease. 1% agarose gel was prepared, the digestion products were electrophoresed at 110V for 45min, then stained with ethidium bromide and imaged under ultraviolet imager. The results are shown in Figure 5. Figure 5 As shown, recombinant plasmid pBR-fed-CD163-SRCR5-FP14 (plasmid map as shown in Figure 6) and pBR-fed were digested by EcoR I (NEB, Cat No: R3101S) and Eag I restriction endonuclease, 1% agarose gel was prepared, the digestion products were electrophoresed at 110V for 45min, then stained with ethidium bromide and imaged under ultraviolet imager. The results are shown in Figure 7. Figure 1The pBR-fed-CD163-SRCR5-FP14 plasmid was sent to Beijing Genesee Biotech Co., Ltd. for sequencing with the identification primers. It was found that the CD163 SRCR5-FP14 was inserted into the expected position in fedA.

[0058] The E. coli engineering strain HB101 was preserved in the laboratory and stored in a -80°C cryotube. The E. coli HB101 was streaked on an LB plate and incubated at 37°C overnight. A single colony was picked and inoculated in 4 mL of fresh LB medium and incubated at 37°C, 220 rpm overnight. After one generation, the bacterial solution was inoculated into 40 mL of fresh LB medium at a volume ratio of 1:100. When the OD 600 = 0.4-0.6, the bacterial solution was ice-bathed for 30 min, centrifuged at 4°C, 4000 rpm for 10 min, then resuspended with pre-cooled 10% glycerol, centrifuged at 4°C, 4000 rpm for 10 min, and washed with 10% glycerol for 3 times. Finally, 40 μL of 10% glycerol was used to resuspend 4 mL of bacterial solution, and 100 μL was aliquoted to prepare the HB101 electrocompetent cells. The recombinant plasmid pBR-fed-CD163-SRCR5-FP14 and pBR-fed were electroporated into the HB101 electrocompetent cells using an electroporation instrument (Bio-Rad) at a voltage of 1.8 KV. Then, 1 mL of SOC medium (Qingdao Gaoke High-tech Industrial Park Haibo Biotechnology Co., Ltd., Catalog No.: HBDC002) was added, and the mixture was incubated at 37°C for 1 h. 200 μL of bacterial solution was spread on an LB plate containing 100 μg / mL Amp + The positive clone containing pBR-fed-CD163-SRCR5-FP14 was named HB101 (pBR-fed-CD163-SRCR5-FP14), and the positive clone containing pBR-fed was named HB101 (pBR-fed). Figure 6 The positive clone containing pBR-fed-CD163-SRCR5-FP14 was named HB101 (pBR-fed-CD163-SRCR5-FP14), and the positive clone containing pBR-fed was named HB101 (pBR-fed).

[0059] The recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) and HB101 (pBR-fed) were cultured in LB liquid medium containing 100 μg / mL Amp + to the platform phase, then added with formaldehyde aqueous solution (National Pharmaceutical Group Chemical Reagent Co., Ltd., item number: 10010018) to a final concentration of 0.3% (v / v), inactivated at 4°C for 3 days, centrifuged at 4000 rpm for 10 min, then the supernatant was discarded, resuspended with an equal volume of PBS, washed twice in succession to prepare the recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) and HB101 (pBR-fed) bacterial suspension, and adjusted to a final concentration of 1 x 10 10 CFU / mL.

[0060] The construction method of the recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-WL14) based on the expression of WL14 epitope and the recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-GR14) based on the expression of GR14 epitope was the same as that of the recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14).

[0061] Example 3, Functional verification of the recombinant bacteria expressing the CD163 receptor key SRCR5 domain B cell epitope on the surface

[0062] To verify whether the CD163 receptor key SRCR5 domain WL14 epitope, FP14 epitope and GR14 epitope are correctly expressed on the surface of HB101 vector bacteria, the prepared recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-WL14), recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14), recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-GR14) and HB101 (pBR-fed) bacterial suspension were respectively subjected to agglutination test with CD163 rabbit polyclonal antibody (Wuhan Dr. De Biological Engineering Co., Ltd., Item No.: A00812-1), and the results are shown in Table 1. The recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-WL14), recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) and recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-GR14) all produced agglutination reaction with CD163 rabbit polyclonal antibody, but did not react with non-immune rabbit serum (prepared in the laboratory, collected from healthy rabbit ear marginal vein blood after coagulation and centrifugation), while the HB101 (pBR-fed) control did not react with CD163 rabbit polyclonal antibody and non-immune rabbit serum, indicating that the CD163 receptor key SRCR5 domain WL14 epitope, FP14 epitope and GR14 epitope are correctly expressed on the surface of HB101 vector bacteria. At the same time, agglutination titer detection of CD163 rabbit polyclonal antibody using recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-WL14), recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) and recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-GR14) found that recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) could detect higher antibody titer, indicating that the immunogenicity of FP14 epitope is stronger, and therefore HB101 (pBR-fed-CD163-SRCR5-FP14) recombinant bacteria expressing the surface-expressed CD163 receptor key SRCR5 domain FP14 epitope were used for related experiments.

[0063] Table 1 Verification of expression of CD163 receptor key SRCR5 domain B cell epitope on the surface of HB101

[0064]

[0065] Note: “-” represents no agglutination particles, negative; “+ 1:1” represents the presence of agglutination particles, positive, and the agglutination antibody titer is 1:1; “+ 1:4” represents the presence of agglutination particles, positive, and the agglutination antibody titer is 1:4.

[0066] To verify whether the recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) with correct surface presentation and functional expression of CD163 SRCR5-FP14 epitope can induce pigs to produce specific antibodies against CD163 SRCR5-FP14 epitope, 6 healthy 28-day-old weaned piglets were purchased from Taizhou Taihe Biotechnology Co., Ltd. After 3 days of adaptation, 3 piglets were injected with HB101 (pBR-fed-CD163-SRCR5-FP14) recombinant bacteria in the neck muscle, and the other 3 piglets were injected with HB101 (pBR-fed) in the neck muscle as a control. The amount of bacteria injected into all pigs was 1 x 10 10 CFU / head. After 14 days, the whole blood of all pigs was collected and the serum was separated, and the CD163 SRCR5-FP14 epitope-specific agglutinating antibodies in the serum of pigs were detected using the CD163 SRCR5-FP14 epitope-specific agglutinating antibody detection method constructed in the laboratory. The specific steps of the CD163 SRCR5-FP14 epitope-specific agglutinating antibody detection method are as follows:

[0067] 1. The main subunit pegA (its position in the peg operon is 1-177 aa) of Salmonella gallinarum CVCC 526 (purchased from the China Institute for Veterinary Drug Control and preserved in the laboratory, Yang Weifeng. Preparation and preliminary clinical application of anti-Salmonella PEG fimbria monoclonal antibody [D]. Yangzhou University, 2016.) peg operon was analyzed using the B cell epitope prediction website (https: / / www.iedb.org / ), and the position with stronger immunogenicity in pegA was replaced with the CD163 SRCR5-FP14 epitope. The replacement site is from the N terminus of pegA protein aa 59-72, and the replacement sequence is: DRLTDLNPGDIYTG. The replacement site in the pegA gene is 175-216 bp, and the replacement sequence is: GATAGATTGACTGACTTAAACCCTGGCGATATATATACAGGA.

[0068] 2. The recombinant expression vector pBR322-peg-CD163-SRCR5-FP14 (SEQ ID NO. 4) containing the chimeric gene peg-CD163-SRCR5-FP14 was synthesized by Beijing Chengke Biological Technology Co., Ltd.

[0069] 3. The pBR322-peg-CD163-SRCR5-FP14 was electroporated into the inert carrier S9H (the general inert carrier S9H patent number: ZL202010427735.8) developed in the laboratory to obtain the S9H (pBR322-peg-CD163-SRCR5-FP14) detection antigen bacteria which correctly present the expression CD163 SRCR5-FP14 epitope on the surface.

[0070] 4. 5 μL of different dilutions of pig serum were mixed with 5 μL of S9H (pBR322-peg-CD163-SRCR5-FP14) detection antigen bacteria and 5 μL of S9H (pBR322-peg) control antigen bacteria (constructed in the laboratory earlier, patent number: ZL202410695247.3, neutralizing epitope QT7 of the main glycoprotein GP5 of the North American type porcine reproductive and respiratory syndrome virus envelope, nucleic acid molecule, expression vector, neutralizing antibody and its application) to carry out plate agglutination test, thereby qualitatively and quantitatively detecting specific antibodies against CD163 SRCR5-FP14 epitope in pig serum.

[0071] The specific antibodies against CD163 SRCR5-FP14 epitope produced by pigs induced by HB101 (pBR-fed-CD163-SRCR5-FP14) recombinant bacteria are shown in Table 2 below. All pigs in the HB101 (pBR-fed-CD163-SRCR5-FP14) injection group produced specific antibodies against CD163 SRCR5-FP14 epitope on the 14th day after injection, and the antibody titers of two pigs were 1:4 and the antibody titer of one pig was 1:2, while the pigs in the HB101 (pBR-fed) control group did not produce antibodies against CD163 SRCR5-FP14 epitope.

[0072] Table 2 Production and testing of CD163 SRCR5-FP14 epitope specific antibodies

[0073]

[0074] Note: “-” represents no agglutination particles, negative; “+ 1:4” represents the presence of agglutination particles, positive, and the agglutination antibody titer is 1:4; “+ 1:2” represents the presence of agglutination particles, positive, and the agglutination antibody titer is 1:2.

[0075] Example 4, Safety evaluation of recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressing FP14 epitope

[0076] To investigate whether the FP14 epitope vaccine of the recombinant bacteria-expressing FP14, HB101 (pBR-fed-CD163-SRCR5-FP14), would have adverse effects on the health and production of pigs, 15 PRRSV antigen and antibody negative weaned piglets (Taizhou Taihe Biotechnology Co., Ltd.) at 28 days of age were divided into three groups. After 3 days of adaptation, 5 piglets were injected with inactivated FP14-expressing HB101 (pBR-fed-CD163-SRCR5-FP14) bacterial suspension in the neck muscle, 5 piglets were injected with inactivated HB101 (pBR-fed) bacterial suspension in the neck muscle, and all piglets were injected with 1 x 10 10 CFU / piglet, and another 5 piglets were injected with the same dose of PBS and raised separately in another room. After injection, all test pigs were observed and monitored for 14 consecutive days for mental state, diet, body temperature, body weight, injection site, and injection absorption. All aspects of animal testing (feeding, operation, and euthanasia) in the present application were strictly performed in accordance with the requirements of the Yangzhou University Experimental Animal Welfare and Ethics Committee. The results showed that during the observation period, no obvious clinical symptoms were observed in each injection group, and the mental state of the pigs in each group was good, and the feeding and drinking were normal; the body temperature was normal Figure 7 ); compared with the PBS injection group, there was no significant difference in body weight gain in the FP14-expressing HB101 (pBR-fed-CD163-SRCR5-FP14) injection group and the HB101 (pBR-fed) injection group Figure 8 ); and no local adverse inflammatory reactions such as redness and induration were observed at the injection site. The above results indicated that the FP14-expressing HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine had good safety.

[0077] Table 3 Clinical observation of pigs injected with FP14-expressing HB101 (pBR-fed-CD163-SRCR5-FP14) recombinant bacteria

[0078]

[0079] Example 5 Evaluation of the effectiveness of the FP14 epitope-expressing recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine

[0080] To investigate whether the recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) expressing the FP14 epitope vaccine can provide protection against PRRSV challenge, 10 PRRSV antigen and antibody negative weaned piglets (Taizhou Taihe Biotechnology Co., Ltd.) at 28 days of age were divided into two groups. After 3 days of adaptation, 5 pigs in the neck muscle were injected with inactivated HB101 (pBR-fed-CD163-SRCR5-FP14) bacterial suspension as the immunized group, and the other 5 pigs in the neck muscle were injected with inactivated HB101 (pBR-fed) bacterial suspension as the control group. The amount of bacteria injected into all pigs was 1×10 10 CFU / each, and the second immunization was performed 14 days after the first immunization. All pigs were challenged 14 days after the second immunization. The challenge strain was the highly pathogenic PRRSV JXA1 strain (donated by Yangzhou Youbang Biopharmaceutical Co., Ltd.), and the challenge dose was 1×10 4.5 TCID 50 / mL, 2 mL / each, and the challenge route was nasal challenge, 1 mL in each nostril. The immunization and challenge procedures are shown in Table 4.

[0081] Table 4 Immunization and challenge procedures

[0082]

[0083] After challenge, all pigs were monitored for clinical symptoms, body temperature, and body weight for 21 consecutive days. The sera of all pigs were collected at 14 dpi (day post inoculation), 28 dpi, 3 dpc (day post challenge), 5 dpc, 7 dpc, 14 dpc, and 21 dpc. The CD163 SRCR5-FP14 epitope-specific antibodies in the sera of pigs at 14 dpi and 28 dpi were detected using the previously constructed CD163 SRCR5-FP14 epitope-specific antibody detection method. At the same time, the virus viremia of the challenged pigs was detected by the fluorescence quantitative detection method in the reference (Transbound Emerg Dis. 2019 Nov; 66(6): 2271-2278.).

[0084] The results show that after immunization of the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine, the pigs can produce specific antibodies against the CD163 SRCR5-FP14 epitope, and on the 14th day after the second immunization, the agglutination antibody titer against the CD163 SRCR5-FP14 epitope in the immunized pigs is the highest of 1:16 and the lowest of 1:4, while the control group injected with HB101 (pBR-fed) cannot detect specific antibodies against the CD163 SRCR5-FP14 epitope, and the production of CD163 SRCR5-FP14 epitope specific antibodies is as shown in Table 2. Figure 9

[0085] After challenge, the HB101 (pBR-fed) control group showed clinical symptoms such as depression, decreased appetite, lying still, redness all over the body, coughing, etc., while the recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine immunization group did not show obvious clinical symptoms Figure 10 ); and the HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group did not have pigs die during the observation period, while the HB101 (pBR-fed) control group had 5 pigs die, and the specific death time and number of pigs were: 1 pig died at 9dpc, 1 pig died at 10dpc, 2 pigs died at 11dpc, and 1 pig died at 13dpc Figure 11 ). In terms of body temperature monitoring results, the HB101 (pBR-fed) control group began to have pigs with fever on the second day, and then all pigs had persistent high fever until the pigs showed signs of impending death, while the recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group only had individual pigs with high fever, and the duration of high fever was shorter Figure 12 ). After challenge, although the pigs in the recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group showed slow growth from 7dpc to 14dpc, all pigs showed continuous growth, while the pigs in the HB101 (pBR-fed) control group showed weight loss Figure 13 ). After challenge, compared with the viremia in the HB101 (pBR-fed) control group, the viremia in the pigs of the recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group was about two orders of magnitude lower, and the average viral copy number in the blood of the recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) immunization group was 10 3.8 copies / μL at 3dpc, while the average viral copy number in the blood of the HB101 (pBR-fed) control group was 10 6.2 ​copies / μL; at 5 dpc, the average viral copy number in the blood of the pigs immunized with the recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) was 10 5.2 copies / μL, while the average viral copy number in the blood of the pigs in the HB101 (pBR-fed) control group was 10 6.8 copies / μL; at 7 dpc, the average viral copy number in the blood of the pigs immunized with the recombinant bacteria HB101 (pBR-fed-CD163-SRCR5-FP14) was 10 4.8 copies / μL, while the average viral copy number in the blood of the pigs in the HB101 (pBR-fed) control group was 10 6.3 copies / μL Figure 14 ). The above results show that the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressing the FP14 epitope of the key SRCR5 domain of the CD163 receptor mediating PRRSV infection can provide certain immune protection for pigs subjected to an attack by highly pathogenic PRRSV.

[0086] In summary, the present application provides the epitope FP14 of the key SRCR5 domain of the CD163 receptor mediating PRRSV infection and the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine expressing the FP14 epitope. The HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine is safe, and no adverse reactions occur in the immunized pigs, and does not affect the production performance of the pigs. Since the HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine does not involve PRRSV strains, and has been inactivated using formaldehyde, there are also no safety problems such as the occurrence of viremia, the return of virulence, recombination with other PRRSV strains, and transmission to unvaccinated pigs caused by existing PRRSV live vaccines. The HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine can protect the immunized pigs against lethal challenge by the highly pathogenic PRRSV JXA1 strain. The HB101 (pBR-fed-CD163-SRCR5-FP14) epitope vaccine against the FP14 epitope of the key SRCR5 domain of the CD163 receptor mediating PRRSV infection has a broad-spectrum protective effect against multiple lineages of PRRSV strains.

Claims

1. A key SRCR5 domain epitope peptide of the CD163 receptor in host susceptible cells that mediates PRRSV infection, characterized in that... The epitope peptide is a B-cell epitope in the loop 5-6 region of the SRCR5 domain of porcine CD163 protein, and its amino acid sequence is shown in SEQ ID NO.

1.

2. A nucleic acid molecule encoding the epitope peptide of claim 1, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

2.

3. An operator, characterized in that, The operon is used to insert the nucleic acid molecule described in claim 2 into the F18 fimbriae of *E. coli*. Fed Replacement in the manipulator fedA It is obtained from nucleotides 268 to 309 in the gene.

4. The operator according to claim 3, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

3.

5. An expression cassette, a recombinant expression vector, a recombinant cell or a recombinant bacterial strain, characterized in that, It comprises the nucleic acid molecule of claim 2 or the operon of claim 3 or 4.

6. The method for constructing the recombinant expression vector according to claim 5, characterized in that, Includes the following steps: (1) Obtaining the gene sequence of the key SRCR5 domain epitope peptide of the CD163 receptor in host susceptible cells that mediates PRRSV infection, the gene sequence being shown in SEQ ID NO.2; (2) Insert the gene sequence obtained in step (1) into the F18 fimbriae. Fed Replacement in the manipulator fedA The recombinant gene fragment is obtained from nucleotides 268 to 309 of the gene, and then introduced into a vector to obtain a recombinant expression vector.

7. The method for constructing the recombinant strain according to claim 5, characterized in that, The method comprises introducing the recombinant expression vector of claim 5 into a vector bacterium via electroporation.

8. The use of the epitope peptide of claim 1, the nucleic acid molecule of claim 2, the operon of claim 3 or 4, the expression cassette of claim 5, the recombinant expression vector, the recombinant cell or the recombinant strain in the preparation of porcine PRRSV vaccine or porcine CD163 antibody detection reagent or kit.

9. An epitope vaccine targeting the FP14 epitope of the key SRCR5 domain of the PRRSV CD163 receptor, characterized in that, The epitope vaccine comprises the epitope peptide of claim 1, the nucleic acid molecule of claim 2, the operon of claim 3 or 4, the expression cassette of claim 5, the recombinant expression vector, the recombinant cell or recombinant strain, and preferably, the epitope vaccine further comprises a suitable immune adjuvant acceptable to pigs.

10. An epitope-specific antibody, characterized in that, The specific antibody is obtained by immunizing animals with the epitope vaccine according to claim 9.

Images