Weissella fusiformis JWC120 and application thereof

Abstract

The invention relates to the technical field of microorganisms, in particular to Weissella fusiformis JWC120 with a function of inhibiting common harmful bacteria in animal breeding and application of the Weissella fusiformis JWC120. The Weissella fusiformis JWC120 with the function of inhibiting common harmful bacteria in animal breeding, provided by the invention, has the preservation number of CGMCC No.31945, and can effectively inhibit common escherichia coli, salmonella, staphylococcus aureus and shigella in animal breeding; a bacteriocin crude extract of the strain has a remarkable inhibition effect on common staphylococcus aureus in animal breeding, and has a good application prospect in animal disease prevention and treatment and development of livestock and poultry breeding health-care products.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a fusion strain of Weissella JWC120 that has the function of inhibiting common harmful bacteria in animal husbandry and its application. Background Technology

[0002] Lactic acid bacteria preparations, as a new type of green feed additive, are safe, high-quality, and have no toxic side effects. They are receiving increasing attention and have good application prospects.

[0003] Weissella is a newly emerging lactic acid bacteria, belonging to the order Lactobacilliles and the genus Weissella. It is part of the normal intestinal flora and is currently mainly used in human food fermentation production. Fusion Weissella is a type of Weissella, and as a fermentation microorganism with important functions, it has been widely used in various fermented foods such as yogurt, kimchi, soy sauce, and alcoholic beverages. Fusion Weissella not only produces lactic acid during fermentation but also promotes the formation of other fermentation products such as alcohols, esters, and acids, significantly influencing the flavor characteristics of the products. Furthermore, Fusion Weissella may inhibit the growth of harmful microorganisms in the fermentation environment by producing organic acids and antimicrobial substances, thereby promoting the dominance of beneficial bacteria. Currently, the application of Fusion Weissella in animal production is relatively limited.

[0004] Staphylococcus aureus, Salmonella, and other opportunistic pathogens found in nature are important zoonotic pathogens. They colonize and infect animals through the skin, damaged mucous membranes, and respiratory tract, causing severe diseases such as bacteremia, septicemia, and pneumonia. For a long time, antibiotics have been the primary means of controlling harmful bacterial infections in animal husbandry. However, long-term use of antibiotics can lead to drug resistance in pathogens, causing environmental pollution, disrupting ecological balance, and creating food safety issues, directly threatening human and animal health. Compared to antibiotics, bio-based agents have the advantages of being non-toxic and environmentally friendly, making research on bio-based agents that can inhibit the growth of pathogens of great significance. Summary of the Invention

[0005] To address the problems of antibiotic resistance in pathogenic bacteria such as Staphylococcus aureus and Salmonella caused by antibiotic use in animal husbandry, leading to environmental pollution and food safety issues, and the limited availability of effective microbial agents to inhibit Staphylococcus aureus and Salmonella, this invention provides a strain of Weissella fusion JWC120 that inhibits common harmful bacteria in animal husbandry and its applications, thus solving the aforementioned problems.

[0006] The Fusion Weissella JWC120 (also referred to herein as strain JWC120, JWC120 strain or JWC120) provided by this invention has the function of inhibiting common harmful bacteria in animal breeding. Its accession number at the China General Microbiological Culture Collection Center (CGMCC) is CGMCC No. 31945.

[0007] Preferably, the animals refer to pigs and chickens.

[0008] The present invention also provides a crude bacteriocin extract, obtained from the fused Weissella JWC120, which has the function of inhibiting Staphylococcus aureus, a common bacterium in animal husbandry.

[0009] Preferably, the extraction method is as follows: add saturated ammonium sulfate with a concentration of 60% to the supernatant of the above-mentioned Fusion Weissl JWC120 fermentation broth, stir until dissolved, centrifuge and discard the supernatant, collect the precipitate; resuspend the precipitate with deionized water, and the resulting resuspended solution is the crude bacteriocin extract of Fusion Weissl JWC120.

[0010] Preferably, the preparation method of the fusion Weissella JWC120 fermentation broth is as follows: the fusion Weissella JWC120 is inoculated into MRS liquid medium and cultured at 37°C for 18 hours. Then, it is inoculated into new MRS medium at a 1% inoculation rate and cultured at 37°C for 48 hours to obtain the fermentation broth of the fusion Weissella strain.

[0011] The present invention also provides a livestock and poultry breeding health product, the active ingredient of which is the above-mentioned crude extract of bacteriocins.

[0012] Preferably, the product is a solid or liquid bacterial agent.

[0013] The present invention also provides a method for preparing the above-mentioned livestock and poultry breeding health products, including culturing the fused Weissella strain, preparing a crude bacteriocin extract of the strain, and using the crude bacteriocin extract as the active ingredient of the livestock and poultry breeding health products.

[0014] Preferably, the method for preparing the crude bacteriocin extract of *Westernella* is as follows: add saturated ammonium sulfate with a concentration of 60% to the supernatant of the fermentation broth of *Westernella* fusion, stir until dissolved, centrifuge, discard the supernatant, and collect the precipitate; resuspend the precipitate with deionized water, and the resulting resuspended solution is the crude bacteriocin extract of *Westernella* fusion.

[0015] The application of the fused Weissella JWC120 in inhibiting Escherichia coli, Salmonella, Staphylococcus aureus, and Shigella in animal husbandry also falls within the scope of protection of this invention.

[0016] The application of the crude bacteriocin extract in inhibiting Staphylococcus aureus in animal husbandry also falls within the scope of protection of this invention.

[0017] The patent accession information for the Fusion Weissella JWC120, which has the function of inhibiting common harmful bacteria in animal husbandry, provided by this invention, is as follows: Biomaterial (strain): JWC120 Classification and nomenclature: Fusion Weissella Weissella confusa Deposit date: September 11, 2024 Accession Number: CGMCC No. 31945 Preservation Institution: China General Microbiological Culture Collection Center (CGMCC) Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0018] The beneficial effects of this invention are as follows: The fusion Weissella JWC120 provided by this invention, which has the function of inhibiting common harmful bacteria in animal breeding, can effectively inhibit Escherichia coli, Salmonella, Staphylococcus aureus, and Shigella, which are common in animal breeding. Its crude bacteriocin extract has a significant inhibitory effect on Staphylococcus aureus, which is common in animal breeding. It can be applied to the prevention and treatment of animal diseases and the development of livestock and poultry breeding health care products in the animal breeding industry, and has good development and application prospects. Attached Figure Description

[0019] Figure 1 Image of the fused Weissella JWC120 bacterial cells.

[0020] Figure 2 Growth curves of *Westernella* JWC120 fusion strain.

[0021] Figure 3 To investigate the effect of organic acid treatment on the supernatant of *Westernella* JWC120 on inhibiting *Staphylococcus aureus*.

[0022] Figure 4 To investigate the effect of catalase treatment on the supernatant of *Westernella* JWC120 on inhibiting *Staphylococcus aureus*.

[0023] Figure 5 To investigate the effect of enzyme treatment on Staphylococcus aureus in the supernatant of Fussella JWC120.

[0024] Figure 6 To investigate the effect of temperature treatment on the inhibition of Staphylococcus aureus by the fusion Weissella supernatant.

[0025] Figure 7 pH stability analysis of the fused Weissella supernatant. Detailed Implementation

[0026] The technical solution of the present invention will be described in detail below with reference to the embodiments and accompanying drawings. It should be understood that the following embodiments are for explanation and illustration only and are not intended to limit the scope of protection of the present invention.

[0027] The Staphylococcus aureus used in the following examples was derived from pigs and purchased from the China Institute of Veterinary Drug Control.

[0028] The Salmonella was derived from pigs and purchased from the China Institute of Veterinary Drug Control.

[0029] The E. coli was derived from pigs and purchased from the China Institute of Veterinary Drug Control.

[0030] Shigella was derived from chickens and isolated and preserved in the inventor's laboratory.

[0031] JLA121, ZLP122, ZLL123, and JLA120 were all isolated from the animal intestinal tract in the same batch as JWC120, and were isolated and preserved by the inventor's laboratory.

[0032] The culture medium used in the following examples: MRS liquid culture medium was purchased from Beijing Aoboxing Co., Ltd., model / specification: 250g / bottle.

[0033] Note: MRS solid medium can be obtained by adding agar to the above liquid medium.

[0034] MRS broth was purchased from Beijing Aoboxing Company, and comes in a 250g / bottle size.

[0035] Hydrochloric acid and sodium hydroxide solutions were purchased from Sinopharm Chemical Reagent Co., Ltd., in 500mL / bottle and 500g specifications, with molecular weights of 36.5 and 40, respectively.

[0036] The following is the fully automated growth curve analyzer used in the example, purchased from Shanghai Weizai Technology Co., Ltd., model Bioscreen C.

[0037] Trypsin, papain, pepsin, and proteinase K were purchased from Beijing Lanbolide Trading Co., Ltd., with the following specifications: Trypsin (>2500U / mg) (Catalog No.: 0459), Papain (Catalog No.: P3250), Pepsin (P7000), and Proteinase K (30u / mg) (Catalog No.: 0706).

[0038] Unless otherwise specified, the reagents used in the following examples are all conventional reagents in the art, commercially available or prepared according to conventional methods in the art, and are of laboratory purity. Unless otherwise specified, the test methods and conditions used in the following examples are conventional test methods and conditions in the art, and can be found in relevant test manuals, public literature, or manufacturer's instructions. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0039] Example 1: Isolation, purification, and identification of strain JWC120 1. Isolation and purification of strain JWC120 The cecal contents sample of broiler chickens used in this invention was taken from a chicken farm in Zhuozhou, Hebei Province, and the separation and purification method is as follows: 25g of cecal contents were collected from broiler chickens at a chicken farm in Zhuozhou, Hebei Province. The contents were placed in a triangular flask containing 225ml of sterile physiological saline and glass beads, and shaken thoroughly to obtain a bacterial suspension. 1.0 ml of this bacterial suspension was then transferred to a test tube containing 9.0 ml of sterile physiological saline and mixed to obtain a dilution of 10. -1 Repeat the above steps to prepare bacterial suspensions with dilutions of 10⁻⁶ each time. -2 10 -3 10 -4 10 -5 10 -6 Bacterial solution. Select 10 -4 10 -5 10 -6 Three dilutions were prepared, with 0.1 ml of bacterial suspension from each dilution dropped onto MRS agar plates. The plates were incubated anaerobicly at 37°C for 24–48 h. Typical colonies were then picked and cultured in fresh MRS medium to obtain a fusion strain of *Westernella*. Weissella confusa It was named JWC120.

[0040] 2. Identification of strain JWC120 The 16S rDNA of strain JWC120 was amplified by PCR using the universal primers 27F / 1492R for fusion Weissella 16S rDNA. After passing 1% agarose gel electrophoresis, the amplified products were sent to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. The obtained sequences were compared online using the NCBI database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), with the sequence of the strain with the highest homology used as the reference to determine the taxonomic position of strain JWC120. Figure 1 This is a cell diagram of strain JWC120.

[0041] Sequence alignment results showed that the 16S rDNA sequence (SEQ ID NO: 1) of strain JWC120 had the highest similarity to strain 18902 of *Westernella fusionis*, with a similarity of 100%. Therefore, strain JWC120 was identified as *Westernella fusionis*. Weissella confusa ).

[0042] SEQ ID NO: 1: AACTGATTTGAAGAGCTTGCTCAGATATGACGATGGACATTGCAAAGAGT GGCGAACGGGTGAGTAACACGTGGGAAAACCTACCTCTTAGCAGGGGATAA CATTTGGAAACAGATGCTAATACCGTATAACAATGACAACCGCATGGTTG TTATTTAAAAGATGGGTTCTGCTATCACTAAGAGATGGTCCCGCGGTGCAT TAGCTAGTTGGTAAGGTAATGGCTTACCAAGGCGATGATGCATAGCCGAG TTGAGAGACTGATCGGCCACAATGGGACTGAGACACGGCCCATACTCCTA CGGGAGGCAGCAGTAGGGAATCTTCCACAATGGGCGAAAGCCTGATGGAG CAACGCCGCGTGTGTGATGAAGGGTTTCGGCTCGTAAAACACTGTTGTAA GAGAAGAATGACATTGAGAGTAACTGTTCAATGTGTGACGGTATCTTACC AGAAAGGAACGGCTAAATACGTGCCAGCAGCCGCGGTAATACGTATGTTC CAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGACGGTTATTT AAGTCTGAAGTGAAAGCCCTCAGCTCAACTGAGGAATTGCTTTGGAAACT GGATGACTTGAGTGCAGTAGAGGAAAGTGGAACTCCATGTGTAGCGGTGA AATGCGTAGATATATGGAAGAACACCAGTGGCGAAGGCGGCTTTCTGGAC TGTAACTGACGTTGAGGCTCGAAAGTGTGGGTAGCAAACAGGATTAGATA CCCTGGTAGTCCACACCGTAAACGATGAGTGCTAGGTGTTTGAGGGTTTC CGCCCTTAAGTGCCGCAGCTAACGCATTAAGCACTCCGCCTGGGGAGTAC GACCGCAAGGTTGAAACTCAAAGGAATTGACGGGGACCCGCACAAGCGGT GGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCAGGTCTTG ACATCCCTTGACAACTCCAGAGATGGAGCGTTCCCTTCGGGGACAAGGTG ACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTTGGGTTAA GTCCCGCAACGAGCGCAACCCTTATTACTAGTTGCCAGCATTCAGTTGGG CACTCTAGTGAGACTGCCGGTGACAAACCGGAGGAAGGTGGGGATGACGT CAAATCATCATGCCCCTTATGACCTGGGCTACACACGTGCTACAATGGCG TATACAACGAGTTGCCAACCCGCGAGGGTGAGCTAATCTCTTAAAGTACG TCTCAGTTCGGATTGTAGGCTGCAACTCGCCTACATGAAGTCGGAATCGC TAGTAATCGCGGATCAGCACGCCGCGGTGAATACGTTCCCGGGTCTTGTA CACACCGCCCGTCACACCATG 3. Patent Deposit of Strain JWC120 Strain JWC120 was deposited on September 11, 2024, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 31945.

[0043] Example 2: Determination of the growth curve of strain JWC120 After activation, *Westernella* fusion strain JWC120 was inoculated into MRS liquid medium at inoculum concentrations of 0.5% (v / v), 1.0% (v / v), and 2.0% (v / v), and incubated statically at 37°C for 48 h. The control group consisted of JLA121, ZLP122, ZLL123, and JLA120 (representing *Lactobacillus acidophilus* from chicken, *Lactobacillus plantarum* from porcine, *Lactococcus lactis* from porcine, and *Lactobacillus acidophilus* from chicken, all isolated from animal intestines in the same batch as JWC120). The viable counts of indicator bacteria *Escherichia coli*, *Salmonella*, *Staphylococcus aureus*, and *Shigella* were all adjusted to 10⁻⁶. 7 The fermentation broth, supernatant, and supernatant were diluted by a factor of 2, with 180 μL of each dilution added to Oxford cups. Indicator bacteria were incubated statically at 37°C, and the inhibition diameter was measured. The results are shown in Table 1. JWC120 showed significantly better inhibitory effects against Escherichia coli, Salmonella, Staphylococcus aureus, and Shigella than strains JLA120, ZLP120, ZLL120, and JLA120.

[0044] The OD of the bacterial culture from 0 to 48 hours was determined using the fully automated growth curve analyzer Bioscreen C (Shanghai Weizai Technology Co., Ltd.). 600nm Values ​​were used to plot growth curves, and the results are as follows: Figure 2 As shown, strain JWC120 exhibits the best growth performance at an inoculum size of 1.0%.

[0045] Example 3: Analysis of antimicrobial substances in *Westernella* JWC120 After activating the JWC120 strain, it was inoculated into MRS broth at a 1% inoculum and cultured at 37°C for 24 hours. After the culture was completed, it was centrifuged at 6000 r / min for 15 min, and the supernatant was filtered through a 0.22 μm filter membrane. The filtered supernatant was stored at 4°C for later use.

[0046] (1) Elimination of organic acids The pH of the supernatant in the experimental group was adjusted to 4.0 using 1 mol / L NaOH and HCl solutions, while the blank control group consisted of untreated supernatant. Staphylococcus aureus was used as an indicator bacterium for the antibacterial test, and the diameter of the inhibition zone was measured to evaluate the effect of organic acids on the antibacterial effect of bacteriocins.

[0047] The results are as follows Figure 3 As shown: the diameter of the inhibition zone in the blank control group was larger than that in the experimental group.

[0048] (2) Elimination of hydrogen peroxide In the experimental group, the pH of the supernatant was adjusted to 7.0 using 1 mol / L NaOH and HCl solutions, 10 mg / mL catalase was added, and the mixture was incubated in a 37°C water bath for 2 hours. The pH was then adjusted back to the original pH of 4.1, and Staphylococcus aureus was used for antibacterial testing. The supernatant that was not treated with catalase was used as a blank control.

[0049] The results are as follows Figure 4 As shown in Table 2, the inhibition diameter of the blank control group was significantly larger than that of the experimental group.

[0050] (3) Enzyme stability assay Take four 1 mL aliquots of supernatant and add 10 mg / mL of trypsin, papain, pepsin, and 50 μL of proteinase K, respectively. Adjust the pH of the solutions to their respective optimum values ​​(optimal pH for trypsin: 7.4; optimal pH for papain: 6.5; optimal pH for pepsin: 4.5; optimal pH for proteinase K: 7.5). Incubate the pH-adjusted solutions in a 37°C water bath for 2 hours, then adjust the pH back to the original value. Perform an antibacterial test using Staphylococcus aureus, using the untreated supernatant as a blank control.

[0051] The test results are as follows Figure 5 As shown in Table 3, the inhibition diameter of the blank control group was greater than that of the four experimental groups. Among the four experimental groups, the inhibition diameter of the proteinase K group was the largest, while that of the trypsin group was the smallest.

[0052] (4) Thermal stability determination Take six 1 mL aliquots of supernatant and treat them in water baths at 40 ℃, 60 ℃, 80 ℃, 100 ℃, and 120 ℃, respectively. Treat the supernatant at 100 ℃ and 120 ℃ for 30 minutes, and the remaining temperatures for 4 hours. Use the supernatant at room temperature as a blank control. Determine the inhibition diameter using Staphylococcus aureus.

[0053] The test results are as follows Figure 6As shown in Table 4, the inhibition diameter of the blank control group was larger than that of the experimental group, while the inhibition diameter of the experimental group decreased with increasing temperature.

[0054] (5) pH stability determination Take four 1 mL aliquots of the supernatant and adjust the pH to 3.0, 4.0, 5.0, and 6.0 respectively using 1 mol / L NaOH and HCl solutions. After standing at room temperature for 1 h, restore the pH to the initial value using NaOH and HCl solutions. Determine the inhibition diameter using Staphylococcus aureus, with the untreated supernatant serving as a blank control.

[0055] The test results are as follows Figure 7 As shown in Table 5, the inhibition diameter of the blank control group was larger than that of the experimental group. In the experimental group, the inhibition diameter was the smallest at pH 3.0 and the largest at pH 6.0.

[0056] Based on the above experimental results, the supernatant of strain JWC120 still showed an inhibition diameter of over 23 mm after acid and alkali treatment, indicating that the antibacterial substance can withstand acid and alkali. Therefore, the antibacterial substance in the supernatant is bacteriocin.

[0057] After treatment with pH 3.0–6.0 and temperature (40℃, 60℃, 80℃, 100℃, and 120℃), the supernatant of strain JWC120 showed inhibition diameters above 22 mm. Significant differences in inhibition diameter were observed, with no significant reduction in diameter across experimental groups, indicating no significant decrease in antibacterial activity. The addition of four proteases resulted in inhibition diameters smaller than the control group, but the trypsin-treated group exhibited the smallest diameter, suggesting that the cytokines in the supernatant are sensitive to trypsin, although the inhibition diameter remained above 18 mm. In conclusion, the bacteriocins of strain JWC120 possess strong acid and alkali resistance and high-temperature activity.

[0058] Example 4: Preparation method and antibacterial effect of crude bacteriocin extract from *Westernella* JWC120. The fused Weissella JWC120 was inoculated into MRS liquid medium and cultured at 37°C for 18 hours. Then, it was inoculated into fresh MRS medium at a 1% inoculum and cultured at 37°C for 48 hours. The fermentation broth from the fresh MRS medium was then added to five small beakers, centrifuged at 4°C for 10,000 g, coded, and stored in an ice box.

[0059] Different amounts of ammonium sulfate were placed in five small beakers to achieve saturation concentrations of 40%, 50%, 60%, 70%, and 80%, respectively, and stirred until the ammonium sulfate was completely dissolved.

[0060] The protein content in the supernatant was evaluated after precipitation with ammonium sulfate of different concentrations, and the precipitate was resuspended in deionized water to obtain crude cytokinin extract. The antibacterial effect was assessed using Staphylococcus aureus to determine the optimal ammonium sulfate concentration, and the results are shown in Table 6. The optimal ammonium sulfate concentration was finally determined to be 60%. The crude cytokinin extract extracted with this concentration had an inhibition diameter of 22.0 mm, significantly larger than that extracted with other concentrations of ammonium sulfate.

Claims

1. A strain of fused Weissella ( Weissella confusa The strain is identified by its accession number CGMCC No. 31945.

2. The crude bacteriocin extract of the fused Weissella strain as described in claim 1.

3. A method for preparing the crude bacteriocin extract according to claim 2, comprising: Add saturated ammonium sulfate at a concentration of 60% to the supernatant of the fermentation broth of the fused Weissella strain according to claim 1, stir until dissolved, centrifuge, discard the supernatant, and collect the precipitate; resuspend the precipitate with deionized water, and the resulting resuspended solution is the crude bacteriocin extract.

4. The method according to claim 3, characterized in that, The fusion strain of Weissella as described in claim 1 was inoculated into MRS liquid medium and cultured at 37°C for 18 hours. Then, it was inoculated into new MRS medium at a 1% inoculation rate and cultured at 37°C for 48 hours to obtain the fermentation broth of the fusion strain of Weissella.

5. A livestock and poultry health care product, wherein the active ingredient is the crude bacteriocin extract as described in claim 2.

6. The livestock and poultry breeding health product according to claim 5, characterized in that, The product is a solid or liquid bacterial agent.

7. A method for preparing the livestock and poultry health care product according to any one of claims 5 or 6, comprising culturing the fusion Weissella strain according to claim 1, preparing a crude bacteriocin extract of the strain, and using the crude bacteriocin extract as the active ingredient of the livestock and poultry health care product.

8. The method according to claim 7, characterized in that, Add saturated ammonium sulfate at a concentration of 60% to the supernatant of the fermentation broth of the fused Weissella strain, stir until dissolved, centrifuge, discard the supernatant, and collect the precipitate; resuspend the precipitate in deionized water, and the resulting resuspended solution is the crude bacteriocin extract of the strain.

9. The use of the fusion Weissella strain according to claim 1 in inhibiting Escherichia coli, Salmonella, Staphylococcus aureus and Shigella commonly found in animal husbandry.

10. The use of the crude bacteriocin extract according to claim 2 in inhibiting Staphylococcus aureus, which is common in animal husbandry.

Images