Application of CsC12RT1 gene in breeding of new citrus variety

Abstract

The invention discloses application of a CsC12RT1 gene in breeding of a new citrus variety, belongs to the technical field of gene engineering, and particularly relates to application of the CsC12RT1 gene in breeding of the new citrus variety, and the CDS sequence of the CsC12RT1 gene is as shown in SEQ ID NO.1. The invention further discloses application of the CsC12RT1 gene in breeding of the new citrus variety. According to the invention, through overexpression of the CsC12RT1 gene, the content of vicenin-2, nobiletin and / or tangeretin in citrus peel is increased, which prompts that the CsC12RT1 gene can be used as a candidate gene for breeding a new citrus variety with high content of vicenin-2, nobiletin and / or tangeretin, and a new functional citrus variety is cultivated by adopting a genetic engineering method.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to the application of the CsC12RT1 gene in the breeding of new citrus varieties. Background Technology

[0002] Citrus fruits are among the most widely cultivated and highest-yielding fruit varieties in China. Citrus fruits are rich in nutrients and bioactive secondary metabolites, which not only give them their unique flavor and health benefits but also play significant roles in antioxidation, anti-inflammation, and anti-cancer activity. Currently known substances in citrus fruits with important anti-inflammatory, antioxidant, and anti-tumor effects include phenolic acids, flavonoids, carotenoids, essential oils, limonene, and synephrine.

[0003] Vicine belongs to the flavonoid glycosides class of flavonoid compounds, while hesperidin and naringin belong to the polymethoxyflavones class of compounds. They possess significant biological activities, including: 1) plant stress resistance, protecting against pathogens such as bacteria, fungi, and pests; 2) antioxidant and photoprotective effects, scavenging intracellular reactive oxygen species (ROS) and excess free radicals, reducing oxidative damage; 3) anti-inflammatory effects, exhibiting anti-inflammatory activity by inhibiting pro-inflammatory cytokines and reducing leukocyte infiltration; 4) cardiovascular protection, studies have shown that dietary intake of naringin and hesperidin can effectively reduce the risk of cardiovascular disease death in adults; 5) anti-cancer and anti-tumor effects, studies have shown that dietary intake of naringin and hesperidin can reduce the risk of breast cancer, lung cancer, colon cancer, prostate cancer, and pancreatic cancer; 6) metabolic regulation and anti-obesity: regulating gut microbiota balance, inhibiting the growth of pathogenic bacteria, promoting the proliferation of probiotics such as Bifidobacteria, and improving intestinal barrier function.

[0004] Vizanol, quercetin, and / or hesperidin are widely distributed in various vegetables and fruits and are used in food processing to reduce the use of synthetic chemicals and improve human health. Identifying the key enzymes in their biosynthetic pathways and elucidating the molecular mechanisms by which they function can provide a theoretical basis for molecular breeding of functional citrus fruits with high levels of vizanol, quercetin, and / or hesperidin, which is of great significance for improving the comprehensive utilization rate of citrus fruits. Summary of the Invention

[0005] To address the aforementioned technical issues, this invention proposes the application of the CsC12RT1 gene in the breeding of new citrus varieties. By overexpressing the CsC12RT1 gene, the content of vincain-2, quercetin, and / or hesperidin in citrus peel is increased, suggesting that the CsC12RT1 gene can serve as a candidate gene for the breeding of new citrus varieties with high vincain-2, quercetin, and / or hesperidin content, and that functional new citrus varieties can be cultivated using genetic engineering methods.

[0006] To achieve the above objectives, the present invention provides the application of the CsC12RT1 gene in the breeding of new citrus varieties, and the CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.1.

[0007] Preferably, by overexpressing the CsC12RT1 gene, the content of vincain-2, quercetin and / or hesperidin in citrus peel is increased, resulting in a new citrus variety with high content of vincain-2, quercetin and / or hesperidin.

[0008] The present invention also provides an overexpression vector containing the CsC12RT1 gene, the CDS sequence of which is shown in SEQ ID NO.1.

[0009] The present invention also provides a recombinant strain containing the CsC12RT1 gene, the CDS sequence of which is shown in SEQ ID NO.1.

[0010] This invention also provides the application of the overexpression vector or the recombinant strain in the breeding of new citrus varieties. The overexpression vector or the recombinant strain increases the content of vincain-2, naringin and / or hesperidin in citrus peel by overexpressing the CsC12RT1 gene, thereby obtaining new citrus varieties with high vincain-2, naringin and / or hesperidin content.

[0011] The present invention also provides a method for breeding new citrus varieties with high content of citrus tin-2, naringin and / or hesperidin, comprising the following steps: amplifying the CDS sequence of the CsC12RT1 gene, constructing an overexpression vector of the CsC12RT1 gene, transforming Agrobacterium, infecting citrus fruits, and obtaining a new citrus variety; the CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.1.

[0012] This invention also provides the application of the CsC12RT1 gene in the breeding of new citrus varieties with high virginine-2 content. The CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.1. By overexpressing the CsC12RT1 gene, the content of virginine-2 in citrus peel is increased, and new citrus varieties with high virginine-2 content are obtained.

[0013] This invention also provides the application of the CsC12RT1 gene in the breeding of new citrus varieties with high cannabinoid content. The CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.1. By overexpressing the CsC12RT1 gene, the cannabinoid content in citrus peel is increased, and new citrus varieties with high cannabinoid content are obtained.

[0014] This invention also provides the application of the CsC12RT1 gene in the breeding of new citrus varieties with high hesperidin content. The CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.1. By overexpressing the CsC12RT1 gene, the content of hesperidin in citrus peel is increased, and new citrus varieties with high hesperidin content are obtained.

[0015] The present invention also provides the application of the CsC12RT1 gene in increasing the content of vescenin-2, quercetin and hesperidin in citrus peel, wherein the CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.1; by overexpressing the CsC12RT1 gene, the content of vescenin-2, quercetin and hesperidin in citrus peel is increased.

[0016] Compared with the prior art, the present invention has the following advantages and technical effects:

[0017] This invention provides the application of the CsC12RT1 gene in the breeding of new citrus varieties, and its specific technical effects are as follows:

[0018] (1) This invention first discovered that the expression level of CsC12RT1 gene is positively correlated with the content of vescenin-2, quercetin and / or hesperidin in citrus. The higher the expression level of CsC12RT1 gene, the higher the content of vescenin-2, quercetin and / or hesperidin in citrus peel. In the experiment, the citrus that were transiently transformed with the CsC12RT1 gene overexpression vector had a maximum content of up to 30.1% higher than that of citrus that were transformed with the empty vector.

[0019] (2) The CsC12RT1 gene can be used as a candidate gene for breeding new citrus varieties with high content of citrus-2, citronellol and / or hesperidin. It is of great significance for breeding new functional citrus varieties by using genetic engineering methods, accelerating the breeding process, reducing the breeding workload and improving the comprehensive utilization rate of citrus. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 The diagram shows the structure of the CsC12RT1 gene in Late Orange. In the diagram, A represents the chromosomal location of the CsC12RT1 gene, B represents the structure of the CsC12RT1 gene, Exon1 represents the exon, and C represents the conserved domain of the CsC12RT1 gene.

[0022] Figure 2The image shows the agarose gel electrophoresis results of the amplified CsC12RT1 gene CDS sequence. In the figure, M represents Marker and CDS represents the CsC12RT1 gene CDS sequence.

[0023] Figure 3 The structure of the CsC12RT1 gene overexpression vector pLGNe-CsC12RT1 is shown.

[0024] Figure 4 The images show photos of Late Orange fruits from the experimental and control groups on the day of instantaneous transformation and after 5 days of cultivation. In the images, A is a photo of Late Orange fruits from the control and experimental groups on the day of instantaneous transformation, B is a photo of Late Orange fruits from the control and experimental groups after 5 days of cultivation, and C is a partial sample photo of Late Orange fruits from the control and experimental groups after 5 days of cultivation when total RNA was extracted. In the figures, pLGNe represents the control group, and pLGNeCsC12RT1-1, pLGNeCsC12RT1-2, and pLGNeCsC12RT1-3 represent the experimental group.

[0025] Figure 5 The expression levels of the CsC12RT1 gene in the peel of the late-maturing orange injection area after 5 days of culture in the experimental and control groups are shown in the figure. pLGNe represents the control group, and pLGNeCsC12RT1-1, pLGNeCsC12RT1-2 and pLGNeCsC12RT1-3 represent the experimental group. P < 0.0001 indicates significant difference.

[0026] Figure 6 Figure 1 shows the results of detecting the contents of vezin-2, noriside, and hesperidin in the peel of the late-maturing oranges in the injection area after 5 days of cultivation in the experimental and control groups. In the figure, A represents the content of vezin-2, B represents the content of noriside, and C represents the content of hesperidin. In the figure, pLGNe represents the control group, and pLGNeCsC12RT1-1, pLGNeCsC12RT1-2, and pLGNeCsC12RT1-3 represent the experimental group. P < 0.0001, P = 0.0023, P = 0.0021, and P = 0.0007 represent significant differences.

[0027] Figure 7 Here are the structural formulas of vezin-2, naringin, and hesperidin, where A is vezin-2, B is naringin, and C is hesperidin. Detailed Implementation

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0030] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0031] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0032] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0033] The source of the materials used in this invention: the late-maturing Jincheng orange is derived from the superior late-maturing Jincheng orange strain bred by the Citrus Research Institute of the Chinese Academy of Agricultural Sciences, with the variety approval number being Yu Shen Citrus 2011001.

[0034] Example 1

[0035] I. Bioinformatics analysis of the CsC12RT1 gene.

[0036] The structure of the CsC12RT1 gene in Late Orange is as follows: Figure 1 As shown, the gene is located between 7927452bp and 7928957bp on chromosome 4 of Citrus sinensis, chromosome version number Citrus sinensis v3.0, contains one exon, and encodes 314 amino acids. The CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.1.

[0037] The CDS sequence of the CsC12RT1 gene SEQ ID NO.1: ATGTATGATTTATTCCAACCATGGGCAGCA GAGGCAGCTTACCAGTATCACATAGCTGCTGTTTTGTTCTTAACCATATCTGCAGTAGCCGGTTCTTACTTGCTGCACAATATCATAAATCCCAGCCTGAAGTACCCTTTCTTTGAATCTGACTTCCTCGATAGAGAAAACAAGAAAATCAACCGCTTCATGCATCCTACTGCCAATGGCACCTTAAACAAAGACAGGAACTTAAAAGCTTTTGAACTATCTTGCAAATTTGTGTTCATCAAAACATCAAGAGAGATCGAATCCAAGTACTTGGATTATTTTCCTTCTTTGATGGAAAATGAAATAGTTCCAGTTGGGCCTCTAGTTCAAGAATCTATATTCAAAGAAGATGATACGAAGATTATGGACTGGCTGAGCCAAAAGGAGCCTTGGTCAGTAGTGTTTGTATCATTTGGCAGTGAGTACTTTCTTTCCAAGGATGAAATGCATGAGATAGCCAGTGGGTTATTGCTCAGCGAGGTTAGTTTTATACGGGTTTTGAGATTACATCCTGATGAAAAAATTACTATCGAGGAGGCACTGCCTCAAGGCTTTGCTGAGGAGATTGAAAGGAATAATAAGGGAATGTTAGTACAAGGTTGGGTTCCGCAGGCTAAAATTTTAAGGCATGGAAGGATCGGCGGTTTTTTGAGTCATTGTGGTTGGGGTTCGGCAGTTGAAGGGATGGTGTTCGGGGTACCAATCATAGCTATGCCAATGGTATATGAGCAGTCAAGGAATGCCAAAGTGGTGGTTGATATCGGTATGGGCATGGACGTGCCGAGAGATAAGATCAATCAAAGACTTAGAAGAGAGGAGGTGGCAAGGGTCATTAAACATGTTTTGCTGCAAGAAGAAGGGAAGCAAATAAGAAGAAAAGCTAAAGAAATGAGTGAGAGGATGAGAAGATAG。

[0038] II. Cloning the CDS sequence of the CsC12RT1 gene.

[0039] 1. RNA extraction and cDNA synthesis:

[0040] Total RNA was extracted from leaves of *Citrus aurantiacus* using a plant total RNA extraction kit (Adley, CAT: RN09). RNA quality was verified by agarose gel electrophoresis, and RNA concentration was determined using a concentration meter. cDNA was then synthesized using a reverse transcription kit (PrimeScript RTMaster Mix, TaKaRa, CAT: RR036A) according to the accompanying instructions.

[0041] 2. Amplify the CDS sequence of the CsC12RT1 gene:

[0042] Primers OE-CsC12RT1-F (SEQ ID NO.2) and OE-CsC12RT1-R (SEQ ID NO.3), along with the high-fidelity enzyme PrimeSTAR Max DNAPolymerase (TaKaRa, CAT: R045Q), were used. Late-ripening orange cDNA was used as a template, and the amplification system was prepared according to the instructions accompanying the PrimeSTAR Max DNAPolymerase package. The PCR amplification program was: 98℃, 5 min; 98℃, 30 s, 56℃, 30 s, 72℃, 1.5 min, 35 cycles; extension at 72℃ for 10 min. The CDS sequence of the CsC12RT1 gene was obtained, with a fragment length of 951 bp (CDS sequence 942 bp - terminator 3 bp + 12 bp of restriction enzyme sites).

[0043] The nucleotide sequence of primer OE-CsC12RT1-F is SEQ ID NO.2: GGTACCATGTATGATTTATTCCAACCATGGGCAG.

[0044] The nucleotide sequence of primer OE-CsC12RT1-R is SEQ ID NO.3: GAATTCTCTTCTCATCCTCTCACTCATTTC.

[0045] Agarose gel electrophoresis results are as follows Figure 2 As shown, the amplified fragment size results were as expected. Under UV light, the agarose gel block containing the target fragment was cut off with a clean blade, and the DNA fragment was recovered using a kit (BioFlux, CAT: BSC02M1). A portion of the recovered product was sent to the company for sequencing. The sequencing results, after comparative analysis, confirmed that the obtained DNA fragment was the CDS sequence (SEQ ID NO.1) of the Late Orange CsC12RT1 gene.

[0046] III. Construct an overexpression vector for the CsC12RT1 gene and transform it into Agrobacterium.

[0047] 1. Construct an overexpression vector for the CsC12RT1 gene:

[0048] The recovered DNA fragments, namely the CDS sequence of the CsC12RT1 gene of Late Orange and the overexpression vector pLGNe, were digested with restriction endonucleases KpnⅠ and EcoRI (ThermoFisher) and then recovered by gel extraction. The DNA fragments were ligated at 16℃ for 12 h. The digestion system and reaction conditions were prepared according to the attached instructions. The ligation was performed using the T4 DNALigase kit (Promega, CAT: M1801). The ligation system and reaction conditions were prepared according to the instructions attached to the T4 DNALigase kit.

[0049] The obtained ligation product was transformed into *E. coli* DH5α using the method described in the instruction manual accompanying the *E. coli* DH5α (purchased from Weidi Biotechnology). Plasmids from positive clones were extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the overexpression vector pLGNe-CsC12RT1 of the CsC12RT1 gene.

[0050] like Figure 3 The image shows the structure of the CsC12RT1 gene overexpression vector pLGNe-CsC12RT1.

[0051] 2. Transformation of Agrobacterium tumefaciens with an overexpression vector of the CsC12RT1 gene:

[0052] The overexpression vector pLGNe-CsC12RT1 obtained was introduced into Agrobacterium tumefaciens EHA105 cells using a heat shock method. The specific steps are as follows: 50 μL of frozen Agrobacterium tumefaciens competent cells (EHA105) in a 2 mL centrifuge tube were thawed on ice. 2 μL of the plasmid of the overexpression vector was added to the competent cells, and the mixture was mixed by pipetting. The mixture was then placed on ice for 5 min, flash-frozen in liquid nitrogen for 5 min, incubated at 37 °C for 5 min, and placed on ice for 5 min. Then, 800 μL of LB liquid medium was added to a 2 mL centrifuge tube, mixed by pipetting, and cultured on a shaker at 260 rpm at 28 °C for 2 h. Then, the bacterial culture was centrifuged at 6000 r / min for 1 min, the supernatant was discarded, and the bacterial cells were resuspended in 50 μL of LB liquid medium. After resuspending, the cells were spread on LB solid medium containing 50 mg / L kanamycin and incubated in the dark at 28°C for 2 days. After the colonies grew, they were picked and single colonies were verified by PCR using primers ID-CsC12RT1-F (SEQ ID NO.4), primers ID-CsC12RT1-R (SEQ ID NO.5) and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q). The amplification system was prepared according to the instructions of the high-fidelity enzyme PrimeSTAR Max DNA Polymerase. The PCR amplification conditions were: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0053] The nucleotide sequence of primer ID-CsC12RT1-F is SEQ ID NO.4:TCGTTGAAGATGCCTCTGCCGACAG.

[0054] The nucleotide sequence of primer ID-CsC12RT1-R is SEQ ID NO.5:TCTTCTCATCCTCTCACTCATTTC.

[0055] The PCR amplification products were subjected to agarose gel electrophoresis. Colonies with the correct band size were positive clones containing the overexpression vector pLGNe-CsC12RT1.

[0056] IV. Transient conversion of the CsC12RT1 gene overexpression vector pLGNe-CsC12RT1.

[0057] 1. Agrobacterium infection:

[0058] Select late-ripening orange fruits of uniform growth stage and sterilize them in a clean bench with a 75% ethanol aqueous solution. Add 500 μL of Agrobacterium tumefaciens containing pLGNe and pLGNe-CsC12RT1 plasmids to 50 mL of liquid LB medium (containing 50 mg / L kanamycin) and incubate at 28℃ and 200 rpm until OD reaches [value missing]. 600 =0.5. Centrifuge and collect the precipitate. Resuspend Agrobacterium in 1 / 2 MS liquid medium. Then, randomly select four injection points on the diagonal of the equatorial plane of the sterilized Late Jin Orange fruit and mark them. Inject the Agrobacterium resuspension containing pLGNe-CsC12RT1 plasmid into the peel of the Late Jin Orange using a 1 mL syringe. Inject 1 mL into each area, which is recorded as the experimental group. The Late Jin Oranges injected with the same amount of Agrobacterium resuspension containing pLGNe plasmid are used as the control group. The experimental group and the control group are each repeated three times. The Late Jin Oranges injected with Agrobacterium resuspension are placed in a 28℃ incubator in the dark for 5 days.

[0059] like Figure 4 The image shows photos of the late-ripening orange fruits in the experimental and control groups on the day of instantaneous transformation and after 5 days of cultivation. Figure 4 Image A shows photographs of the late-night orange fruits from the control group (pLGNe) and experimental groups (pLGNe-CsC12RT1-1, pLGNe-CsC12RT1-2, and pLGNe-CsC12RT1-3) on the day of instantaneous transformation. Figure 4 Image B shows photos of late-ripening orange fruits after 5 days of cultivation in the control group (pLGNe) and experimental groups (pLGNeCsC12RT1-1, pLGNeCsC12RT1-2, and pLGNeCsC12RT1-3). Figure 4 Photograph of part of the sample during total RNA extraction (C).

[0060] 2. qRT-PCR analysis of transiently transformed late-ripening orange fruits:

[0061] Total RNA (Adelai, CAT No: RN09) was extracted from the peel of the injected areas of *Citrus reticulata* var. *mairei* (Citrus reticulata) cultured in the experimental and control groups at 28°C in the dark for 5 days. cDNA was synthesized using the PrimeScript RTMaster Mix reverse transcription kit (TaKaRa, CAT: RR036A), and the expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsC12RT1-F (SEQ ID NO. 6) and RT-CsC12RT1-R (SEQ ID NO. 7).

[0062] qRT-PCR reaction conditions: 95℃ for 3 min, 94℃ for 10 s; 56℃ for 10 s, 72℃ for 10 s, 40 cycles; 72℃ for 10 min.

[0063] The nucleotide sequence of primer RT-CsC12RT1-F is SEQ ID NO.6:ATGGAAGGATCGGCGGTTTT.

[0064] The nucleotide sequence of primer RT-CsC12RT1-R is SEQ ID NO.7:ACCACCACTTTGGCATTCCT.

[0065] Use 2 -△△Ct The relative expression levels of the CsC12RT1 gene in the experimental and control groups of Wanjin oranges were calculated as follows: the control group sample was defined as the reference factor, i.e., its CsC12RT1 expression level was 1. Then, the fold increase in gene expression in the experimental group sample relative to the reference factor was calculated as 2. -△△Ct , which is its relative expression level.

[0066] The results are as follows Figure 5 As shown, the expression level of CsC12RT1 gene in the experimental groups (pLGNe-CsC12RT1-1, pLGNe-CsC12RT1-2 and pLGNe-CsC12RT1-3) was significantly higher than that in the control group (pLGNe), with the highest level being more than 8 times that of the control group.

[0067] V. Determine the content of vincanin-2, naringin and hesperidin in the fruits of the experimental group and the control group.

[0068] The contents of vezin-2, naringin and hesperidin components in the peel of the experimental group and the control group after 5 days of dark incubation at 28℃ were determined by UPLC-MS.

[0069] The results are as follows Figure 6 China A Figure 6 China B and Figure 6 As shown in Figure C, compared with the control group fruits transiently transformed with pLGNe, the contents of vesener-2, quercetin, and hesperidin in the peels of the experimental groups pLGNe-CsC12RT1-1, pLGNe-CsC12RT1-2, and pLGNe-CsC12RT1-3 transiently transformed with pLGNe-CsC12RT1 increased by 16.48%–21.61%, 14.72%–11.45%, and 24.76%–30.11%, respectively. This indicates that transient overexpression of the CsC12RT1 gene can significantly increase the contents of vesener-2, quercetin, and / or hesperidin in late-ripening oranges. Figure 7 China A Figure 7 China B and Figure 7 As shown in C, these are the structural formulas of veselene-2, naringin, and hesperidin.

[0070] In summary, this invention is the first to discover a positive correlation between the expression level of the CsC12RT1 gene and the content of vincastatin-2, quercetin, and hesperidin in citrus. The higher the expression level of the CsC12RT1 gene, the higher the content of vincastatin-2, quercetin, and hesperidin in the citrus peel. In the experiment, citrus transiently transformed with the CsC12RT1 gene overexpression vector showed up to 30.11% higher levels of these substances compared to citrus transformed with the empty vector. The CsC12RT1 gene can serve as a candidate gene for breeding new citrus varieties with high vincastatin-2, quercetin, and hesperidin content. This is of great significance for using genetic engineering methods to cultivate functional citrus varieties, accelerate the breeding process, reduce the breeding workload, and improve the comprehensive utilization rate of citrus.

[0071] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of the CsC12RT1 gene in the breeding of new citrus varieties, characterized in that, The CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, By overexpressing the CsC12RT1 gene, the content of vincain-2, quercetin, and / or hesperidin in citrus peel was increased, resulting in a new citrus variety with high content of vincain-2, quercetin, and / or hesperidin.

3. An overexpression vector, characterized in that, The overexpression vector contains the CsC12RT1 gene, and the CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.

1.

4. A recombinant bacterial strain, characterized in that, The recombinant strain contains the CsC12RT1 gene, and the CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.

1.

5. The application of the overexpression vector as described in claim 3 or the recombinant strain as described in claim 4 in the breeding of new citrus varieties, characterized in that, The overexpression vector or the recombinant strain increases the content of vincain-2, quercetin, and / or hesperidin in citrus peel by overexpressing the CsC12RT1 gene, thereby obtaining a new citrus variety with high content of vincain-2, quercetin, and / or hesperidin.

6. A method for breeding a new citrus variety with high content of cinnarizine-2, quercetin, and / or hesperidin, characterized in that, Includes the following steps: The CDS sequence of the CsC12RT1 gene was amplified, an overexpression vector of the CsC12RT1 gene was constructed, Agrobacterium was transformed, and citrus fruits were infected to obtain a new citrus variety. The CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.

1.

7. The application of the CsC12RT1 gene in the breeding of new citrus varieties with high Vitrin-2 content, characterized in that, The CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.

1. By overexpressing the CsC12RT1 gene, the content of vincain-2 in citrus peel is increased, resulting in a new citrus variety with high vincain-2 content.

8. Application of the CsC12RT1 gene in the breeding of new citrus varieties with high allantoin content, characterized in that... The CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.

1. By overexpressing the CsC12RT1 gene, the content of naringin in citrus peel is increased, resulting in a new citrus variety with high naringin content.

9. The application of the CsC12RT1 gene in the breeding of new citrus varieties with high hesperidin content, characterized in that... The CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.

1. By overexpressing the CsC12RT1 gene, the content of hesperidin in citrus peel is increased, resulting in a new citrus variety with high hesperidin content.

10. The application of the CsC12RT1 gene in increasing the content of veselcin-2, naringin, and hesperidin in citrus peel, characterized in that, The CDS sequence of the CsC12RT1 gene is shown in SEQ ID NO.1; by overexpressing the CsC12RT1 gene, the content of vesenoside-2, naringin and hesperidin in citrus peel is increased.

Images