Cassava low-temperature-resistant MeSR34b gene and application thereof

Abstract

The invention provides a cassava low-temperature-resistant MeSR34b gene. The CDS sequence of the cassava low-temperature-resistant MeSR34b gene is as shown in SEQ ID NO: 1. The cassava low-temperature-resistant MeSR34b gene is cloned from cassava for the first time, the expression of the MeSR34b gene in the cassava is inhibited under low-temperature stress, and research shows that the gene can remarkably improve the low-temperature resistance of the cassava, increase the malondialdehyde content, the proline cumulant and the like in the cassava, reduce oxidative damage of cells, yellow newborn leaves of the cassava and improve the yield of the cassava. The expression of various protein genes is regulated and controlled. The invention provides a new candidate gene for research on improvement of low temperature resistance, oxidative damage resistance and the like of plants.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biology, and particularly relates to a cassava low-temperature-resistant MeSR34b gene and application thereof. BACKGROUND

[0002] Cassava (Manihot esculenta) is an important food and energy crop in the world, and its storage roots contain rich starch, which is the main source of food for nearly 1 billion people in the tropical and subtropical regions of the world. Cultivated cassava has an extraordinary light, heat and water resource utilization rate in the long-term evolution and artificial selection process, and the biological energy yield per unit area is higher than that of almost all other cultivated crops, and it has the characteristics of high light efficiency, drought tolerance, poor soil tolerance and low temperature sensitivity. However, due to the overall low level of scientific and technological investment and research on cassava, a tropical crop, the major basic theoretical research on the yield, quality, resistance and adaptability of cassava is seriously lagging behind, resulting in that the yield, quality and resistance potential of cassava have not been fully tapped.

[0003] In China, cassava is mainly planted in tropical and subtropical provinces such as Guangxi, Guangdong and Hainan, with an annual planting area of about 6 million mu and a fresh tuber yield of about 10 million tons per year. More than 15 million tons of dry chips need to be imported every year, which shows that the demand gap is huge. At the same time, due to the deterioration of the ecological environment, factors such as reduction of arable land, pests and diseases, drought, salinity and low temperature have been restricting the development of cassava planting industry, and the yield loss caused by these factors is more than 50% per year, which makes the cassava processing industry face the situation of lack of raw materials. In order to meet the market demand, it is necessary to continue to expand the planting area of cassava and improve the breeding and planting technology. Therefore, carrying out basic theoretical research on the stress adaptation of cassava and cultivating new cassava germplasm with high yield and resistance plays an irreplaceable role in meeting the diversified demand of people's life quality.

[0004] Cassava is very sensitive to low temperature, and is suitable for growing in areas with an average temperature of above 18℃ and at least 8 months of frost-free period. When the temperature is lower than 15℃, the growth and development of cassava is inhibited, and when the temperature is lower than 4℃, the top growth is inhibited, the plant wilts and the stem dies. If the tubers are stressed by low temperature after tuber formation, the tuber swelling and starch accumulation will be limited, and the yield will be reduced. In recent years, although cassava has been introduced and planted in Yunnan, Guizhou, Fujian, Jiangxi and Shandong provinces, due to the influence of low temperature weather, there is a lack of low-temperature-resistant varieties, the planting area is difficult to expand, and the economic benefit is limited. Therefore, it is an urgent need for the development of cassava industry to carry out basic research on low-temperature-resistant breeding, cultivate low-temperature-resistant cassava varieties, make the cassava planting northward, and meet the demand of energy industry for cassava raw materials. SUMMARY

[0005] The purpose of the present application is to overcome the deficiencies in the prior art, and to provide a cassava low-temperature-resistant MeSR34b gene and application thereof.

[0006] The first aspect of the present application provides a cassava low-temperature-resistant MeSR34b gene, wherein the CDS sequence is shown as SEQ ID NO: 1.

[0007] The second aspect of the present application provides a protein encoded by the cassava low-temperature-resistant MeSR34b gene according to the first aspect of the present application.

[0008] The third aspect of the present application provides a recombinant vector containing the coding region of the cassava low-temperature-resistant MeSR34b gene according to the first aspect of the present application.

[0009] The original vector of the recombinant vector can be a vector commonly used in the field of gene recombination, such as a virus or a plasmid. The present application does not limit this. In a specific embodiment of the present application, the original vector is a pCambia1301 vector, but it should be understood that other plasmids or viruses can also be used.

[0010] Preferably, the original vector of the recombinant vector is a pCambia1301 vector, and the coding region of the cassava low-temperature-resistant MeSR34b gene is located between the BanH I and Sal I restriction enzyme sites of the pCambia1301 vector. The 5' end of the pCambia1301 vector is a CaMV35S promoter and a myc or RFP sequence, and the 3' end is a Nos terminator.

[0011] The fourth aspect of the present application provides a host bacterium containing the coding region of the cassava low-temperature-resistant MeSR34b gene according to the first aspect of the present application.

[0012] The fifth aspect of the present application provides an expression cassette containing the coding region of the cassava low-temperature-resistant MeSR34b gene according to the first aspect of the present application.

[0013] The sixth aspect of the present application provides the use of the cassava low-temperature-resistant MeSR34b gene according to the first aspect of the present application, or the protein according to the second aspect of the present application, or the recombinant vector according to the third aspect of the present application, or the host bacterium according to the fourth aspect of the present application, or the expression cassette according to the fifth aspect of the present application in improving the low-temperature resistance of cassava, and / or reducing the content of malondialdehyde, and / or increasing the accumulation of proline.

[0014] The seventh aspect of the present application provides the use of the cassava low-temperature-resistant MeSR34b gene according to the first aspect of the present application, or the protein according to the second aspect of the present application, or the recombinant vector according to the third aspect of the present application, or the host bacterium according to the fourth aspect of the present application, or the expression cassette according to the fifth aspect of the present application in yellowing of new leaves of cassava. Thus, the transgenic strain can be preliminarily distinguished from the common strain. Moreover, the yellowing of the new leaves can increase the ornamental property of the cassava plant, and provide a new way for breeding ornamental cassava varieties.

[0015] The eighth aspect of the present application provides the use of the cassava low-temperature-resistant MeSR34b gene according to the first aspect of the present application, or the protein according to the second aspect of the present application, or the recombinant vector according to the third aspect of the present application, or the host bacterium according to the fourth aspect of the present application, or the expression cassette according to the fifth aspect of the present application in improving the antioxidant damage resistance of cassava.

[0016] The ninth aspect of the present application provides the use of the cassava low-temperature-resistant MeSR34b gene according to the first aspect of the present application, or the protein according to the second aspect of the present application, or the recombinant vector according to the third aspect of the present application, or the host bacterium according to the fourth aspect of the present application, or the expression cassette according to the fifth aspect of the present application in improving the methyl viologen damage resistance of cassava.

[0017] The tenth aspect of the present application provides the use of the cassava low-temperature-resistant MeSR34b gene according to the first aspect of the present application, or the protein according to the second aspect of the present application, or the recombinant vector according to the third aspect of the present application, or the host bacterium according to the fourth aspect of the present application, or the expression cassette according to the fifth aspect of the present application in breeding ornamental cassava varieties, and / or breeding low-temperature-resistant cassava varieties, and / or screening low-temperature-resistant cassava germplasm.

[0018] The eleventh aspect of the present application provides the use of the cassava low-temperature-resistant MeSR34b gene according to the first aspect of the present application, or the protein according to the second aspect of the present application, or the recombinant vector according to the third aspect of the present application, or the host bacterium according to the fourth aspect of the present application, or the expression cassette according to the fifth aspect of the present application in improving the expression of the MeBED gene, and / or improving the expression of the MeATL54 gene, and / or improving the expression of the MeWRKY42 / 33 gene, and / or improving the MeDREB2a / 2f gene.

[0019] A twelfth aspect of the present application provides a primer pair, which is MeSR34b cloning primer Sense Primer: CGGGATCCTATGAGTAGCCGCGCGAGCAGAA and MeSR34b cloning primer Antisense Primer: ACGCGTCGACTCACCGGGATAAGCTCCTGCTC.

[0020] The present application provides a cassava low temperature resistant MeSR34b gene which is cloned from cassava for the first time. The expression of the MeSR34b gene in cassava is inhibited under low temperature stress. Research shows that the gene can significantly improve the low temperature resistance of cassava, increase the content of malondialdehyde and proline accumulation in cassava, reduce the oxidative damage of cells, and make the new leaves of cassava yellow, and regulate the expression of various protein genes. The present application provides a new candidate gene for improving the low temperature resistance of plants, resisting oxidative damage, cultivating ornamental cassava varieties, cultivating low temperature resistant transgenic cassava, screening low temperature resistant cassava varieties, and the like. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 For expression analysis of MeSR34b gene in different tissue parts and expression analysis under low temperature.

[0022] Figure 2 For subcellular localization analysis of MeSR34b.

[0023] Figure 3 For identification and phenotype analysis of cassava MeSR34b high expression strain.

[0024] Figure 4 For phenotype analysis and stress resistance analysis of cassava MeSR34b high expression strain.

[0025] Figure 5 For identification and verification of downstream genes regulated by MeSR34b. DETAILED DESCRIPTION

[0026] The present application will be further described below with reference to the accompanying drawings and specific examples, so as to better understand the present application. In the examples, the specific techniques or conditions not mentioned are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The reagents or instruments not mentioned by the manufacturer are all conventional products that can be obtained by purchase.

[0027] Example 1: Cloning of cassava low temperature resistant MeSR34b gene

[0028] After extracting the RNA from cassava leaves, the cDNA was obtained by reverse transcription using TaKaRa PrimeScript II 1st Strand cDNA Synthesis Kit, and PCR cloning of MeSR34b gene was carried out with the cDNA as a template. The cloning primers were MeSR34b cloning primer Sense Primer: CGGGATCCTATGAGTAGCCGCGCGAGCAGAA (containing BanH 1 site), and MeSR34b cloning primer Antisense Primer: ACGCGTCGACTCACCGGGATAAGCTCCTGCTC (containing Sal 1 site). The PCR amplification system is shown in Table 1, and the PCR reaction program is shown in Table 2. The amplification product was recovered, sequenced, and the CDS sequence of cassava MeSR34b gene was shown as SEQ ID NO: 1.

[0029] Table 1 PCR amplification system

[0030] Component Volume Sense Primer (10 uM) 1.0 μL Antisense Primer (10 uM) 1.0 μL Cassava Leaf cDNA 1.0 μL 2 x PrimerSTAR Max DNA Polymerase 25 μL ddH2O 23 μL Total 50 μL

[0031] Table 2 PCR reaction program

[0032]

[0033] Example 2: Expression analysis of cassava MeSR34b gene in different tissue parts

[0034] In order to study the expression characteristics of cassava MeSR34b gene in different tissues, 8 tissue parts of cassava were taken, and real-time fluorescent quantitative PCR was carried out to detect the expression of cassava MeSR34b gene.

[0035] Forward primer: AGAACTCTCTATGTTGGAAATC and Reverse primer: CTCCATGTGCAAGCTCCACTCG were used as primers, and the reaction system is shown in Table 3, and the reaction program is as follows: 95℃ 10s, 55℃ 5s, 72℃ 15s, 40 cycles, each sample was repeated 3 times, and the data was processed by 2 一△△Ct method, and the output results were analyzed by Microsoft Excel and drawn. The results are shown in Figure 1 A, and the expression of MeSR34b in cassava callus, leaves and apical buds is preferential, while the expression of MeSR34b in flowers is the lowest.

[0036] Table 3 Reaction system is as follows:

[0037] Component (Comonent) Volume (Volume) TB Green Premix Ex Taq II 10 μL ROX Reference Dye 0.4 μL Template 1 μL Forward primer 0.8 μL Reverse primer ddH2O Total 0.8 μL 7.0 μL 20 μL

[0038] Example 3: Expression analysis of cassava MeSR34b gene under low temperature stress

[0039] Cassava seedlings were treated with low temperature (5-week-old tissue culture seedlings were placed in a 4-degree Celsius light incubator for 24 hours), and young leaves and top buds were taken to extract RNA for qRT-PCR (qRT-PCR method same as Example 2) to study the response of the MeSR34b gene to adverse environments. The results showed that low temperature inhibited the expression of the MeSR34b gene. Figure 1

[0040] Example 4: Construction of plant overexpression vector

[0041] The amplification product of Example 1 was digested with BanH I and Sal I and ligated into the pCambia1301 vector, in which the 5' end of the pCambia1301 vector is the CaMV35S promoter and the myc or RFP sequence, and the 3' end is the Nos terminator. Finally, the 1301-35S::myc-MeSR34b vector and the 1301-35S::RFP-MeSR34b vector were constructed.

[0042] Example 5: Subcellular localization analysis of MeSR34b

[0043] The 1301-35S::RFP-MeSR34b plasmid was transformed into Agrobacterium GV3101 by heat shock method (i.e., 100 μL of competent Agrobacterium cells were taken in a pre-cooled centrifuge tube, 0.1-1 μg of plasmid DNA was added, the centrifuge tube was quickly frozen in liquid nitrogen for 5 minutes, the centrifuge tube was quickly taken out of the liquid nitrogen and immediately placed in a 37-degree Celsius water bath, heat shock for 5 minutes, and then spread on the culture medium). The Agrobacterium was spread on solid YEP medium with kanamycin and rifampicin antibiotics, and after the colonies grew, PCR identification was performed, and the positive colonies were shaken and stored for subsequent plant infection.

[0044] The Agrobacterium containing the 1301-35S::RFP-MeSR34b plasmid was centrifuged, resuspended with infiltration buffer containing acetosyringone and magnesium salt to an appropriate concentration (OD 600 ≈ 0.5-1.0), and after induction at room temperature, it was injected into the back of healthy tobacco leaves using a syringe (without needle), so that the bacterial solution infiltrated the leaves. Then the plants were normally cultured for 2-5 days for subcellular localization observation. The lower epidermis of tobacco leaves was injected by transient transformation, and observed by confocal fluorescence microscope. The results showed that the MeSR34b protein was localized in the nucleus. Figure 2

[0045] Example 5: Effect of MeSR34b on plants ​​

[0046] The 1301-35S::myc-MeSR34b plasmid was transformed into Agrobacterium GV3101 by heat shock method (i.e. 100 μL competent Agrobacterium cells were taken in a pre-cooled centrifuge tube, 0.1-1 μg of plasmid DNA was added, the centrifuge tube was quickly frozen in liquid nitrogen for 5 minutes, the centrifuge tube was quickly taken out from the liquid nitrogen and immediately placed in a 37°C water bath, and heat shock was performed for 5 minutes), the Agrobacterium was spread on solid YEP medium added with kanamycin and rifampicin antibiotics, and after the colonies grew, PCR identification was performed, the colonies with positive PCR were shaken and stored for subsequent plant infection.

[0047] The embryogenic friable callus of cassava cultivar cv. 60444 was used as the recipient material, and Agrobacterium liquid with OD = 1.0 was centrifuged to collect the bacteria, washed twice with MS medium without antibiotics, suspended in the same volume of MS medium added with 100 mmol / L acetosyringone, a small amount of embryogenic friable callus was suspended at room temperature for 40 minutes, the bacteria liquid was removed after centrifugation, and the callus cells were placed on MS solid medium added with 100 mmol / L acetosyringone and cultured in the dark at 22°C for 3 days. After repeatedly washing the callus cells with sterile water, the callus cells were placed on GD solid medium added with 500 mg / L carbenicillin and 5 mg / L hygromycin and cultured under light at 26°C for 2 weeks, the untransformed cells were eliminated, and resistant callus was induced; then the callus cells were transferred to embryogenic induction medium added with 500 mg / L carbenicillin and 5 mg / L hygromycin, and resistant transgenic plants were obtained.

[0048] As shown in Figure 3 , high expression plant lines of MeSR34b were obtained by genetic transformation (callus transformation) of cassava (A of Figure 3 , and high expression of MeSR34b protein was detected by Western blot (B of Figure 3 ). Observation of the overexpression lines showed that the color of the new leaves was yellow, which showed low chlorophyll content, but the color and chlorophyll content of the mature leaves were not significantly different from those of the wild type. Detection of the expression of chlorophyll degradation genes MeSRG1 / 2 in the new leaves showed that the expression of MeSRG1 and MeSRG2 genes in the overexpression lines was higher than that in the wild type (C of Figure 3 and D of Figure 3 ), indicating that the color of the leaves was related to the rapid chlorophyll degradation. Accordingly, the transgenic lines and ordinary lines can be preliminarily distinguished by the color of the new leaves. Moreover, the yellow color of the new leaves can increase the ornamental value of cassava plants, providing a new way for the cultivation of ornamental cassava varieties.

[0049] The transgenic plants were transferred to the outdoor environment for 30 days, and were placed in a light incubator with a temperature of 4°C, light / dark of 16h / 8h, and humidity of 70% for low temperature treatment for 6 days. Morphological observation was taken at different time periods, and malondialdehyde (MDA) content, proline content, and the like were detected at different time periods. The results show that after low temperature treatment of the cassava WT and MeSR34b OE #1 and 2 for 4h and 6d, the phenotype difference after low temperature treatment is observed, the WT top bud becomes soft after suffering from low temperature, and the leaf fingers are low, while the MeSR34b OE plant line only has part of the leaf wilting, and the top bud is not affected, which shows that overexpression of MeSR34b significantly improves the tolerance of cassava to low temperature Figure 4 A). Physiological index detection shows that the malondialdehyde (MDA) content in the transgenic plant line is significantly lower than that of the wild type Figure 4 B), and the proline accumulation is obviously higher than that of the wild type Figure 4 C).

[0050] The transgenic plant leaves and the leaves of the common cassava with the same growth vigor were taken, and the isolated leaves were soaked in 100 μM methyl viologen aqueous solution, and were placed in a light incubator with a temperature of 26°C, light / dark of 16h / 8h, and humidity of 70% for 5 days. Methyl viologen can quickly induce the leaves to appear typical oxidative damage symptoms such as chlorosis and necrosis, and then the leaves were photographed to evaluate the antioxidant capacity. Methyl viologen can induce oxidative damage in plants. The mature leaves of the WT and MeSR34b OE plant lines were treated with methyl viologen, and it was found that the yellowing rate of the WT leaves was significantly earlier than that of the MeSR34b OE leaves, and the chlorophyll content was also lower than that of the MeSR34b OE leaves Figure 4 D and Figure 4 E), which shows that high expression of MeSR43b reduces the oxidative damage of cells, thereby enhancing the tolerance of the plant to low temperature.

[0051] Example 5: Cassava MeSR34b specifically regulates the expression of 2930 protein-coding genes

[0052] In order to further study the downstream key genes and signal pathways regulated by MeSR34b, we performed transcriptomic sequencing analysis on the WT and the high expression plant line of MeSR34b. DEseq was used for differential expression analysis of downstream genes, and genes with |log2Ratio|≥1 and q<0.05 were selected as differentially expressed downstream genes by comparing the transgenic plant line with the control group. We found that a considerable number of protein-coding genes were directly or indirectly regulated by MeSR34b Figure 5A). KEGG analysis of differentially expressed genes regulated by MeSR34b showed significant enrichment of genes involved in secondary metabolism (Fig. 1 Figure 5 B), and the use of quantitative and semi-quantitative PCR verification found that MeSR34b can induce MeBED (Manes.03G090703) and MeATL54 (Manes.13G097400) gene alternative splicing body differential expression (Fig. 1 Figure 5 C), while MeWRKY42 / 33 (Manes.03G132901 / Manes.04G102600), MeDREB2a / 2f (Manes.08G096900 / Manes.08G048500) and other genes (https: / / phytozome-next.jgi.doe.gov / ) expression were strongly induced by MeSR34b (Fig. 1 Figure 5 D), which will be the focus of further research.

[0053] In crop cultivation and breeding, it is of core significance to find downstream genes and interacting factors regulated by target genes. Its role is as follows: first, to analyze the regulatory network. It can fully reveal how the target gene controls the molecular pathway of cold resistance and yield through cascade reaction. Second, to accurately guide breeding. Downstream genes and interacting factors can be used as more direct and stable molecular markers to guide genetic breeding, accelerate the aggregation of excellent alleles, and avoid the unpredictability of multi-gene regulation. Third, to explore new targets. Downstream genes and interacting factors themselves may be the key switch of trait regulation, which can be used as new targets for gene editing or transgenic breeding, thereby bypassing the negative effects of upstream major genes and achieving more precise trait improvement. In the present invention, the study of cassava MeSR34b on regulatory genes in cassava provides a theoretical basis and gene resources for realizing the directional and efficient genetic improvement of cassava stress resistance traits.

[0054] The specific embodiments of the present application are described in detail above, but they are only examples, and the present application is not limited to the specific embodiments described above. Any equivalent modifications and alternatives to the present application made by those skilled in the art are also within the scope of the present application. Therefore, any equivalent transformation and modification made without departing from the spirit and scope of the present application should be covered within the scope of the present application.

Claims

1. Use of a cassava low-temperature-resistant MeSR34b gene, or a protein encoded by the cassava low-temperature-resistant MeSR34b gene, or a recombinant vector containing the cassava low-temperature-resistant MeSR34b gene, or a host bacterium or an expression cassette containing the cassava low-temperature-resistant MeSR34b gene in improving the low-temperature resistance of cassava, and / or increasing the content of malondialdehyde, and / or increasing the accumulation of proline, wherein the CDS sequence of the cassava low-temperature-resistant MeSR34b gene is shown as SEQ ID NO:

1.

2. Use of a cassava low-temperature-resistant MeSR34b gene, or a protein encoded by the cassava low-temperature-resistant MeSR34b gene, or a recombinant vector containing the cassava low-temperature-resistant MeSR34b gene, or a host bacterium or an expression cassette containing the cassava low-temperature-resistant MeSR34b gene in yellowing new leaves of cassava, wherein the CDS sequence of the cassava low-temperature-resistant MeSR34b gene is shown as SEQ ID NO:

1.

3. Use of a cassava low-temperature-resistant MeSR34b gene, or a protein encoded by the cassava low-temperature-resistant MeSR34b gene, or a recombinant vector containing the cassava low-temperature-resistant MeSR34b gene, or a host bacterium or an expression cassette containing the cassava low-temperature-resistant MeSR34b gene in improving the resistance of cassava to oxidative damage and / or improving the resistance of cassava to methyl viologen damage, wherein the CDS sequence of the cassava low-temperature-resistant MeSR34b gene is shown as SEQ ID NO:

1.

4. Use of a cassava low-temperature-resistant MeSR34b gene, or a protein encoded by the cassava low-temperature-resistant MeSR34b gene, or a recombinant vector containing the cassava low-temperature-resistant MeSR34b gene, or a host bacterium or an expression cassette containing the cassava low-temperature-resistant MeSR34b gene in cultivating ornamental cassava varieties, and / or cultivating low-temperature-resistant cassava varieties, and / or screening low-temperature-resistant cassava germplasm, wherein the CDS sequence of the cassava low-temperature-resistant MeSR34b gene is shown as SEQ ID NO:

1.

5. The cassava low-temperature tolerance MeSR34b gene, or the protein encoded by the cassava low-temperature tolerance MeSR34b gene, or a recombinant vector, host bacterium, or expression cassette containing the cassava low-temperature tolerance MeSR34b gene, in improving... MeBED Gene expression, and / or enhancement MeATL54 Gene expression, and / or enhancement MeWRKY42 / 33 Gene expression, and / or enhancement MeDREB2a / 2f The application of the gene, the CDS sequence of the cassava low-temperature resistant MeSR34b gene is shown in SEQ ID NO:

1.

6. Use according to any one of claims 1 to 5, characterized in that, The original vector of the recombinant vector is a pCambia1301 vector, the coding region of the cassava low-temperature-resistant MeSR34b gene is located between the BanH I and Sal I restriction endonuclease sites of the pCambia1301 vector, the 5' end of the pCambia1301 vector is a CaMV35S promoter and a myc or RFP sequence, and the 3' end is a Nos terminator.

7. A pair of primers, characterized in that, The primer pair is MeSR34b cloning primer Sense Primer: CGGGATCCTATGAGTAGCCGCGCGAGCAGAA and MeSR34b cloning primer Antisense Primer: ACGCGTCGACTCACCGGGATAAGCTCCTGCTC.

Images