Application of lentinan in preparation of medicine for treating triple negative breast cancer

Abstract

The invention belongs to the technical field of biomedicine, and discloses application of lentinan in preparation of a medicine for treating triple negative breast cancer, the lentinan can down-regulate the protein of SCGB2A2 and / or mRNA expression level to inhibit the growth of triple negative breast cancer cells (such as MDA-MB-468, MDA-MB-436 and / or MDA-MB-231 cells). The lentinan is found to be capable of effectively treating the triple negative breast cancer, and the lentinan regulates SCGB2A2, so that the problem of lack of triple negative breast cancer treatment targets in the prior art is solved at the same time.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biomedical technology, more specifically, relates to the application of lentinan in the preparation of a drug for treating triple-negative breast cancer. BACKGROUND

[0002] Breast cancer is the most common malignant tumor in women, and the incidence of breast cancer has been increasing year by year since 2000. Triple-negative breast cancer (TNBC) is the most malignant and invasive subtype, accounting for 15-20% of breast cancer. Because of the lack of specific treatment targets, current treatment methods are still mainly chemotherapy and surgery, but the toxic side effects of chemotherapy drugs often lead to unsatisfactory prognosis. Therefore, it is urgent to find new treatment drugs and targeted treatment programs.

[0003] SCGB2A2 is a secretoglobin family 2A member 2, which is considered a potential new marker, and the expression rate is high in primary and metastatic breast tumors, and low in normal breast, indicating its potential as a breast cancer treatment target. However, the exact function of SCGB2A2 is not clear, some studies show that it promotes breast cancer cell proliferation and metastasis, and is related to the triple-negative state of breast cancer, and some reports show that SCGB2A2 inhibits breast cancer proliferation, so it is crucial to determine the function of SCGB2A2 in breast cancer for the development of breast cancer treatment drugs.

[0004] Lentinan is a beta-glucan extracted from the fruiting bodies of Lentinus edodes, and lentinan is considered to have antiviral and immunomodulatory activity in the prior art, and is mainly used for the treatment of hepatitis B virus and gastrointestinal tumors. So far, there has been no report of lentinan being used to prepare a breast cancer marker SCGB2A2 to treat triple-negative breast cancer. SUMMARY

[0005] In view of the side effects of triple-negative breast cancer chemotherapy drugs in the existing treatment methods, the present application aims to provide the application of lentinan in the preparation of a drug for treating triple-negative breast cancer, and the present application finds that lentinan can effectively treat triple-negative breast cancer, and lentinan regulates SCGB2A2, thereby solving the problem of the lack of triple-negative breast cancer treatment targets in the prior art.

[0006] To achieve the above-mentioned purpose, according to one aspect of the present application, there is provided the application of lentinan in the preparation of a drug for treating triple-negative breast cancer.

[0007] As a further preferred embodiment of the present application, the lentinan can down-regulate the protein and / or mRNA expression level of SCGB2A2 to inhibit the growth of triple-negative breast cancer cells.

[0008] As a further preferred embodiment of the present application, the lentinan is used for inhibiting the growth of triple-negative breast cancer MDA-MB-468, MDA-MB-436 and / or MDA-MB-231 cells.

[0009] As a further preferred embodiment of the present application, the lentinan is used for inhibiting the growth of triple-negative breast cancer MDA-MB-468 cells.

[0010] As a further preferred embodiment of the present application, the lentinan is used for inhibiting the growth of triple-negative breast cancer MDA-MB-468 xenograft tumor.

[0011] As a further preferred embodiment of the present application, the dose of lentinan applied per kg organism per 2 days is 5 mg.

[0012] As a further preferred embodiment of the present application, the triple-negative breast cancer treating drug is an intravenous injection preparation.

[0013] By the above technical solutions conceived by the present application, compared with the prior art, the present application finds that lentinan can effectively treat triple-negative breast cancer, and lentinan can inhibit the growth of triple-negative breast cancer cells by down-regulating the protein and / or mRNA expression level of SCGB2A2, and inhibit the growth of triple-negative breast cancer MDA-MB-468, MDA-MB-436 and / or MDA-MB-231 cells.

[0014] As exemplified in the examples below, the present application proves through multiple in vitro experiments and animal experiments that lentinan can inhibit the growth of triple-negative breast cancer and significantly inhibit the growth of triple-negative breast cancer cells and xenograft tumor. As described in the examples below, the present application further screens out the key target SCGB2A2 of lentinan against breast cancer cell growth through proteomics and bioinformatics research (such as using GeneCard database, GEPIA2 database and OncoDV database). It is proved through Western Blot and qRT-PCR experiments that lentinan down-regulates the protein and / or mRNA expression level of SCGB2A2, and lentinan inhibits the growth of breast cancer cells and xenograft tumor by down-regulating the expression of SCGB2A2, which provides a new target and treatment strategy for the treatment of triple-negative breast cancer patients, and also provides a new theoretical basis for the clinical application of lentinan as an anti-triple-negative breast cancer drug.

[0015] The present application proves that lentinan plays a role in treating triple-negative breast cancer by inhibiting the expression of SCGB2A2; as exemplified in the examples below, through in vitro proliferation experiments, wound healing and invasion experiments by gene interference means, SCGB2A2 knockout xenograft tumor in vivo experiments are constructed using CRISPR-Cas9 technology, confirming the role of SCGB2A2 in promoting cell growth, migration and cycle progression in triple-negative breast cancer, that is, SCGB2A2 can promote the malignant progression of triple-negative breast cancer, which is a key target for lentinan to play an anti-triple-negative breast cancer role, providing a promising therapeutic target and theoretical basis for triple-negative breast cancer, and laying a solid foundation for the clinical application of lentinan in treating triple-negative breast cancer.

[0016] The present application proves that intravenous injection of lentinan has the characteristics of safe and low toxicity in treating triple-negative breast cancer-bearing nude mice, as exemplified in the examples below, the dose of lentinan applied by the present application per kg organism every 2 days is 5mg, which has no obvious effect on the liver damage markers (ALT and AST) of nude mice, kidney damage markers (BUN and Cr) and body weight of nude mice, and the present application provides a promising therapeutic drug for treating triple-negative breast cancer, overcoming the limitations of current triple-negative breast cancer treatment.

[0017] The present application proves that SCGB2A2 is a key target for lentinan to play an anti-triple-negative breast cancer cell growth role through in vivo and in vitro rescue experiments, as exemplified in the examples below, the present application proves that lentinan can significantly down-regulate the expression level of SCGB2A2 protein in triple-negative breast cancer cells, and in vivo and in vitro experiments have confirmed that overexpression of SCGB2A2 can rescue the killing effect of lentinan on breast cancer cells, that is, the inhibitory effect of lentinan on triple-negative breast cancer cells and xenograft tumors after overexpression of SCGB2A2 is weakened. The present application excludes the false positive nature behind the phenomenon through rescue experiments, and establishes a rigorous and reliable causal logic. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 lentinan has a significant anti-triple-negative breast cancer cell growth effect; wherein, Figure 1 A in the formula (I) is CCK-8 method for detecting the influence of lentinan on the proliferation activity of three kinds of triple-negative breast cancer cells; Figure 1 B in the formula (I) is a clonogenic assay for detecting the anti-triple-negative breast cancer activity of lentinan; Figure 1 C-E in the formula (I) are in vivo anti-tumor experiments of lentinan (wherein, Figure 1 C in the formula (I) is a representative ex vivo tumor picture, Figure 1 D in the formula (I) is a tumor volume record of each group of mice, Figure 1 E in the formula (I) is a tumor weight statistical chart of each group of mice); and Figure 1F is the H&E and Ki67 staining images of tumor tissue, to evaluate the effect of lentinan on the morphology and proliferation activity of tumor cells; Figure 1 H-K in FIG. 7 are the contents of ALT, AST, BUN and Cr in the serum of MDA-MB-468 tumor-bearing nude mice; Figure 1 L in FIG. 8 is the body weight of MDA-MB-468 tumor-bearing nude mice in each group.

[0019] Figure 2 is that lentinan significantly down-regulates the expression of breast cancer marker SCGB2A2 in MDA-MB-468 cells; wherein, Figure 2 A-B in FIG. 9 are the proteomics experiments comparing the significantly different proteins in MDA-MB-468 cells before and after lentinan treatment; Figure 2 C in FIG. 10 is the comparison of the top 10 proteins significantly down-regulated by lentinan with breast cancer-related target genes from the GeneCard database, finding the key gene SCGB2A2; Figure 2 D-E in FIG. 11 are the detection of SCGB2A2 protein expression in MDA-MB-468 cells and tumor tissues after treatment with lentinan at different concentrations by Western Blot method (wherein, Figure 2 D is MDA-MB-468 cells, Figure 2 E is MDA-MB-468 tumor tissue); Figure 2 F in FIG. 12 is the effect of lentinan at different concentrations on the expression of SCGB2A2 in cells by immunofluorescence method, wherein blue represents the cell nucleus and green represents SCGB2A2; Figure 2 G in FIG. 13 is the effect of lentinan at different concentrations on the mRNA level of SCGB2A2 by qRT-PCR method, Figure 2 H-J in FIG. 14 are the effects of lentinan on the secretion of SCGB2A2 by triple-negative breast cancer cells by ELISA method (wherein, Figure 2 H is the standard curve, R 2 value of 0.9993 indicates a good fitting effect, Figure 2 I is the content of SCGB2A2 in the cell culture supernatant, Figure 2 J is the content of SCGB2A2 in the serum of tumor-bearing nude mice).

[0020] Figure 3 is that SCGB2A2 has high breast specificity and is highly expressed in breast cancer; wherein, Figure 3 A in FIG. 15 is the SCGB2A2 expression profile of all tumor samples and paired normal tissues in the GEPIA2 database (wherein, BRCA has the highest expression; BRCA represents breast cancer); Figure 3 B in FIG. 16 is the comparison of SCGB2A2 expression in breast cancer samples and adjacent healthy tissues in the OncoDV database;Figure 3 C, D in each of which is the elevation of SCGB2A2 level is associated with the difference of overall survival and disease-free survival.

[0021] Figure 4 is to test the overexpression efficiency of SCGB2A2 and the influence on the proliferation, migration and cycle progression of breast cancer after overexpression of SCGB2A2; wherein, Figure 4 A in each of which is the expression of SCGB2A2 in three kinds of breast cancer cells after screening stable strains by Western Blot detection, to verify the successful overexpression of SCGB2A2 in breast cancer cells (from left to right: MDA-MB-468, MDA-MB-231 and MDA-MB-436 cells); Figure 4 B in each of which is the effect of SCGB2A2 in cell cycle detected by cell cycle test kit; Figure 4 C in each of which is the CCK-8 detection of control cells and SCGB2A2 overexpressed cells in three kinds of breast cancer cells; Figure 4 D in each of which is the clonogenic assay to detect the proliferation ability of control cells and SCGB2A2 overexpressed three kinds of breast cancer cells; Figure 4 E in each of which is the Transwell experiment to detect the influence of SCGB2A2 overexpression on the migration and invasion ability of three kinds of breast cancer cells; Figure 4 F in each of which is the scratch test to detect the influence of SCGB2A2 overexpression on the migration ability of three kinds of breast cancer cells, and the width of injury-healing is marked at 0h, 24h and 48h respectively.

[0022] Figure 5 is to test the knockdown efficiency of SCGB2A2 and the influence on the growth of breast cancer cells and xenograft tumor after knockdown of SCGB2A2; Figure 5 A in each of which is the expression of SCGB2A2 in three kinds of breast cancer cells after screening stable strains by Western Blot detection, to verify the different degrees of knockdown of SCGB2A2 in breast cancer cells; Figure 5 B in each of which is the CCK-8 method to detect the proliferation activity of breast cancer cells after different degrees of knockdown of SCGB2A2; Figure 5 C in each of which is the effect of knockdown of SCGB2A2 in tumor-bearing nude mice, and the representative ex vivo tumor pictures; Figure 5 D in each of which is the tumor volume statistical chart of blank control group and SCGB2A2 knockdown group; Figure 5 E in each of which is the final tumor statistical chart of blank control group and SCGB2A2 knockdown group; Figure 5 F in each of which is the EdU staining experiment of tumor tissue of blank control group and SCGB2A2 knockdown group, and the breast cancer cell proliferation ability is evaluated quantitatively and statistically; Figure 5G is the Ki67 staining and quantitatively evaluating the breast cancer cell proliferation ability of the tumor tissues of the blank control group and the SCGB2A2 knockdown group in the figure.

[0023] Figure 6 is that lentinan inhibits the in vivo and in vitro proliferation of breast cancer cells by down-regulating SCGB2A2; Figure 6 A and B in the figure are MDA-MB-468 cells and MDA-MB-436 cells overexpressing SCGB2A2, respectively, and the proliferation activity is determined by the CCK-8 method after being treated with 800 μg / mL lentinan; Figure 6 C in the figure is MDA-MD-468 cells with SCGB2A2 knockdown, and the proliferation activity is determined by the CCK-8 method after being treated with 800 μg / mL lentinan; Figure 6 D in the figure is a representative photo of the tumor of the SCGB2A2 overexpression and control group of tumor-bearing nude mice with or without 5 mg / kg lentinan administration treatment; Figure 6 E-F in the figure are statistical graphs of measuring tumor volume and final tumor weight; Figure 6 G in the figure is SCGB2A2 immunohistochemical staining detection in overexpressed SCGB2A2 and control tumor tissues to determine the expression of SCGB2A2; Figure 6 H in the figure is the content of SCGB2A2 detected by Western Blot method after 800 μg / mL lentinan is given to the overexpressed SCGB2A2 and control cells for 48 h; Figure 6 I in the figure is the content of SCGB2A2 in the above four groups of tumor tissues detected by Western Blot method. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application will be further described in detail below in combination with the drawings and examples. It should be understood that the specific examples described herein are only used to explain the present application and do not limit the present application. In addition, the technical features involved in each embodiment of the present application described below can be combined with each other as long as they do not conflict with each other.

[0025] Example 1: A lentinan and its extraction method Lentinan was extracted and purified from dried Lentinula edodes fruiting bodies according to prior art methods (e.g. J. Agric. Food Chem. 2013, 61, 9849-9858). 250 g of fruiting bodies were washed and cut into small pieces, and soaked in 95 wt% ethanol overnight to remove organic impurities. The Lentinula edodes was boiled in 2000 mL of boiling water twice for 1 h each time, and the resulting filtrate was mixed and concentrated to 600 mL. The cooled concentrated solution was mixed with an equal volume of 95 wt% ethanol, and centrifuged at 4000 rpm for 15 min. The resulting precipitate was collected and dried to obtain crude lentinan. The crude lentinan was dissolved in 450 mL of distilled water. To decolorize the solution and remove proteins, 50 mL of 30 wt% H2O2 was slowly added dropwise while stirring under heating at 55 °C. After 5 h of reaction, the solution was precipitated with an equal volume of 95 wt% ethanol, and the resulting precipitate was collected by centrifugation and dried to obtain decolorized lentinan. Finally, the decolorized crude lentinan was dissolved in 1000 mL of distilled water, and ultrafiltration was performed using an ultrafiltration membrane with a molecular weight cut-off of 300 kDa. The resulting macromolecular mixture was collected, and finally freeze-dried to obtain purified lentinan.

[0026] The obtained lentinan was designated as SLNT.

[0027] Example 2 Experimental methods: CCK-8 experiment: Three triple-negative breast cancer cell lines MDA-MB-468, MDA-MB-436 and MDA-MB-231 were purchased from Wuhan Ponsgen Biotech Co., Ltd. Cells (5 x 10 3 / well) were seeded in 96-well plates and cultured for 24 h, then 0, 200, 400 and 800 pg / mL lentinan solution was added for further culture for 48 h. CCK-8 reagent was added and incubated at 37 °C for 1 h, and then the absorbance was measured (450 nm). The complete medium without lentinan solution was used as the NC group, and the complete medium containing 800 pg / mL lentinan solution was used as the “SLNT (800 pg / mL)” group.

[0028] Clonogenic assay: MDA-MB-468 and MDA-MB-436 cells (1000 cells / well) were seeded in 24-well plates and cultured for 24 h, then 0, 200, 400 and 800 pg / mL lentinan solution was added for further culture for 48 h, followed by replacement with complete medium for further culture for 14 days. The cells were fixed (4 wt% paraformaldehyde) for 30 min and stained with 0.1 wt% crystal violet for 15 min, and then photographed to count the number of colonies.

[0029] Experimental animals and grouping in the embodiments of the present application: 30 five-week-old female Balb / c mice were adaptively fed for one week, and the mice were subcutaneously injected with MDA-MB-468 cells 8x10 6 each group, i.e. a blank control group (0.9wt% physiological saline, denoted as the NC group), a low-dose lentinan administration group (1mg / kg lentinan; that is, 1mg of lentinan was applied to each kg of the mice; denoted as the “SLNT (1 mg / kg)” group), and a high-dose lentinan group (5mg / kg lentinan; that is, 5mg of lentinan was applied to each kg of the mice; denoted as the “SLNT (5 mg / kg)” group). After the tumor implantation, the next day, the mice were injected with 0.9wt% physiological saline or lentinan solution in the tail vein according to the grouping, and the tumor volume was measured every 2 days. After 4 weeks, the mice in each group were sacrificed after anesthesia, and the tumor tissues were peeled off for use, the tumor weight was recorded, and the tumor volume calculation formula was V=1 / 2 (length x width 2 ).

[0030] Immunohistochemical staining: H&E staining was used to observe the tissue morphology and structure, and the wax blocks of the tumor tissues of each group after embedding were cut into sections with a thickness of 4μm, the sections were sequentially soaked in xylene for 40min, 85wt% ethanol for 5min, and 75wt% ethanol for 5min, and then rinsed with pure water, followed by staining the samples with hematoxylin for 5min, eosin for 10min, and dehydration and transparency, and then mounting, and the sections were observed and photographed under a microscope under white light. Ki-67 staining was used to evaluate the tumor proliferation activity: Ki-67 is a recognized cell proliferation marker, 10mM sodium citrate buffer (pH=6.0) was used for antigen repair, the sections were incubated with the primary antibody of Ki-67 (1:1000, v:v) at 4°C overnight, the secondary antibody was incubated according to the instructions of the IHC kit, diaminobenzidine (DAB) was used as a color developing agent, hematoxylin was used for restaining, and then a semi-quantitative evaluation was performed.

[0031] The results are as follows Figure 1The anti-triple negative breast cancer activity of lentinan was verified. In the CCK-8 experiment in vitro, lentinan significantly inhibited the proliferation activity of three triple negative breast cancer cells in a concentration-dependent manner. When the concentration of lentinan was 800 μg / mL, the inhibition rates of MDA-MB-231 and MDA-MB-436 cells were 24.16 ± 3.95% and 27.95 ± 1.65%, respectively, and especially for MDA-MB-468 cells, the inhibition rate was as high as 70.02 ± 5.13%. In the in vitro colony formation experiment, lentinan could significantly inhibit the colony formation ability of triple negative breast cancer cells, and the inhibition rates of MDA-MB-468 and MDA-MB-436 cells were 66.92 ± 3.78% and 35.06 ± 5.68%, respectively. Subsequently, the MDA-MB-468 cells with the best inhibition effect were subjected to in vivo anti-tumor experiment. From the tumor graph, tumor volume and tumor weight, it can be seen that the lentinan administration group can significantly inhibit the growth of triple negative breast cancer tumor. The H&E and Ki67 staining results of tumor tissue showed that after lentinan administration, tumor cells appeared in multiple places Apoptosis morphology (nuclear pyknosis and cytoplasmic vacuoles), and lentinan significantly down-regulated the expression level of Ki67 in tumor tissue, indicating that lentinan administration significantly inhibited the proliferation of triple negative breast tumor. In addition, the detection of ALT, AST, BUN and Cr indicators in the serum of nude mice and the body weight data of nude mice showed that there was no significant difference between the lentinan administration group and the control group, indicating that lentinan administration did not cause liver and kidney damage in nude mice, and had no obvious side effects. In summary, lentinan administration can significantly inhibit the in vitro proliferation of triple negative breast cancer cells and the in vivo growth of tumor, and has no obvious toxic side effects.

[0032] Example 3 Proteomics research: The cell line MDA-MB-468 with the best inhibition effect of lentinan was used for proteomics detection and analysis. The same heavy isotope labeling quantitative (TMT) technology was used to quantitatively compare the protein content in the cell samples, and the experiment was divided into blank control group and 800 μg / mL lentinan administration group, each group was repeated three times, and the significant difference proteins were screened according to the two conditions of Fold change>2 and Q-value<0.05.

[0033] Immunofluorescence staining and imaging: cell slides were prepared, and after 24 h, they were fixed with 4wt% paraformaldehyde at room temperature for 30 min, and washed with PBS for 2 times, then 3wt% BSA+0.05wt% Triton-X-100 blocking solution was used for room temperature blocking for 1 h. Incubate SCGB2A2 primary antibody at 4℃ overnight, wash with PBS for 5 times, incubate secondary antibody at room temperature for 1 h, wash with PBS for 5 times, and then mount with anti-fluorescence quenching agent containing DAPI. Finally, observe the cells by laser confocal microscope and take pictures.

[0034] qRT-PCR experiment: to detect the expression level of SCGB2A2 mRNA, upstream primer: 5'- GAACACCGACAGCAGCAGCA-3'; downstream primer: 5'-TCTCCAATAAGGGGCAGCC-3'.

[0035] Western Blot experiment: gel preparation, 10wt% separation gel, protein sample denaturation at 100°C for 10min, 50μg loading; constant voltage 80v into gel, when the front of bromophenol blue just entered the separation gel, constant voltage 120v running gel; constant current transfer tank for 90min; use fast blocking solution for 5min; dilute the primary antibody (1:1000, v:v) with TBST solution containing 3wt% bovine serum albumin, incubate the PVDF membrane containing target protein at 4°C overnight; soak the membrane with TBST for 1 time, 10min; soak the membrane with TBST for 2 times, 10min each time; dilute the secondary antibody (1:5000, v:v) with TBST, incubate at room temperature for 1h; soak the membrane with TBST for 3 times, 10min each time, ECL color development, scan the results for analysis.

[0036] Detection of SCGB2A2 secretion content: MDA-MB-468 cells were seeded in 10cm plates and cultured with normal medium, 12h later, the cells were washed with PBS for 2 times, and then the medium was changed to Opti-MEM, and the cells were treated with or without 500μg / mL lentinan. After 48h, the supernatant medium was harvested, centrifuged at 4000rpm for 20min to eliminate floating cells, and then the medium was concentrated using ultrafiltration tube with a molecular weight cut-off of 3kDa. Subsequently, according to the manufacturer's protocol, the ELISA kit was used to quantify the SCGB2A2 level in the serum of tumor-bearing nude mice and the concentrated cell culture supernatant in the experimental group.

[0037] Results are shown in Table 1 Figure 2As shown, the proteomics research results showed that 8487 proteins were identified in the control group and the lentinan treatment group, of which 220 proteins were significantly down-regulated and 101 proteins were significantly up-regulated. The clustering analysis results of the differential proteins showed that the sample repeatability of each group was good and could be used for subsequent analysis. The top ten significantly down-regulated proteins were marked in the volcano plot of differential proteins, which were MAGA6, TNFSF10, COA5, MT2, SCD, C1RL, MT1X, TRI26, SCG2BA2 and UBL5. By comparing these 10 differential proteins with the top 1000 breast cancer related target genes from the GeneCard database, the SCGB2A2 protein was found as a breast cancer marker. Subsequently, the down-regulation of SCGB2A2 protein by lentinan in triple-negative breast cancer cells was verified. Western Blot results showed that lentinan down-regulated the content of SCGB2A2 protein in MDA-MB-468 cells and tumor tissues in a concentration-dependent manner, that is, the down-regulation effect of SCGB2A2 protein in cells was best when the concentration of lentinan was 800 pg / mL, and the down-regulation effect of SCGB2A2 protein in tumor tissues was best when the concentration of lentinan was 5 mg / kg. Immunofluorescence experiments visually observed that the expression of SCGB2A2 in the cytoplasm of MDA-MB-468 cells was down-regulated (green fluorescence weakened) after lentinan administration for 48 h. The results of qRT-PCR experiments showed that the regulation of lentinan on SCGB2A2 also manifested in the down-regulation at the transcriptional level. In the existing theoretical basis, SCGB2A2 is a secretory protein that is synthesized in the cytoplasm and then secreted outside the cell to function. The above examples in this study have proved that lentinan can inhibit the expression of SCGB2A2 in triple-negative breast cancer cells, and it is necessary to study the effect of lentinan on the secretion of SCGB2A2. The content of SCGB2A2 in the cell culture supernatant and the serum of MDA-MB-468 tumor-bearing nude mice after lentinan treatment was detected using an ELISA kit, and the results showed that lentinan significantly inhibited the secretion of SCGB2A2 by triple-negative breast cancer cells. In summary, lentinan administration can significantly inhibit the expression level and secretion of SCGB2A2 in triple-negative breast cancer cells.

[0038] Example 4 The exact function of SCGB2A2 in breast cancer is still unclear. Although some studies show that it can promote the proliferation and metastasis of breast cancer cells, there are also reports that it has an inhibitory effect on proliferation. Therefore, elucidating the function of SCGB2A2 is crucial for understanding the anti-triple-negative breast cancer effect of lentinan.

[0039] Results as Figure 3As shown, first, the expression of SCGB2A2 in breast cancer was verified by means of information of existing databases. By using the GEPIA2 database to compare the gene expression profiles of all tumor samples and paired normal samples, it was found that SCGB2A2 was almost only expressed in breast cancer and normal breast, with high breast specificity. Subsequently, according to the OncoDV database, the mRNA expression of SCGB2A2 in invasive breast cancer and normal breast tissue was analyzed, and the expression level of SCGB2A2 in invasive breast cancer was significantly higher than that in the adjacent normal tissue. Among 535 patients with high and low expression of SCGB2A2, the overall survival rate and disease-free survival rate of patients with high expression of SCGB2A2 were lower than those of patients with low expression of SCGB2A2. In summary, the present case demonstrates that SCGB2A2 has high breast specificity and is highly expressed in breast cancer patients.

[0040] Example 5 Construction of SCGB2A2 stable overexpression cell strain: The lentiviral supernatant containing SCGB2A2 overexpression lentivirus and control vector were prepared by Jikai Gene (Shanghai, China). The insertion sequence of SCGB2A2 overexpression lentivirus is as follows (i.e., as shown in SEQ ID No. 1): ATGAAGTTGCTGATGGTCCTCATGCTGGCGGCCCTCTCCCAGCACTGCTACGCAGGCTCTGGCTGCCCCTTATTGGAGAATGTGATTTCCAAGACAATCAATCCACAAGTGTCTAAGACTGAATACAAAGAACTTCTTCAAGAGTTCATAGACGACAATGCCACTACAAATGCCATAGATGAATTGAAGGAATGTTTTCTTAACCAAACGGATGAAACTCTGAGCAATGTTGAGGTGTTTATGCAATTAATATATGACAGCAGTCTTTGTGATTTATTT. The triple-negative breast cancer cells MDA-MB-468, MDA-MB-436 and MDA-MB-231 cells were inoculated in a 6-well plate, and the lentiviral supernatant containing SCGB2A2 overexpression lentivirus was added to the cells according to the instructions, which was recorded as the “SCGB2A2 OE” group; the random sequence not targeting any gene was used as a control virus to infect the cells, which was recorded as the “Control OE” group. After 12 hours of infection, the lentivirus-containing supernatant was removed, and fresh culture medium was added. After 72 hours of lentivirus addition, the cells were cultured with complete medium containing 0.4 μg / mL puromycin for two weeks to screen cells stably overexpressing SCGB2A2.

[0041] Cell cycle experiment: 5xl05of triple negative breast cancer cells MDA-MB-468, MDA-MB-436 and MDA-MB-231 overexpressing SCGB2A2 and their respective control cells were used. Wells were seeded in 24-well plates and when cells reached 90% confluency, cells were trypsinized, washed twice with PBS, resuspended in single cell suspension and then fixed in 70wt% pre-chilled ethanol at 4°C overnight. Before analysis, cells were iodine propidium (PI) stained using Cell Cycle and Apoptosis Assay Kit according to the manufacturer's instructions. Cells were analyzed using flow cytometry. 4

[0042] Wound healing experiment: 1xl05of triple negative breast cancer cells MDA-MB-468, MDA-MB-436 and MDA-MB-231 overexpressing SCGB2A2 and their respective control cells were used. Wells were seeded in 24-well plates and incubated overnight in complete medium until 100% confluence; a sterile 10μL pipette tip was used to create an even wound; PBS was used to wash 3 times to remove debris; maintained in serum-free medium; initial wound image (0h) was captured using a fluorescent microscope; wound closure was monitored every 24h; wound area was measured using ImageJ software with the Wound Healing Tool plug-in; distance of wound edge movement compared to 0h was calculated. 5

[0043] Transwell experiment: 5xl05of triple negative breast cancer cells MDA-MB-468, MDA-MB-436 and MDA-MB-231 overexpressing SCGB2A2 and their respective control cells were used. Cells in serum-free medium were seeded in the upper chamber and complete medium containing 20vol% serum was added in the lower chamber. Migrated cells after 48h were stained with 0.1wt% crystal violet and counted. 4

[0044] Results are shown in Figures 1 to 3. Figure 4 ​​​As shown, a series of cell experiments targeting SCGB2A2 were designed in this case to verify the function of SCGB2A2 in the proliferation, migration and cycle progression of triple-negative breast cancer cells. First, triple-negative breast cancer cells MDA-MB-468, MDA-MB-436 and MDA-MB-231 were infected with SCGB2A2 overexpression lentivirus, and the overexpression efficiency was detected by Western Blot method. Next, we used propidium iodide (PI) staining and flow cytometry to determine the cell cycle proportion of MDA-MB-468 cells overexpressing SCGB2A2 and control cells. Cell cycle is the process of cell growth, division and proliferation, mainly divided into G1 phase, S phase, G2 phase and M phase, among which the DNA molecules in the S phase are replicated, and the RNA and protein synthesis before cell division is completed in the G2 phase. The detection results show that overexpression of SCGB2A2 leads to a significant increase in the proportion of MDA-MB-468 cells in S and G2 phases, indicating that SCGB2A2 can promote cell cycle progression. Next, we compared the difference in proliferation ability between cells overexpressing SCGB2A2 and corresponding control cells. The results of plate colony formation experiment showed that overexpression of SCGB2A2 can significantly promote the proliferation of triple-negative breast cancer cells. The results of CCK-8 cell proliferation experiment showed that overexpression of SCGB2A2 significantly increased the proliferation activity of three kinds of triple-negative breast cancer cells. Subsequently, the function of SCGB2A2 in migration was investigated. The results of scratch test and Transwell migration experiment showed that overexpression of SCGB2A2 can promote the migration of triple-negative breast cancer cells.

[0045] Example 6 CRISPR-Cas9 technology successfully constructs SCGB2A2 stable knockout cells: SCGB2A2 knockout lentivirus containing lentivirus supernatant and control vector were prepared by Jikai Gene (Shanghai, China). The sequences are as follows (corresponding to SEQ ID No. 2 to SEQ ID No. 4, respectively): #1 (i.e., clone #1): 5'-TCAATCCACAAGTGTCTAAGA-3' #2 (i.e., clone #2): 5'-ATGCCACTACAAATGCCATAG-3' #3 (i.e., clone #3): 5'-TGTATTCAGTCTTAGACACTT-3' MDA-MB-468 triple negative breast cancer cells were seeded in 6-well plates and lentivirus supernatant containing SCGB2A2 knock-out lentivirus was added to the cells according to the instructions, noted as "SCGB2A2 KO" group; random sequences that do not target any gene were used as control virus to infect cells, noted as "Control KO" group. After 12 hours of infection, the lentivirus-containing supernatant was removed and fresh culture medium was added. After 72 hours of lentivirus addition, cells were cultured with complete medium containing 0.4 μg / mL puromycin for two weeks to select cells stably knocked out of SCGB2A2.

[0046] Experimental animals and grouping in the embodiments of the present application: 20 five-week-old female Balb / c mice were adaptively fed for one week, and the mice were subcutaneously injected with #1 SCGB2A2 KO cells with the best knock-out efficiency or control blank knock-out cells (Control KO) 8x10 6 2 2

[0047] EdU staining experiment: according to the instructions, tumor sections were stained using the EdU cell proliferation detection kit. EdU was used to label actively proliferating cells, and DAPI was used to stain the cell nuclei to determine the total number of cells. The proliferation rate was calculated as the ratio of EdU-positive cells to the total number of cells.

[0048] Other specific experimental steps in this case are referred to the above experimental methods.

[0049] Results are shown in Table 1. Figure 5 ​To further understand the role of SCGB2A2 in promoting malignant progression of triple-negative breast cancer, in this example, three different sg plasmids were first constructed using CRISPR-Cas9 technology, and SCGB2A2 stably knocked out MDA-MB-468 cells were established. It was verified that SCGB2A2 knock-out clones #1 #2 #3 lost SCGB2A2 expression to varying degrees, among which clone #1 lost SCGB2A2 expression to the greatest extent and performed the best. Using these cells, the CCK-8 experiment results showed that the cell viability decreased significantly after SCGB2A2 was knocked out, and the cell proliferation activity was the lowest in the cells with the highest SCGB2A2 knock-out efficiency. This indicates that knocking down SCGB2A2 effectively inhibits the proliferation ability of breast cancer cells. We then selected triple-negative breast cancer cells MDA-MB-468 infected with clone #1 for in vivo experiments to evaluate the effect of SCGB2A2 on tumor proliferation. The SCGB2A2 KO and Control KO MDA-MB-468 cells stably transfected were inoculated subcutaneously on the right side of the back of nude mice. The tumors were harvested 30 days after inoculation. It can be seen that the tumor weight and volume of SCGB2A2 knock-out were significantly smaller than those of the control. EdU and ki67 staining of tumor tissues in the two groups showed that knocking out SCGB2A2 inhibited the proliferation of triple-negative breast cancer tumors. In combination with Example 4 and Example 5, the present application proves that SCGB2A2 promotes the proliferation of triple-negative breast cancer cells in vivo and in vitro, accelerates cell migration and cycle progression. In view of the tumor-promoting effect of SCGB2A2 in the progression of triple-negative breast cancer, the development of a preparation capable of down-regulating its expression as a new triple-negative breast cancer treatment strategy shows a broad application prospect.

[0050] Example 7 Animals and grouping for experiments in the examples of the present application: 40 five-week-old female Balb / c mice were adaptively fed for one week, and the mice were subcutaneously injected with triple-negative breast cancer cells MDA-MB-468 overexpressing SCGB2A2 cells (SCGB2A2 OE) and control cells (Control OE) 8x10 6 each, and randomly divided into four groups, 10 mice in each group, namely: Control OE group (intravenous injection of 0.9wt% normal saline), Control OE+SLNT group (intravenous injection of 5mg / kg lentinan), SCGB2A2 OE group (intravenous injection of 0.9wt% normal saline), and SCGB2A2 OE+SLNT group (intravenous injection of 5mg / kg lentinan). After the tumor implantation, the next day, the nude mice were injected with 0.9wt% normal saline or lentinan solution in the tail vein according to the grouping, and the drug was given every other day and the tumor volume was measured. After 4 weeks, the mice in each group were sacrificed after anesthesia, and the tumor tissue was peeled off for use, the tumor weight was recorded, and the tumor volume was calculated according to the formula: V=1 / 2 (length x width 2 ).

[0051] Other specific experimental procedures in this case refer to the experimental methods described above.

[0052] It has been proven that lentinan has significant anti-triple negative breast cancer effect in vitro and in vivo, and lentinan can significantly down-regulate the expression level of SCGB2A2 protein and mRNA in triple negative breast cancer cells. It is necessary to further verify that SCGB2A2 is a key target and lentinan exerts anti-triple negative breast cancer effect by down-regulating SCGB2A2.

[0053] The results are shown in Figure 6 To determine the causal relationship, the in vivo and in vitro SCGB2A2 rescue experiments were set up subsequently. In vitro culture, CCK-8 method was used to detect whether there was a difference in the inhibitory effect of 800 μg / mL lentinan on two kinds of triple negative breast cancer cells before and after SCGB2A2 overexpression. As shown in the figure, the inhibitory effect of lentinan treatment on cells without overexpression of SCGB2A2 was better, which indicated that the overexpression of SCGB2A2 weakened the inhibitory effect of lentinan on triple negative breast cancer cells; after knocking out SCGB2A2 in MDA-MB-468 cells, the viability of SCGB2A2 KO cells treated with lentinan was significantly lower than that of the corresponding control cells, and the cells after knocking out SCGB2A2 showed increased sensitivity to lentinan. In the in vivo experiment, we established a Control OE / SCGBA2 OE tumor-bearing nude mouse model to explore whether the overexpression of SCGB2A2 also antagonized the anti-tumor effect of the drug. After 5 mg / kg lentinan administration, the tumor size was significantly inhibited, and the overexpression of SCGB2A2 antagonized part of the anti-triple negative breast cancer tumor effect of lentinan, which was basically consistent with the in vitro results. Next, the tumor tissue sections were subjected to SCGB2A2 immunohistochemical staining, and the results showed that in the SCGB2A2 overexpression tumor, the expression of SCGB2A2 was significantly up-regulated, and the down-regulation of SCGB2A2 by lentinan decreased from 79.75% to 55.93%. The expression level of SCGB2A2 in the Control OE and SCGBA2 OE proteins treated with lentinan was also verified, and the results showed that the overexpression of SCGB2A2 rescued the down-regulation of lentinan on it. In summary, the above complementary experiments proved that the overexpression of SCGB2A2 restored the down-regulation of SCGB2A2 after lentinan administration, that is, the inhibitory effect of lentinan on breast cancer growth was mediated by SCGB2A2.

[0054] In summary, the present application firstly determines that lentinan administration can significantly inhibit the in vitro proliferation of triple-negative breast cancer cells and the in vivo tumor growth, secondly finds that lentinan can significantly down-regulate the expression levels of breast cancer marker SCGB2A2 protein and mRNA, proves the specific expression of SCGB2A2 protein in breast and the high expression in breast cancer through bioinformatics data, verifies that overexpression of SCGB2A2 can promote the proliferation, migration and cycle progression of breast cancer cells, verifies that knocking out the expression of SCGB2A2 can inhibit the in vitro proliferation of breast cancer cells and the in vivo tumor growth, and finally confirms that SCGB2A2 as a key target mediates the effect of lentinan on inhibiting triple-negative breast cancer.

[0055] The present application finally finds that lentinan as a drug for treating triple-negative breast cancer has clinical application value and is extremely applicable. The preparation for down-regulating the expression of SCGB2A2 has important potential and broad prospects in the development of therapeutic drugs for triple-negative breast cancer.

[0056] Those skilled in the art will easily understand that the above description is only the preferred embodiment of the present application and is not intended to limit the present application, and any modification, equivalent replacement and improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Application of lentinan in the preparation of drugs for treating triple-negative breast cancer.

2. The application as described in claim 1, characterized in that, The lentinan can downregulate the protein and / or mRNA expression levels of SCGB2A2 and inhibit the growth of triple-negative breast cancer cells.

3. The application as described in claim 1, characterized in that, The lentinan is used to inhibit the growth of triple-negative breast cancer cells MDA-MB-468, MDA-MB-436 and / or MDA-MB-231.

4. The application as described in claim 1, characterized in that, The lentinan was used to inhibit the growth of triple-negative breast cancer MDA-MB-468 cells.

5. The application as described in claim 1, characterized in that, The lentinan is used to inhibit the growth of triple-negative breast cancer MDA-MB-468 xenograft tumors.

6. The application as described in claim 1, characterized in that, The dosage of lentinan applied per kg of organism every 2 days is 5 mg.

7. The application as described in claim 1, characterized in that, The drug for treating triple-negative breast cancer is an intravenous injection preparation.

Images