Nucleic acid combination product, male sterility detection kit and detection method

Abstract

The invention belongs to the field of animal reproductive physiology, and particularly relates to a nucleic acid combination product, a male sterility detection kit and a detection method. The invention provides a nucleic acid combination product through special screening, the nucleic acid combination product comprises a detection primer group aiming at a gene Bcl2, a gene Tnp1, a gene Rsph9, a gene Nme8 and a gene Spag6, the genes are key genes jointly expressed in blood and testis of a mouse, and combination detection has relatively high specificity and conservative property among species. In addition, the nucleic acid combination product is also suitable for detecting blood, the stability of a sample is high, a subject is not influenced by time and collection environment, and the nucleic acid combination product is convenient and rapid.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of animal reproductive physiology, and particularly relates to a nucleic acid combination product, a male sterility detection kit and a detection method. BACKGROUND

[0002] The problem of human infertility is becoming increasingly serious. In recent years, the infertility rate of couples of childbearing age worldwide has risen to 8-12%, of which male factors account for about 50%. In male reproductive disorders, spermatogenic disorders are one of the most common causes. In the problems of oligospermia, asthenospermia and non-obstructive azoospermia in male infertility, genetic factors account for about 30%, which covers gene mutations and chromosomal abnormalities and many other aspects. Many genes have complex regulatory roles in spermatogenesis, which may involve multiple signaling pathways and cellular processes. Mutations in these genes can cause low sperm count, weak motility, deformity, and even male infertility. In-depth study of male reproductive performance is of great significance to the fields of reproductive medicine and biology.

[0003] In recent years, the development of molecular biology and gene detection technology has revealed the key genes and their regulatory mechanisms in the process of spermatogenesis. There are many genetic genes affecting reproductive capacity in male individuals. If the presence of these genes can be quickly and simply detected, it will play an important role in the study of male infertility and even the reproductive capacity of male animals. The application of RNA sequencing (RNA-seq) and CRISPR / Cas9 gene editing technology makes it possible to screen and verify infertility-related genes. However, the existing male infertility detection products need to be improved in terms of gene level and molecular mechanism detection.

[0004] Currently, the closest prior art for the genetic cause diagnosis of male infertility is the method based on gene diagnosis, that is, by detecting the pathogenic genes of male infertility patients, the genetic cause is determined. This technology provides an important basis for accurate diagnosis of diseases, effective treatment (such as drugs or assisted reproductive technology) and healthy offspring, and also helps to avoid birth defects. Although this method has high accuracy in detecting specific gene mutations, its promotion is low. Each individual needs to develop a separate detection scheme, which requires a long detection period and high cost, limiting its widespread application in the genetic cause diagnosis of male infertility.

[0005] In the traditional technology, the sample for the conventional detection method of male infertility is semen from patients. The collection of the sample is limited by the environment, and the determination of sperm motility depends on subjective experience, so the kit has certain limitations. SUMMARY

[0006] Based on this, one embodiment of the present application provides a nucleic acid combination product, a kit for detecting male sterility, and a detection method.

[0007] In one aspect, the present application provides a nucleic acid combination product, which comprises one or more of the following primer pairs:

[0008] targeting the Bcl2 gene: an upstream primer with the sequence shown in SEQ ID NO. 3, and a downstream primer with the sequence shown in SEQ ID NO. 4;

[0009] targeting the Nme8 gene: an upstream primer with the sequence shown in SEQ ID NO. 17, and a downstream primer with the sequence shown in SEQ ID NO. 18;

[0010] targeting the Rsph9 gene: an upstream primer with the sequence shown in SEQ ID NO. 19, and a downstream primer with the sequence shown in SEQ ID NO. 20;

[0011] targeting the Spag6 gene: an upstream primer with the sequence shown in SEQ ID NO. 21, and a downstream primer with the sequence shown in SEQ ID NO. 22; and

[0012] targeting the Tnp1 gene: an upstream primer with the sequence shown in SEQ ID NO. 27, and a downstream primer with the sequence shown in SEQ ID NO. 28.

[0013] In some embodiments, the nucleic acid combination product comprises:

[0014] targeting the Bcl2 gene: an upstream primer with the sequence shown in SEQ ID NO. 3, and a downstream primer with the sequence shown in SEQ ID NO. 4.

[0015] targeting the Rsph9 gene: an upstream primer with the sequence shown in SEQ ID NO. 19, and a downstream primer with the sequence shown in SEQ ID NO. 20.

[0016] targeting the Spag6 gene: an upstream primer with the sequence shown in SEQ ID NO. 21, and a downstream primer with the sequence shown in SEQ ID NO. 22.

[0017] In another aspect, the present application provides the use of the nucleic acid combination product described above in the preparation of a kit for detecting male sterility.

[0018] In another aspect, the present application provides a kit for detecting male sterility, which comprises a nucleic acid combination product comprising one or more of the following primer pairs:

[0019] Targeting Bcl2 gene: an upstream primer with the sequence as shown in SEQ ID NO. 3, and a downstream primer with the sequence as shown in SEQ ID NO. 4.

[0020] Targeting Nme8 gene: an upstream primer with the sequence as shown in SEQ ID NO. 17, and a downstream primer with the sequence as shown in SEQ ID NO. 18.

[0021] Targeting Rsph9 gene: an upstream primer with the sequence as shown in SEQ ID NO. 19, and a downstream primer with the sequence as shown in SEQ ID NO. 20.

[0022] Targeting Spag6 gene: an upstream primer with the sequence as shown in SEQ ID NO. 21, and a downstream primer with the sequence as shown in SEQ ID NO. 22.

[0023] Targeting Tnp1 gene: an upstream primer with the sequence as shown in SEQ ID NO. 27, and a downstream primer with the sequence as shown in SEQ ID NO. 28.

[0024] In some embodiments, the nucleic acid combination product comprises:

[0025] Targeting Bcl2 gene: an upstream primer with the sequence as shown in SEQ ID NO. 3, and a downstream primer with the sequence as shown in SEQ ID NO. 4,

[0026] Targeting Rsph9 gene: an upstream primer with the sequence as shown in SEQ ID NO. 19, and a downstream primer with the sequence as shown in SEQ ID NO. 20.

[0027] Targeting Spag6 gene: an upstream primer with the sequence as shown in SEQ ID NO. 21, and a downstream primer with the sequence as shown in SEQ ID NO. 22.

[0028] In some embodiments, the male sterility detection kit further comprises one or more of a nucleic acid release reagent, a nucleic acid extraction reagent, and a nucleic acid amplification reagent.

[0029] In some embodiments, the nucleic acid amplification reagent comprises one or more of a DNA polymerase, dNTPs, UNG enzyme, PCR buffer, and Mg 2+

[0030] Another aspect of the present application provides a method for detecting male sterility, comprising: providing a nucleic acid sample to be tested, and performing a PCR amplification reaction on the nucleic acid sample to be tested using the nucleic acid combination product or the male sterility detection kit.

[0031] ​In some embodiments, the PCR amplification reaction comprises a real-time fluorescent quantitative PCR reaction.

[0032] In some embodiments, the nucleic acid sample to be tested comprises a blood nucleic acid sample.

[0033] The present application provides a nucleic acid combination product through special screening, comprising a detection primer group for genes Bcl2, Tnp1, Rsph9, Nme8 and Spag6, which are key genes jointly expressed in mouse blood and testis, and the combined detection has high specificity and conservation between species. In addition, the nucleic acid combination product of the present application is also suitable for blood detection, and has high sample stability, and the subjects are not affected by the period and collection environment, and is convenient and fast. BRIEF DESCRIPTION OF DRAWINGS

[0034] In order to more clearly illustrate the technical solutions in the embodiments of the present application, more completely understand the present application and its beneficial effects, the drawings needed to be used in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0035] Figure 1 Screening of key genes for male reproduction; A is the KEGG enrichment result of 274 male reproduction related genes analyzed by String database; B is the GO function analysis bar chart of 16 male reproduction related genes; C is the intersection of 274 related genes and 16 related genes of the pathway; wherein, the blue part represents 274 genes related to mouse male sterility screened by String database; the green part represents 202 genes of 16 male reproduction related pathways obtained by Metascape;

[0036] Figure 2 Interaction network analysis of key genes for male reproduction; A is the interaction network diagram of 193 key genes for male reproduction; B is the interaction network diagram of core genes for male reproduction with degree≥25;

[0037] Figure 3 Primer specificity analysis of mouse testis and blood samples; A is the expression analysis of internal reference and target genes of mouse testis; B is the expression analysis of internal reference and target genes of mouse blood;

[0038] Figure 4The melting curve profile of core genes; A-N are the melting curve of Gapdh, Nme8, Atm, Tnp1, Bcl2, Stra8, Spag6, Dnai1, Spo11, Ddx4, Trp53, Rsph9, Dnah6 and Dnah1 genes, respectively;

[0039] Figure 5 The CT value distribution of mouse testis and blood combined expression genes; A-N are the CT value distribution range box plot of Gapdh, Nme8, Atm, Tnp1, Bcl2, Stra8, Spag6, Dnai1, Spo11, Ddx4, Trp53, Rsph9, Dnah6 and Dnah1 genes, respectively;

[0040] Figure 6 The expression of core genes in blood relative to mouse testis tissue;

[0041] Figure 7 Conservation analysis of mouse male reproductive core genes and primer sequences of other species; A-G are the conservation analysis of primer sequences of mouse Nme8, Atm, Bcl2, Tnp1, Stra8, Spag6 and Rsph9 and the corresponding gene CDS region sequences of other species. DETAILED DESCRIPTION

[0042] The present application will be further described below in conjunction with the embodiments and examples. It should be understood that these embodiments and examples are only used to explain the present application and not used to limit the scope of the present application, and the purpose of providing these embodiments and examples is to make the understanding of the disclosed content of the present application more thorough and comprehensive. It should also be understood that the present application can be realized in many different forms and is not limited to the embodiments and examples described herein, and those skilled in the art can make various modifications or changes without departing from the spirit of the present application, and the equivalent forms obtained thereby also fall within the protection scope of the present application. In addition, in the following description, a large number of specific details are given in order to provide a more complete understanding of the present application, and it should be understood that the present application can be implemented without one or more of these details.

[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0044] Terminology

[0045] Unless otherwise stated or contradictory, the terms or phrases used herein have the following meanings:

[0046] The selection range of the terms "and / or", "or / and", "and / or" used in the present application includes any one of two or more relevant listed items, and also includes any and all combinations of the relevant listed items, which includes any two relevant listed items, any more relevant listed items, or all relevant listed items. It should be noted that when at least two conjunctions selected from "and / or", "or / and", "and / or" are combined to connect at least three items, it should be understood that in the present application, the technical solution undoubtedly includes the technical solution connected by "logical and", and also undoubtedly includes the technical solution connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For another example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C and D (i.e. the technical solution connected by "logical or"), and also includes any and all combinations of A, B, C and D, i.e. includes the combination of any two or any three of A, B, C and D, and also includes the four-item combination of A, B, C and D (i.e. the technical solution connected by "logical and").

[0047] In the present application, "multiple", "various", "multiple times", "multiple" and the like are used without specific limitation, which means greater than or equal to 2 in quantity. For example, "one or more" means one or greater than or equal to two.

[0048] As used herein, "combinations thereof", "any combination thereof", "any combination manner thereof" and the like include all suitable combination manners of any two or more listed items.

[0049] In the present application, "suitable", "suitable", "any suitable manner" and the like are described in the context of being able to implement the technical solutions of the present application, solve the technical problems of the present application, and achieve the intended technical effects of the present application.

[0050] In the present application, "further", "more further", "particularly" and the like are used for description purposes to indicate differences in content, but should not be understood as limiting the scope of protection of the present application.

[0051] In the present application, "optionally", "optional", "optional" means optional, i.e. selected from two parallel solutions of "yes" or "no". If there are multiple "optional" in a technical solution, and there is no specific description, and no contradictory relationship or mutual restriction, each "optional" is independent.

[0052] In the present application, the technical features described in an open manner include both the closed technical solution consisting of the listed features and the open technical solution including the listed features.

[0053] In the present application, when referring to a numerical interval (i.e. a numerical range), unless otherwise specified, the optional numerical distribution within the numerical interval is considered to be continuous, and includes both numerical end points (i.e. the minimum and maximum values) of the numerical range, and every numerical value between the two numerical end points. When a numerical interval refers to only integers within the numerical interval, unless otherwise specified, the two end point integers of the numerical range, and every integer between the two end points are considered to be directly enumerated in the present application, for example, when t is an integer selected from 1 to 10, it means that t is any one integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe a feature or a characteristic, the ranges can be combined. In other words, unless otherwise specified, the ranges disclosed in the present application should be understood to include any and all sub-ranges therein.

[0054] In the present application, unless otherwise specified, the temperature parameter allows both constant temperature treatment and variation within a certain temperature interval. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuation within a range such as ±5°C, ±4°C, ±3°C, ±2°C, ±1°C is allowed.

[0055] In the present application, (w / w) and wt% both represent weight percentage, (v / v) refers to volume percentage, and (w / v) refers to mass volume percentage.

[0056] All documents mentioned in the present application are incorporated by reference in the present application as if each document was individually incorporated by reference. Unless and to the extent that the cited documents conflict with the purpose and / or technical solutions of the present application, the cited documents are incorporated by reference in their entirety. When the present application refers to the cited documents, the definitions of the relevant technical features, terms, nouns, phrases, etc. in the cited documents are also incorporated by reference. When the present application refers to the cited documents, the examples and preferred modes of the relevant technical features cited are also incorporated by reference into the present application, subject to the implementation of the present application. It should be understood that when the cited content conflicts with the description in the present application, the present application is given priority or is modified according to the description in the present application.

[0057] In one aspect, the present application provides a nucleic acid combination product, which comprises one or more pairs of primers selected from the following pairs of primers:

[0058] Targeting the Bcl2 gene: an upstream primer with the sequence as shown in SEQ ID NO. 3, and a downstream primer with the sequence as shown in SEQ ID NO. 4;

[0059] Targeting Nme8 gene: an upstream primer with sequence as shown in SEQ ID NO. 17, and a downstream primer with sequence as shown in SEQ ID NO. 18;

[0060] Targeting Rsph9 gene: an upstream primer with sequence as shown in SEQ ID NO. 19, and a downstream primer with sequence as shown in SEQ ID NO. 20;

[0061] Targeting Spag6 gene: an upstream primer with sequence as shown in SEQ ID NO. 21, and a downstream primer with sequence as shown in SEQ ID NO. 22;

[0062] Targeting Tnp1 gene: an upstream primer with sequence as shown in SEQ ID NO. 27, and a downstream primer with sequence as shown in SEQ ID NO. 28.

[0063] The specific primer sequences are shown in Table 1:

[0064] Table 1

[0065]

[0066] In some embodiments, the nucleic acid combination product comprises:

[0067] Targeting Bcl2 gene: an upstream primer with sequence as shown in SEQ ID NO. 3, and a downstream primer with sequence as shown in SEQ ID NO. 4.

[0068] Targeting Rsph9 gene: an upstream primer with sequence as shown in SEQ ID NO. 19, and a downstream primer with sequence as shown in SEQ ID NO. 20.

[0069] Targeting Spag6 gene: an upstream primer with sequence as shown in SEQ ID NO. 21, and a downstream primer with sequence as shown in SEQ ID NO. 22.

[0070] Another aspect of the present application provides use of the nucleic acid combination product in preparing a male sterility detection kit.

[0071] Another aspect of the present application provides a male sterility detection kit, which comprises a nucleic acid combination product, and the nucleic acid combination product comprises one or more of the following primer pairs:

[0072] Targeting Bcl2 gene: an upstream primer with sequence as shown in SEQ ID NO. 3, and a downstream primer with sequence as shown in SEQ ID NO. 4.

[0073] Targeting Nme8 gene: an upstream primer with sequence as shown in SEQ ID NO. 17, and a downstream primer with sequence as shown in SEQ ID NO. 18.

[0074] Targeting the Rsph9 gene: an upstream primer with the sequence as shown in SEQ ID NO. 19, and a downstream primer with the sequence as shown in SEQ ID NO. 20.

[0075] Targeting the Spag6 gene: an upstream primer with the sequence as shown in SEQ ID NO. 21, and a downstream primer with the sequence as shown in SEQ ID NO. 22.

[0076] Targeting the Tnp1 gene: an upstream primer with the sequence as shown in SEQ ID NO. 27, and a downstream primer with the sequence as shown in SEQ ID NO. 28.

[0077] In some embodiments, the nucleic acid combination product comprises:

[0078] Targeting the Bcl2 gene: an upstream primer with the sequence as shown in SEQ ID NO. 3, and a downstream primer with the sequence as shown in SEQ ID NO. 4.

[0079] Targeting the Rsph9 gene: an upstream primer with the sequence as shown in SEQ ID NO. 19, and a downstream primer with the sequence as shown in SEQ ID NO. 20.

[0080] Targeting the Spag6 gene: an upstream primer with the sequence as shown in SEQ ID NO. 21, and a downstream primer with the sequence as shown in SEQ ID NO. 22.

[0081] In some embodiments, the male sterility detection kit further comprises one or more of a nucleic acid releasing reagent, a nucleic acid extraction reagent, and a nucleic acid amplification reagent.

[0082] In some embodiments, the nucleic acid amplification reagent comprises one or more of a DNA polymerase, dNTPs, UNG enzyme, PCR buffer, and Mg 2+ In some embodiments, the nucleic acid amplification reagent comprises one or more of a DNA polymerase, dNTPs, UNG enzyme, PCR buffer, and Mg

[0083] Another aspect of the present application provides a method for detecting male sterility, comprising: providing a nucleic acid sample to be tested, and performing a PCR amplification reaction on the nucleic acid sample to be tested using the nucleic acid combination product or the male sterility detection kit.

[0084] The detection method of the present application includes disease diagnosis and non-diagnostic treatment purposes, such as the study of genetic polymorphism, and also includes various occasions for human lifestyle adjustment, psychological intervention, etc.

[0085] In some embodiments, the PCR amplification reaction comprises a real-time fluorescent quantitative PCR reaction.

[0086] In some embodiments, the nucleic acid sample to be tested comprises blood.

[0087] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0088] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0089] It should be understood that in the various embodiments of this application, the order of the above-mentioned processes does not imply the order of execution. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0090] Example 1

[0091] 1. Screening for genes related to male reproductive function

[0092] 1.1 Building a PPI network using the STRING database

[0093] We used websites such as CNKI (https: / / www.cnki.net / ) and NCBI (https: / / www.ncbi.nlm.nih.gov / ) to search for genes related to male reproduction, and imported the genes into the STRING database (https: / / cn.string-db.org / ) for protein-protein interaction network analysis, initially screening out 274 genes with high correlation.

[0094] 1.2 Gene enrichment using the Matescape database

[0095] Import the above genes into the Matescape database ( KEGG enrichment analysis and GO functional analysis were performed on the .html file. Figure 1 A and Figure 1 (B in the text) screened out 16 pathways related to male reproduction ( Figure 1 (B in the original text). Next, Venn diagram analysis was performed on 274 male reproduction-related genes screened from the String database and 202 key genes from 16 pathways in the Matescape database, thus identifying 193 common genes between the two. Figure 1 (C in the middle).

[0096] 1.3, Cytoscape software constructs a male reproductive key gene interaction network diagram

[0097] The PPI network was analyzed by visualizing Cytoscape3.10.2 software (download address: https: / / cytoscape.org / ). According to the principle of network topology analysis, the larger the reference value, the closer the node to the network center, and the greater the role in network topology. The key genes with degree≥25 were selected as the core genes of male reproduction, and then the related primers were designed for subsequent analysis (B in Figure 2 and B in Figure 2 ). According to the degree value of node connection, the key genes were screened out, and a gene interaction concentric network containing 36 nodes and 235 edges was constructed as a candidate gene for studying the joint expression of blood and testis (B in Figure 2 ).

[0098] 2, Acquisition of mouse blood and testis tissue samples

[0099] Select 6-week-old C57 experimental mice, use ether inhalation anesthesia method to anesthetize the mice, use eye ball blood collection method to collect blood into an anticoagulant tube, and record the blood collection amount. Then, fix the mouse in supine position on the operating board, cut off the lower abdominal hair, disinfect with alcohol, push the testis to the scrotum, and cut it open along the midline of the scrotum. A shallow pink, vascularized oval testis can be seen. Then, remove the adipose tissue and connective tissue of the testis and move it into a cryopreservation tube, which is stored in liquid nitrogen.

[0100] 3, Extraction of mouse blood and testis RNA and synthesis of cDNA

[0101] 3.1, Extraction of mouse blood and testis RNA

[0102] According to the operation steps of high-efficiency blood total RNA extraction kit (Tiangen, DP443), the RNA of mouse blood sample was extracted, and the obtained 35 μL mouse blood RNA solution was stored at -80℃ for standby. At the same time, according to the operation steps of animal tissue total RNA extraction kit (Tiangen, DP451), the RNA of mouse testis tissue sample was extracted, and the obtained 35 μL mouse testis RNA solution was stored at -80℃ for standby.

[0103] 3.2, Synthesis of first-strand cDNA of mouse blood and testis

[0104] Synthesize the first-strand cDNA of mouse blood and testis RNA samples on ice according to the following operations.

[0105] ① Remove the gDNA of the sample according to the following system.

[0106] Table 2 Preparation of DNA removal reaction system

[0107]

[0108] 2. Reverse transcription was performed according to the following system.

[0109] Table 3 Preparation of reverse transcription reaction solution

[0110]

[0111] In the reverse transcription reaction, Mix was added to the gDNA removal reaction solution and mixed well. Incubation was performed at 42°C for 15 min and at 95°C for 3 min, and then the sample was placed on ice. The obtained cDNA can be used for subsequent experiments or stored at -80°C.

[0112] 4. General PCR amplification of candidate genes

[0113] First, according to the gene sequence in the NCBI database, the Primer 5 software was used to design the related primers (Table 4), which were synthesized by a company and then diluted with double distilled water. Subsequently, the PCR reaction mixture was prepared according to the system of “2×Phanta SE Buffer 5 μL, 10 μM of upstream and downstream primers 0.4 μL each, template DNA 0.4 μL, Phanta SE Super-Fidelity DNA Polymerase 0.2 μL, and double distilled water 3.6 μL”. After shaking and short centrifugation, the sample was placed in a PCR amplifier, and the thermal cycle was performed according to the conditions of “98°C for 30 s, 94°C for 10 s, 56°C for 5 s, 72°C for 30 s, and 72°C for 1 min”, with three-step cycles in the middle for 35 times. After the reaction, the sample was stored at low temperature, and was ready for electrophoresis detection.

[0114] Table 4 RT-PCR detection of mouse genes (Mus musculus)

[0115]

[0116] 5. Agarose gel electrophoresis detection

[0117] When preparing the gel, 1.04 g of agarose was weighed, 80 mL of 0.5 × TBE buffer was added, and the microwave oven was heated until the agarose was completely dissolved. When the solution cooled to about 60 °C, it was poured into the gel mold, the comb was inserted, and it was left to stand for 15-20 min until the gel completely solidified. When loading, 6 μL of sample was added to each protein sample well, and 8 μL of DNA molecular weight marker (Marker 2000) was added to one well at the front and back of the gel as a reference. The prepared gel was placed in the electrophoresis tank, enough 0.5 × TBE buffer was added to cover the gel, the power supply was connected, and it was ensured that the negative electrode was close to the sample well and the positive electrode was far from the sample well. The voltage was set to 100 V, and the electrophoresis was started. The migration of the bromophenol blue dye was observed, and the electrophoresis was stopped when the dye migrated to 2 / 3 of the gel. After the electrophoresis was completed, the gel was carefully removed and placed in a UV transilluminator. The DNA bands were observed under the UV lamp and photographed, and the size of the sample DNA fragments was estimated according to the band position of the DNA molecular weight marker.

[0118] Through agarose gel electrophoresis experiments, the expression of the internal reference genes and candidate genes in mouse blood and testis was analyzed, and the specificity of the designed primers was detected. The results preliminarily believed that the seven genes Nme8, Atm, Tnp1, Bcl2, Stra8, Spag6 and Rsph9 were all expressed in mouse blood and testis.

[0119] 6. Real-time fluorescent quantitative PCR detection

[0120] First, Gapdh was used as an internal reference gene, and qPCR technology was used to detect the relative expression of each gene. Subsequently, the qPCR reaction system 10 μL was configured in the following proportions: 2 × Master SYBR Green Mix 5 μL, primer 1 (10 μM) 0.2 μL, primer 2 (10 μM) 0.2 μL, cDNA template 0.5 μL, and ddH2O 4.1 μL. After all were added, shaken and centrifuged briefly, they were placed in a real-time fluorescent quantitative PCR instrument for thermal cycling (each sample and each gene were repeated 3 times, and the test was repeated 3 times). Finally, the Ct values were obtained and exported, and Excel software was used for gene expression or sequencing result verification analysis.

[0121] The steps for analyzing the expression of each gene are as follows: First, select an internal reference gene for homogenization processing, and calculate the relative expression of each gene ΔCt (ΔCt = Ct value of gene - Ct value of internal reference). Then, using the testis tissue of the control mouse as a reference, the relative quantitative analysis method was used to compare the expression of each gene in the test group (ΔΔCt = ΔCt (test group) - ΔCt (control group), relative expression = 2 -ΔΔCt ). Finally, the quantitative results were analyzed for significance using Excel software.

[0122] The results are as follows:

[0123] To further detect the specificity of primers, we analyzed the melting curves of core genes. The results showed that Gapdh, Nme8, Atm, Tnp1, Spag6, Spo11, Rsph9, Dnah6, and Dnah1 genes showed single sharp peaks, and the primer specificity of the genes was good. Trp53 showed individual base sequence differences in different samples, but the Tm difference was not more than 2°C, and the specificity was good. Bcl2, Stra8, Dnai1, and Ddx4 showed a small peak on the left side of the main peak of the melting curve, which was extremely likely to be due to the formation of dimers by upstream and downstream primers.

[0124] Subsequently, the CT value distribution of the genes obtained by real-time fluorescence quantitative PCR was analyzed. The results showed that the CT value distribution of the core genes in the mouse testis was between 10 and 30, indicating that the data results of the qPCR experiment were available. In the mouse blood, the CT value distribution of Gapdh, Nme8, Atm, Tnp1, Rsph9, Bcl2, Spag6, Stra8, Ddx4, and Dnah1 genes was between 20 and 35, indicating that the data results of the qPCR experiment were available, but there may be large variations; the CT value of Dnai1, Spo11, Trp53, and Dnah6 was greater than 35, indicating that these genes were not expressed or expressed at low levels in the blood, which was consistent with the results of agarose gel. The results of qRT-PCR detection of core gene expression levels showed that, relative to the expression in the mouse testis, the expression of the Bcl2 gene in the blood was significantly increased, the expression of Nme8, Atm, Stra8, Spag6, Ddx4, and Rsph9 genes was significantly reduced, and the expression of Tnp1, Dnai1, Spo11, Trp53, Dnah6, and Dnah1 genes was almost not expressed. It can be seen that, at the gene level, Bcl2, Nme8, Atm, Stra8, Spag6, Ddx4, and Rsph9 are the key genes that are jointly expressed in the mouse blood and testis.

[0125] 7. Conservation analysis of mouse male reproductive core gene primer sequences and CDS regions of other species

[0126] First, using Clustal Omega in EMBL-EBI, homology analysis was performed by aligning the upstream primer sequences (and reverse complementary sequences of the downstream primers) of Nme8, Atm, Bcl2, Tnp1, Stra8, Spag6, and Rsph9 with the CDS sequences of the aforementioned chicken, pig, cattle, and sheep. Sequences matching the upstream and downstream primers were selected for further multiple sequence alignment, and the similarity was indicated by the symbols below the sequences (similarity: "*" > ":" > "." > " "). Next, the "Percent Identity Matrix" was opened to view the sequence consistency matrix, and the Clustalo format file was downloaded from "Alignment in CLUSTALformat with base / residue numbering" for subsequent conservation analysis. Finally, WebLogo3 was opened, "Create your own logos" was clicked, the Clustalo format file was imported, the required parameters were adjusted, and "Create WebLogo" was clicked. The system automatically generated conservation analyses for each gene and saved them as "PNG" format images.

[0127] turn out:

[0128] The primer sequences “CGCTACCGTCGTGACTTCG (SEQ ID NO.3) and CCACCGAACTCAAAGAAGGC (SEQ ID NO.4)” for Bcl2, “CGGGAGCTGTTCCTCTTTTAGT (SEQ ID NO.21) and TTCAGTTTCTCATCGGGGTTG (SEQ ID NO.22)” for Spag6, and “ACCTTGCTGGAGAAGTCGGA (SEQ ID NO.19) and GTGCGAGGAGCGTGGTAGAA (SEQ ID NO.20)” for Rsph9 showed high conservation among the five species.

[0129] The primer sequences “ACCAGCCGCAAGCTAAAGAC (SEQ ID NO.27) and ATCATCGCCCCGTTTCCTA (SEQ ID NO.28)” of Tnp1 are also highly conserved, but no relevant sequences are found in the species chicken.

[0130] In addition, the "CGTCAATAGTCAGAACTTGTGGG (SEQ ID NO. 17) and CAGCAACGACGAAGTGAAGAAT (SEQ ID NO. 18)" primer sequences of Nme8, the "TACATACCAAGCATACGCCAAAC (SEQ ID NO. 1) and GACTGTCACAACCACCACCATC (SEQ ID NO. 2)" primer sequences of Atm, and the "GGAGAAGGCAACCAACCCA (SEQ ID NO. 25) and TGTCCTATTCAGTACCTGCCACTT (SEQ ID NO. 26)" primer sequences of Stra8 are less conserved among the five species.

[0131] The above-described embodiments only express several implementation manners of the present application, facilitate specific and detailed understanding of the technical solutions of the present application, but cannot be understood as a limitation on the patent protection scope of the present application. It should be noted that, for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. In addition, it should be understood that, after reading the above teaching content of the present application, the technical personnel in the art can make various modifications or modifications to the present application, and the equivalent forms obtained are also within the protection scope of the present application. It should also be understood that, the technical solutions obtained by the technical personnel in the art through logical analysis, reasoning or limited experiments on the basis of the technical solutions provided by the present application are all within the protection scope of the appended claims of the present application. Therefore, the protection scope of the patent of the present application should be subject to the content of the appended claims, and the description can be used to explain the content of the claims.

Claims

1. A nucleic acid combination product, characterized by, The nucleic acid combination product comprises one or more of the following primer pairs: for the Bcl2 gene: an upstream primer having the sequence of SEQ ID NO. 3, and a downstream primer having the sequence of SEQ ID NO. 4; for the Nme8 gene: an upstream primer having the sequence of SEQ ID NO. 17, and a downstream primer having the sequence of SEQ ID NO. 18; for the Rsph9 gene: an upstream primer having the sequence of SEQ ID NO. 19, and a downstream primer having the sequence of SEQ ID NO. 20; for the Spag6 gene: an upstream primer having the sequence of SEQ ID NO. 21, and a downstream primer having the sequence of SEQ ID NO. 22; and for the Tnp1 gene: an upstream primer having the sequence of SEQ ID NO. 27, and a downstream primer having the sequence of SEQ ID NO.

28.

2. The nucleic acid combination according to claim 1, characterized in that The nucleic acid combination product comprises: for the Bcl2 gene: an upstream primer having the sequence of SEQ ID NO. 3, and a downstream primer having the sequence of SEQ ID NO. 4; for the Rsph9 gene: an upstream primer having the sequence of SEQ ID NO. 19, and a downstream primer having the sequence of SEQ ID NO. 20; and for the Spag6 gene: an upstream primer having the sequence of SEQ ID NO. 21, and a downstream primer having the sequence of SEQ ID NO.

22.

3. Use of the nucleic acid combination product according to any one of claims 1 to 2 in the preparation of a male sterility detection kit.

4. A male sterility detection kit characterized in that, The kit comprises a nucleic acid combination product comprising one or more of the following primer pairs: for the Bcl2 gene: an upstream primer having the sequence of SEQ ID NO. 3, and a downstream primer having the sequence of SEQ ID NO. 4; for the Nme8 gene: an upstream primer having the sequence of SEQ ID NO. 17, and a downstream primer having the sequence of SEQ ID NO. 18; for the Rsph9 gene: an upstream primer having the sequence of SEQ ID NO. 19, and a downstream primer having the sequence of SEQ ID NO. 20; for the Spag6 gene: an upstream primer having the sequence of SEQ ID NO. 21, and a downstream primer having the sequence of SEQ ID NO. 22; and for the Tnp1 gene: an upstream primer having the sequence of SEQ ID NO. 27, and a downstream primer having the sequence of SEQ ID NO.

28.

5. The male sterility detection kit of claim 4, wherein The nucleic acid combination product comprises: for the Bcl2 gene: an upstream primer having the sequence of SEQ ID NO. 3, and a downstream primer having the sequence of SEQ ID NO. 4, for the Rsph9 gene: an upstream primer having the sequence of SEQ ID NO. 19, and a downstream primer having the sequence of SEQ ID NO. 20; and for the Spag6 gene: an upstream primer having the sequence of SEQ ID NO. 21, and a downstream primer having the sequence of SEQ ID NO.

22. Targeting Spag6 gene: an upstream primer with the sequence as shown in SEQ ID NO. 21 and a downstream primer with the sequence as shown in SEQ ID NO.

22.

6. The male sterility detection kit according to any one of claims 4 to 5, characterized in that, The male sterility detection kit further comprises one or more of a nucleic acid releasing reagent, a nucleic acid extraction reagent and a nucleic acid amplification reagent.

7. The male sterility detection kit of claim 6, wherein The nucleic acid amplification reagents include one or more of a DNA polymerase, dNTPs, UNG enzyme, PCR buffer, and Mg 2+ .

8. A method for detecting male sterility, characterized by, Comprising: Providing a nucleic acid sample to be tested, and performing a PCR amplification reaction on the nucleic acid sample to be tested using the nucleic acid combination product of any one of claims 1 to 2 or the male sterility detection kit of any one of claims 4 to 6.

9. The method for detecting male infertility according to claim 8, characterized in that, The PCR amplification reaction comprises a real-time fluorescent quantitative PCR reaction.

10. The method of detecting male sterility according to any one of claims 8 to 9, wherein, The nucleic acid sample to be tested comprises a blood nucleic acid sample.

Images