Primer and method for rapidly detecting Letinia pekinensis

Abstract

The invention discloses primers and a method for rapidly detecting Letinia pekinensis, belongs to the technical field of microbiological detection, and particularly provides a pair of specific primers and a rapid detection and quantification method based on the primers for overcoming the defects of low detection efficiency, poor specificity and incapability of rapid quantification of Letinia pekinensis in the prior art. According to the primer and the method for rapidly detecting the Letinia pedicularis, efficient and accurate detection of the Letinia pedicularis in an environmental sample is achieved, and technical support is provided for environmental sample analysis, public health threat assessment and research on interaction of the Letinia pedicularis and other microorganisms.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of microorganism detection, and particularly relates to a primer and method for rapidly detecting Dictyostelium discoideum. BACKGROUND

[0002] Dictyostelium discoideum, also known as social amoeba, as an important model organism, has a relatively clear genetic background, and has a significant advantage in the research of cell motility, intercellular signal transduction, medical pathological and pharmacological model, various cell type specialization, and eukaryotic cell development compared to organisms with unknown genetic backgrounds. At the same time, as a soil amoeba, the interaction of Dictyostelium discoideum with the soil environment has attracted much attention. Research shows that its environmental fitness will affect the composition of soil sand and soil water content, and the interaction with environmental pollutants will change the soil texture and physical structure. In addition, Dictyostelium discoideum can also interact with bacteria and environmental pollutants, further affecting the soil physical structure. Therefore, rapid detection of Dictyostelium discoideum has important practical significance for evaluating soil environmental quality and potential pollution.

[0003] In addition to the soil environment, amoeba is widely distributed in natural and artificial environments. In recent years, research has found that amoeba is ubiquitous in tap water and is the main component of tap water protozoa, commonly found in hospitals, swimming pools, cooling towers and various water systems. Although amoeba as a water-borne pathogen is easily overlooked, the potential pathogenic bacteria it carries can pose a serious threat to human health, and water treatment facilities such as ultrafiltration membranes even become an ideal living environment for amoeba, further exacerbating the biological safety problem of drinking water.

[0004] Dictyostelium discoideum itself is non-toxic, harmless and non-pathogenic to organisms and the environment, but it can symbiotically coexist with bacteria and may carry pathogenic bacteria in the body, thereby indirectly having pathogenicity, affecting biological safety and environmental safety of soil, water sources and the like. The cell membrane and thick cell wall of amoeba can provide a physical barrier for the internal parasitic pathogenic microorganisms, improving the adaptability and resistance of pathogenic microorganisms in the environment, making amoeba an environmental carrier for the transmission of pathogenic microorganisms, helping pathogenic microorganisms to survive, spread and proliferate under harsh environmental stress. Based on this, rapid detection of Dictyostelium discoideum is not only crucial for evaluating soil environmental quality, but also helps to avoid potential health risks.

[0005] However, the current research on such protists as Dictyostelium discoideum is insufficient in depth, and there are obvious defects in the related detection technology. The existing common Dictyostelium detection technology is based on the conventional PCR amplification technology of 18S rDNA. The stable and conservative gene fragment in Dictyostelium is amplified, and the sequence result is obtained by sequencing. This method needs to collect samples containing Dictyostelium (such as soil, water or biological tissue) from the environment, and then extract DNA after isolation and purification of Dictyostelium, and then perform PCR amplification and sequencing. Although the amplified DNA fragment has universal applicability in the class of Dictyostelium, it cannot quickly screen samples to obtain specific types of Dictyostelium, and the efficiency is low when detecting specific Dictyostelium, and a large amount of repetitive work is required, which is difficult to meet the needs of rapid environmental quality assessment and biological safety. SUMMARY

[0006] The technical problem to be solved by the present application is to overcome the defects of low detection efficiency, poor specificity and inability to quickly quantify in the prior art, and to provide a pair of specific primers and a rapid detection and quantification method based on the primers, so as to realize efficient and accurate detection of Dictyostelium discoideum in environmental samples, and to provide technical support for environmental sample analysis, public health threat assessment and research on the interaction between Dictyostelium discoideum and other microorganisms.

[0007] The technical scheme adopted by the present application is as follows: a primer and method for rapidly detecting Dictyostelium discoideum, comprising a specific primer pair for detecting Dictyostelium discoideum, which is screened by taking the genome of Dictyostelium discoideum as a target gene, and comprises an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 2. The sequence of the upstream primer SEQ ID NO. 1 is 5'-GAGCCTAGTCTGAA-3', and the sequence of the downstream primer SEQ ID NO. 2 is 5'-GCCAGTAGCCGATAGGAACTTGTT-3'.

[0008] Further, the annealing temperature of the primer pair is 60±5℃, the length of the primer is 20-25 bp, and the GC content is 40-60%.

[0009] A detection and quantification method of Dictyostelium discoideum, which adopts the specific primer pair of claim 1 or 2 and is realized by combining real-time fluorescent quantitative PCR technology, comprising the following steps: S1. Extracting the genomic DNA in the sample to be tested, wherein the sample to be tested includes soil samples, water samples, Dictyostelium discoideum culture solution or suspension; S2. Using the extracted genomic DNA as a template, and performing real-time fluorescent quantitative PCR reaction by using the specific primer pair; S3. According to the CT value obtained by the real-time fluorescent quantitative PCR reaction, the copy concentration of Dictyostelium discoideum in the sample to be measured is calculated in combination with the standard curve, and then the cell concentration is converted.

[0010] Further, the genomic DNA extraction in step S1 adopts TaKaRa MiniBEST Universal Genomic DNA Extraction Kit, and the specific operation is as follows: ① Take an appropriate amount of culture solution containing Dictyostelium discoideum, centrifuge at 12000 rpm for 2 minutes, and discard the supernatant; ② Add 180 μL Buffer GB, 20 μL Proteinase K and 10 μL Rnase A to the centrifuge tube, mix well by pipetting, and then perform 56℃ water bath for 10-30 minutes; ③ Add 200 μL anhydrous ethanol and mix well by pipetting; ④ Transfer the mixed solution to the adsorption column, centrifuge at 12000 rpm for 2 minutes, and discard the filtrate; ⑤ Add 500 μL Buffer WA, centrifuge at 12000 rpm for 1 minute, and discard the filtrate; ⑥ Add 700 μL Buffer WB, centrifuge at 12000 rpm for 1 minute, and discard the filtrate, repeat this step once; ⑦ Centrifuge the empty adsorption column at 12000 rpm for 2 minutes, then place it in a new 1.5 mL centrifuge tube, add 30 μL sterile water or 65℃ preheated Elution Buffer to the center of the adsorption column, and stand at room temperature for 5 minutes; ⑧ Centrifuge at 12000 rpm for 2 minutes, elute the DNA, and store the obtained genomic DNA at 4℃ for short-term storage or at -40℃ for long-term storage.

[0011] Further, the real-time fluorescent quantitative PCR reaction system in step S2 is 20 μL, including 2×Q5 SYBRqPCR Master Mix 10 μL, 10 μM upstream primer 0.4 μL, 10 μM downstream primer 0.4 μL, DNA template 1 μL and ddH2O 8.2 μL.

[0012] Further, the real-time fluorescent quantitative PCR reaction program in step S2 is as follows: pre-denaturation at 95℃ for 30 seconds; 40 cycles, each cycle including denaturation at 95℃ for 10 seconds and annealing and extension at 60℃ for 30 seconds.

[0013] Further, the method for making the standard curve in step S3 is as follows: ① The genome of *Dendrobium discoideum* was amplified using the specific primer pair described in claim 1 to obtain the target fragment. The target fragment was then ligated into the pEASY-T&B Zero Cloning Vector plasmid vector, transformed into competent DH5α cells, recombinants were screened, and plasmids were extracted. ② Determine the plasmid concentration and dilute it to a gradient concentration of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL as standard samples; ③ Perform real-time quantitative PCR on the standard samples. Plot a standard curve with the logarithm of DNA amount on the x-axis and the corresponding CT value on the y-axis. The standard curve equation is Y = -3.444x + 48.47, R0 2 =0.997.

[0014] Further, the formula for calculating the copy concentration in step S3 is: Copy number (copies / μL) = [(X ng / μL × 10 -9 ) × (6.02 × 10 23 ] ÷ (number of bases × 660); The conversion relationship for cell concentration is: cell concentration (cells / mL) = copy concentration (copies / μL) ÷ 1.51 × 10 7 copies / μL×10 6 cells / mL.

[0015] The beneficial effects of the present invention after adopting the above structure are as follows: (1) The designed specific primer pair (SEQ ID NO.1-2) was verified by multiple strains of Dictyophora to specifically amplify only Dictyophora discoidosa and did not cross-react with other Dictyophora species, effectively solving the problem of poor detection specificity in the prior art and accurately distinguishing Dictyophora discoidosa from other closely related species. (2) Compared with the traditional conventional PCR combined with sequencing detection method, the present invention uses real-time fluorescence quantitative PCR technology, which only takes a few hours from genomic DNA extraction to obtaining quantitative results, greatly shortening the detection time and meeting the needs of rapid assessment of environmental quality and biosafety; (3) By constructing a standard curve (R) 2 =0.997, high linearity), achieving accurate quantification of *Discocephalus discoidus*, accurately determining the bacterial concentration of *Discocephalus discoidus* in environmental samples, with small error and good repeatability, providing reliable quantitative data for *Discocephalus discoidus* related research; (4) The dye-based real-time fluorescence quantitative PCR method does not require the design of specific probes, the operation steps are simple, the reagent cost is low, and the instrument requirements are not high, making it easy to promote and apply in routine laboratories. (5) Can be used for the detection and quantification of D. geosporus in soil, water and other environmental samples, not only can provide technical support for soil environmental quality assessment, but also can help drinking water biological safety monitoring and early diagnosis, dynamic monitoring and precise prevention and control of diseases related to pathogenic bacteria carried by D. geosporus, has important practical value and broad application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0016] The accompanying drawings are included to provide a further understanding of the application, and constitute a part of the specification, illustrate the application, and are used together with the embodiments to explain the application, and do not constitute a limitation on the application.

[0017] Figure 1 For primer gradient amplification gel imaging results, DIS ID NO.1-2 (A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; Figure 1 A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; Figure 1 A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; Figure 1 A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; Figure 1 A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; Figure 1 A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; Figure 1 A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; Figure 2 A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; Figure 3 A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; Figure 4 A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; Figure 5 A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; Figure 6 A), DIS ID NO.5-6 (B), DIS ID NO.9-10 (B), DIS ID NO.13-14 (B), DIS ID NO.15-16 (C), DIS ID NO.17-18 (C), DIS ID NO.19-20 (D), M: DNA marker 2000bp; DETAILED DESCRIPTION

[0018] Figure 1The results of gradient amplification preliminary screening of conventional PCR according to the primers designed based on the genome of Dictyostelium discoideum, a total of 6 groups of primer pairs are qualified, among which 8 groups of temperature gradient, the annealing temperature of conventional PCR in lane 1-8 of A-D is 55.0 ℃, 55.5 ℃, 56.2 ℃, 57.0 ℃, 58.1 ℃, 59.1 ℃, 59.7 ℃, 60.0 ℃.

[0019] Figure 2 The results of specific conventional PCR amplification of the preliminary screening primers, DIS ID NO.1-2, DIS ID NO.13-14, DIS ID NO.17-18 are the preferred specific primer pairs.

[0020] Lane A-B 1-6 respectively: water, Dictyostelium discoideum, Dictyostelium griseum, Dictyostelium macrosporum, Dictyostelium aureum, Dictyostelium purpureum.

[0021] Figure 3 The results of target fragment amplification, standard plasmid construction and sequence alignment, the length of the target fragment and the plasmid standard is correct, the sequencing results are compared with the sequence, the length is correct, and the plasmid construction is successful.

[0022] Figure 4 The amplification curve and standard curve of the plasmid standard of Dictyostelium discoideum, R 2 =0.997, the linear fitting degree is good.

[0023] Figure 5 Amplification curve and dissolution curve of Dictyostelium discoideum samples with different concentrations.

[0024] Figure 6 Amplification results of random samples of Dictyostelium discoideum, random samples can be amplified and get corresponding CT value.

[0025] I. Design and screening of Dictyostelium discoideum specific primers 1. Sample preparation The strains used are Dictyostelium strains preserved by the Ministry of Education Engineering Research Center of Jilin Agricultural University.

[0026] Table 1 Test strains 2. Extraction of genomic DNA of the strains to be tested All 5 Dictyostelium strains samples were extracted using the universal DNA extraction kit TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0: (1) Take 5 ml of bacterial culture solution, centrifuge at 12000 rpm for 2 minutes, discard the supernatant; (2) Add Buffer GB 180 μL, Proteinase K 20 μL and RNase A 10 μL into the tube, mix well, and incubate at 56 °C for 10 minutes; (3) Add 200 μL of anhydrous ethanol into the tube, mix well; (4) Transfer the above liquid into an adsorption column, centrifuge at 12000 rpm for 2 minutes, and then discard the filtrate; (5) Add Buffer WA 500 μL, centrifuge at 12000 rpm for 1 minute, and discard the filtrate; (6) Add 700 μL of Buffer WB into the tube, centrifuge at 12000 rpm for 1 minute, and discard the filtrate; (7) Repeat step (6); (8) Centrifuge the empty adsorption column at 12000 rpm for 2 minutes, and then place it in a new 1.5 mL centrifuge tube, add 30 μL of sterile water into the center of the tube, and stand at room temperature for 5 minutes; (9) Centrifuge again at 12000 rpm for 2 minutes to elute the DNA; (10) Detect the concentration of the genomic DNA by using a spectrophotometer, and store it in a 4 °C refrigerator (if not used on the same day, store it in a -40 °C refrigerator).

[0027] 3. Design the genomic internet primers of Dictyostelium discoideum by using primer 6 software, while following the principles of primer design, the annealing temperature is 60 ± 5 °C, the length of the primer is 20-25 bp, and the GC content is 40-60%. According to the above conditions, a total of 12 pairs of primers are designed (Table 2).

[0028] Table 2. Primer sequence table 4. Take the genomic DNA of Dictyostelium discoideum as a template, and perform gradient amplification by using conventional PCR to preliminarily screen qualified primer pairs, which are DIS ID NO. 1-2 (A), DIS ID NO. 5-6 (B), DIS ID NO. 9-10 (B), DIS ID NO. 13-14 (C), DIS ID NO. 15-16 (C), DIS ID NO. 17-18 (D), respectively. The conventional PCR reaction system is shown in Table 3. Figure 1 A), DIS ID NO. 5-6 (B), DIS ID NO. 9-10 (B), DIS ID NO. 13-14 (C), DIS ID NO. 15-16 (C), DIS ID NO. 17-18 (D), respectively. The conventional PCR reaction system is shown in Table 3. Figure 1 A), DIS ID NO. 5-6 (B), DIS ID NO. 9-10 (B), DIS ID NO. 13-14 (C), DIS ID NO. 15-16 (C), DIS ID NO. 17-18 (D), respectively. The conventional PCR reaction system is shown in Table 3. Figure 1 A), DIS ID NO. 5-6 (B), DIS ID NO. 9-10 (B), DIS ID NO. 13-14 (C), DIS ID NO. 15-16 (C), DIS ID NO. 17-18 (D), respectively. The conventional PCR reaction system is shown in Table 3. Figure 1 A), DIS ID NO. 5-6 (B), DIS ID NO. 9-10 (B), DIS ID NO. 13-14 (C), DIS ID NO. 15-16 (C), DIS ID NO. 17-18 (D), respectively. The conventional PCR reaction system is shown in Table 3. Figure 1 A), DIS ID NO. 5-6 (B), DIS ID NO. 9-10 (B), DIS ID NO. 13-14 (C), DIS ID NO. 15-16 (C), DIS ID NO. 17-18 (D), respectively. The conventional PCR reaction system is shown in Table 3. Figure 1 A), DIS ID NO. 5-6 (B), DIS ID NO. 9-10 (B), DIS ID NO. 13-14 (C), DIS ID NO. 15-16 (C), DIS ID NO. 17-18 (D), respectively. The conventional PCR reaction system is shown in Table 3.

[0029] Table 3. Conventional PCR reaction system Ingredients Amount 2x Magic Green Taq SuperMix 12.5 μL Upstream primer 1 μL Downstream primer 1 μL DNA template 1 μL ddH2O 9.5 μL PCR reaction program as follows: pre-denaturation: 95 ℃, 3 min; 35 cycles: denaturation: 95 ℃, 30 sec; annealing: 55-60 ℃, 30 sec; extension: 72 ℃, 1 min; final extension: 72 ℃, 5 min.

[0030] 5. According to the gel imaging results of amplification (Fig. 1 Figure 1 ), the specific primer pairs obtained by conventional PCR were used as templates for specific amplification by conventional PCR, and DIS ID NO. 5-6, DIS ID NO. 9-10 could also amplify D. confragum and D. maximus except D. discoides; DIS ID NO. 15-16 could also amplify D. confragum, D. maximus, D. aureus and D. violaceum, and finally the better primer sequences were DIS ID NO. 1-2, DIS ID NO. 13-14 and DIS ID NO. 17-18, which had the strongest specificity (Fig. 2 Figure 2 ).

[0031] II. Detection and quantification of D. discoides 1. Obtaining the target fragment: PCR amplification of D. discoides genome using specific primers DIS ID NO. 1-2, and obtaining the target fragment (Fig. 1 Figure 3 A).

[0032] 2. Connect the target gene to the plasmid vector: use pEASY-T&B Zero Cloning Kit to connect the target fragment to pEASY-T&B Zero Cloning Vector plasmid vector, and the cloning reaction system is shown in Table 4: Table 4 Cloning reaction system Ingredients Amount PCR target fragment 0.5 μL -T&B Zero Cloning Vector 1 μL The connection ratio of pEASY-T&B Zero Cloning Vector vector and target fragment is 1:7, and after mixing, it is placed in a pcr instrument at 25 ℃ for 10 min, and after the end, the centrifuge tube is placed on ice.

[0033] 3. Transformation and screening of recombinants: (1) Take the competent DH5a from the -80℃ freezer and insert it into the ice box quickly to allow it to thaw slowly; (2) After adding the ligation product, mix gently, and then stand on ice for 30 min; (3) Place the centrifuge tube in a 42℃ water bath for 45 sec, then quickly move it back to ice and maintain for 2 min, taking care not to shake; (4) Add 700 μL of LB medium without antibiotics, mix gently, and incubate at 37°C, 180 rpm for 1 h; (5) Spread the transformed bacteria evenly on LB plates containing antibiotics, and incubate at 37°C until the liquid is completely absorbed. Then, invert the plates and incubate overnight. (6) Pick single colonies for expansion and further use of plasmid universal detection primers.

[0034] (Forward primer: GAGCCTAGTCTGAA; Reverse primer: GCCAGTAGCCGATAGGAACTTGTT), and perform regular PCR Figure 3 B) Preliminary verification, the results showed that (C) after testing Figure 3 C) The full-length sequence is 141 bp, with no base mismatches, and the standard plasmid.

[0035] 4. Use the operation steps of BBI EZ-10 Spin Column Plasmid Mini-Preps Kit from Shengwo Biotechnology Co., Ltd. to extract the plasmid: (1) Collect the bacteria: Take 5 mL of bacterial solution and add it to a centrifuge tube. Centrifuge at 12000 rpm for 1 min to collect the bacterial precipitate, and then discard the supernatant. (2) Lysis of bacteria: Add 200 μL of Buffer S1 (with RNase A) to the bacterial precipitate, shake well to mix, and lyse the cells and remove RNA. (3) Add lysis solution: Add 200 μL of Buffer S2 to the centrifuge tube, and gently invert the tube 10 times to fully lyse the cells. (4) Neutralize the lysis solution: Add the specified amount of neutralization buffer Buffer S3, and gently invert the tube 10 times to mix thoroughly. (5) Centrifugal separation: Centrifuge at 12000 rpm for 10 min to precipitate the impurities, and the supernatant contains plasmid DNA. (6) Absorption and washing: Carefully transfer the supernatant to the absorption column, add 500 μL of 75% ethanol to the absorption column, centrifuge at 8000 rpm for 1 min, then discard the filtrate, and repeat the washing step once to remove impurities. (7) Dry the absorption column: Place the absorption column in a new centrifuge tube and let it stand at room temperature for 10 min to completely evaporate the alcohol residue, which will not affect the subsequent plasmid dissolution. (8) Elute the plasmid: Add an appropriate amount of ddH2O to the center of the absorption membrane, and let it stand at room temperature for 5 min, then centrifuge at an appropriate speed for 2 min to collect the plasmid solution in the centrifuge tube.

[0036] 5. Constructing a standard curve: High-concentration plasmids were extracted to obtain concentrations of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL as standard test samples. A quantitative real-time PCR reaction was performed to obtain a standard curve. The amplification curve should be S-shaped. Figure 4 A), three replicates were performed, showing good repeatability. Based on the linear relationship between the logarithm of DNA quantity (x) and the corresponding CT value (y), Y = -3.444x + 48.47, R 2 =0.997 ( Figure 4 B).

[0037] 6. Preparation of the sample to be tested One bottle of *Dendrobium distichum* cells in liquid suspension was randomly selected and counted using a hemocytometer. The bacterial concentration was 4.25 × 10⁶ cells / mL. Subsequently, cell suspensions with volumes of 200 μL and concentrations of 4.25 × 10⁶ cells / mL, 3.23 × 10⁶ cells / mL, 2.15 × 10⁶ cells / mL, and 1.08 × 10⁶ cells / mL were prepared using the mother liquor. Genomic DNA was then extracted.

[0038] 7. Extract genomic DNA from the test strain DNA extraction was performed using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit. (1) Cell lysis: Take an appropriate amount of bacterial culture medium, add 180 μL Buffer GB, 20 μL Proteinase K and 10 μL RNase A to a centrifuge tube, mix well and incubate at 56 ℃ for 30 min; (2) Add 200 μL of anhydrous ethanol to it and mix thoroughly by suction and whisking; (3) Transfer the above mixture to an adsorption column, centrifuge at 12000 rpm for 2 min, and discard the filtrate; (4) Add 500 μL of Buffer WA to it, centrifuge at 12000 rpm for 1 min, and then discard the filtrate; (5) Add 700 μL of Buffer WB to it, centrifuge at 12000 rpm for 1 min, and then discard the filtrate; (6) Repeat step (5); (7) Centrifuge the empty adsorption column at 12000 rpm for 2 min to remove residual liquid, then place it on a new 1.5 mL centrifuge tube, add 30 μL of preheated Elution Buffer at 65 ℃ to the center of the adsorption column, and let it stand at room temperature for 5 min. (8) 12000 rpm centrifugation for 2 min, collect the eluted genomic DNA, and store the obtained genome in a -40 °C refrigerator for standby.

[0039] Then the real-time fluorescent quantitative PCR reaction system is prepared.

[0040] 8. Fluorescent quantitative PCR reaction The primer concentration of the fluorescent quantitative PCR reaction system is 10 μM, the annealing temperature of the cycle reaction is 60 °C, and the reaction system is shown in Table 5 below: Table 5 Fluorescent quantitative PCR reaction system Ingredients Amount 2x Q5 SYBR qPCR Master Mix 10 μL Upstream primer (10 μM) 0.4 μL Downstream primer (10 μM) 0.4 μL DNA template 1 μL ddH2O 8.2 μL The reaction program is as follows: pre-deformation: 95 °C, 30 sec; 40 cycles: 95 °C, 10 sec, 60 °C, 30 sec, and the obtained different concentration amplification results and melting curve (Fig. 2) are shown in the following table: Figure 5 ).

[0041] 9. The CT value obtained can be calculated according to the standard curve formula, and the CT value is corresponding to the copy concentration, so as to realize the quantification of the standard sample strain. -9 )×(6.02×10 23 )] ÷ (base number × 660).

[0042] The cell concentration of the sample to be tested is converted into copy concentration, and the results are shown in Table 6 below.

[0043] Table 6 Cell concentration and copy concentration The corresponding relationship of the results is calculated and averaged to be 1×10 6 cells / mL, and the average copy concentration corresponding to the cell concentration is 1.51×10 7 copies / μL.

[0044] III. Detection of random samples of Dictyostelium discoideum The genomic DNA of the random sample is extracted according to the specific embodiment (extraction of the genomic DNA of the strain to be tested), three repeats for each sample, and then fluorescent quantitative PCR (qPCR) is carried out. Figure 6 According to the formula, the copy concentration (copies / μL) / average copy concentration ≈ cell concentration (cells / mL), the CT value of the obtained sample is calculated to obtain the copy concentration, and the cell concentration in the random sample is further obtained, and the corresponding results are shown in the following table: Table 7 Cell concentration and copy concentration Sample Average CT value Copy concentration (copies / μL) Bacterial concentration (x 106 cells / mL) Actual count concentration (x 106 cells / mL) Sample 1 21.52 6.81 x 10 7 ]]> 4.51 4.3 Sample 2 22.09 4.65 x 10 7 ]] 3.08 3.23 Sample 3 22.20 4.33 x 10 7 ]] 2.87 2.15 Sample 4 23.90 1.38 x 10 7 ]] 0.92 1.08 Although the embodiments of the present application have been shown and described, it is to be understood that various modifications, substitutions, replacements and changes can be made to these embodiments without departing from the principles and spirit of the present application, and the scope of the present application is defined by the appended claims and their equivalents. In general, if a person skilled in the art is inspired by the present application, without departing from the purpose of the present application, similar structural modes and embodiments are not creative designs, and should belong to the protection scope of the present application.

Claims

1. A specific primer pair for detecting *Discotyledone spp.*, wherein the primer pair is obtained by screening for target genes in the *Discotyledone spp.* genome, characterized in that: It includes an upstream primer and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO.1 and the nucleotide sequence of which is shown in SEQ ID NO.2; the sequence of the upstream primer SEQ ID NO.1 is 5'-GAGCCTAGTCTGAA-3' and the sequence of the downstream primer SEQ ID NO.2 is 5'-GCCAGTAGCCGATAGGAACTTGTT-3'.

2. The specific primer pair for detecting *Dendrobium discoideum* according to claim 1, characterized in that: The primer pair has an annealing temperature of 60±5℃, a primer length of 20-25bp, and a GC content of 40-60%.

3. A method for detecting and quantifying *Dendrobium discoideum*, using the specific primer pair described in claim 1 or 2, combined with real-time quantitative PCR technology, characterized in that: Includes the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Using the extracted genomic DNA as a template, perform a real-time quantitative PCR reaction using the specific primer pair; S3. Based on the CT value obtained from the real-time quantitative PCR reaction, the copy concentration of *Dendrobium discoideum* in the sample to be tested is calculated in conjunction with the standard curve, and then the bacterial concentration is obtained.

4. The method for detecting and quantifying *Dendrobium discoideum* according to claim 3, characterized in that: The extraction of genomic DNA in step S1 was performed using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit, and the specific procedures are as follows: ① Take an appropriate amount of culture medium containing *Dendrobium discoideum*, centrifuge at 12,000 rpm for 2 minutes, and discard the supernatant; ② Add 180 μL Buffer GB, 20 μL Proteinase K and 10 μL RNase A to the centrifuge tube, mix well by pipetting, and incubate at 56°C for 10-30 minutes. ③ Add 200 μL of anhydrous ethanol and mix thoroughly by suction and whisking; ④ Transfer the mixture to the adsorption column, centrifuge at 12000 rpm for 2 minutes, and discard the filtrate; ⑤ Add 500 μL of Buffer WA, centrifuge at 12000 rpm for 1 minute, and discard the filtrate; ⑥ Add 700 μL Buffer WB, centrifuge at 12000 rpm for 1 minute, discard the filtrate, and repeat this step once; ⑦ Centrifuge the empty adsorption column at 12000 rpm for 2 minutes, then place it on a new 1.5 mL centrifuge tube, add 30 μL of sterile water or preheated Elution Buffer at 65 °C to the center of the adsorption column, and let it stand at room temperature for 5 minutes. ⑧ Centrifuge at 12000 rpm for 2 minutes to elute the DNA. Store the obtained genomic DNA at 4℃ for a short period or at -40℃ for a long period.

5. The method for detecting and quantifying *Dendrobium discoideum* according to claim 3, characterized in that: The real-time quantitative PCR reaction system in step S2, in 20 μL, includes 10 μL of 2×Q5 SYBR qPCR Master Mix, 0.4 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, 1 μL of DNA template, and 8.2 μL of ddH2O.

6. The method for detecting and quantifying *Dendrobium discoideum* according to claim 3, characterized in that: The real-time quantitative PCR reaction program in step S2 is as follows: pre-denaturation at 95°C for 30 seconds; 40 cycles, each cycle including denaturation at 95°C for 10 seconds and annealing extension at 60°C for 30 seconds.

7. The method for detecting and quantifying *Discocephalus discoidus* according to claim 3, characterized in that: The method for creating the standard curve in step S3 is as follows: ① The genome of *Dendrobium discoideum* was amplified using the specific primer pair described in claim 1 to obtain the target fragment. The target fragment was then ligated into the pEASY-T&B Zero Cloning Vector plasmid vector, transformed into competent DH5α cells, recombinants were screened, and plasmids were extracted. ② Determine the plasmid concentration and dilute it to a gradient concentration of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL as standard samples; ③ Perform real-time quantitative PCR on the standard samples. Plot a standard curve with the logarithm of DNA amount on the x-axis and the corresponding CT value on the y-axis. The standard curve equation is Y = -3.444x + 48.47, R0 2 =0.

997.

8. The method for detecting and quantifying *Discocephalus discoidus* according to claim 3, characterized in that: The formula for calculating the copy concentration in step S3 is: Copy number (copies / μL) = [(X ng / μL × 10 -9 ) × (6.02 × 10 23 ] ÷ (number of bases × 660); The conversion relationship for cell concentration is: cell concentration (cells / mL) = copy concentration (copies / μL) ÷ 1.51 × 10 7 copies / μL×10 6 cells / mL.

9. The method for detecting and quantifying *Dendrobium discoideum* according to claim 3, characterized in that: The samples to be tested include soil samples and culture media or suspensions of *Diplostomum truncatum* in water samples.

Images