Molecular marker of qsgc.a8-3 significantly associated with brassica napus seed glucosinolate content and application thereof
A significant association site qSGC.A8-3 on the A08 chromosome of rapeseed was discovered through genome-wide association analysis, and a simple and low-cost PARMS marker was developed, which solved the problem of the difficulty in improving glucosinolate content in rapeseed seeds and achieved efficient and accurate breeding screening.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
- Filing Date
- 2025-08-20
- Publication Date
- 2026-06-05
AI Technical Summary
Existing technologies are insufficient to effectively improve glucosinolate content in rapeseed seeds. Traditional breeding methods are difficult to achieve precise improvement, and existing molecular marker technologies are cumbersome and costly, making it difficult to meet the needs of efficient screening of glucosinolate content in rapeseed germplasm resources.
Genome-wide association analysis revealed a significant association site qSGC.A8-3 at bases 10,557,348 on the rapeseed A08 chromosome. A simple and low-cost PARMS marker was developed and used for screening and breeding of rapeseed seeds for glucosinolate content.
This method enables efficient screening of glucosinolate content in rapeseed seeds, improving selection efficiency and accuracy. It can explain an average of 7.5% of phenotypic variance, is low in cost, and is suitable for genetic improvement of glucosinolate content in rapeseed seeds.
Smart Images

Figure BDA0005557880180000041 
Figure BDA0005557880180000051 
Figure BDA0005557880180000061
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology and genetic breeding technology, specifically relating to a molecular marker qSGC.A8-3, a site significantly associated with glucosinolate content in rapeseed seeds, and its application. Background Technology
[0002] Currently, the main goals of rapeseed breeding include resistance, yield, and quality. These traits are complex quantitative traits, regulated by numerous genes and easily influenced by environmental conditions. Traditional breeding methods and techniques struggle to achieve precise improvement of these traits. However, the rapid advancement of molecular marker technology and the widespread application of emerging biotechnologies such as gene editing have made molecular modification of these traits possible.
[0003] The quality traits of rapeseed mainly include the oil content, erucic acid, and glucosinolate (thioglucosinolate) content of rapeseed seeds. Glucosinolates are a class of sulfur-containing secondary metabolites, with a core structure consisting of a β-thioglucosyl group, a sulfonyl oxime group, and a side chain R group derived from different amino acids. Glucosinolates are mainly found in cruciferous plants, such as rapeseed, broccoli, and cauliflower. Glucosinolates have various positive effects in human cancer prevention, plant disease and pest control, and imparting special flavors to vegetables (Xie Zhaoqi, 2023). However, glucosinolates in rapeseed meal are toxic to livestock, so the glucosinolate content in rapeseed grains determines the value of rapeseed meal as animal feed.
[0004] Using linkage and / or association mapping methods, a number of QTLs controlling glucosinolate content in rapeseed seeds have been identified (Chao et al., 2022; Zhang et al., 2024), mostly distributed on chromosomes A9, C2, C7, and C9, primarily corresponding to genes such as GTR2 and MYB28 (Zhang et al., 2024). However, these QTLs are insufficient to explain the variation in glucosinolate content in rapeseed germplasm resources, indicating that new glucosinolate content regulatory sites still need to be discovered.
[0005] This invention utilizes high-density SNP genotype data from a core associated population of rapeseed and seed glucosinolate content phenotypic data from eight environments to conduct genome-wide association analysis, aiming to find new and stable association sites and develop practical, high-throughput, low-cost molecular markers for molecular improvement of glucosinolate content in rapeseed seeds. Summary of the Invention
[0006] The purpose of this invention is to provide a reagent for detecting the 10,557,348th base on chromosome A08 of Brassica napus and its application in the screening and breeding of glucosinolate content in Brassica napus seeds.
[0007] Another objective of this invention is to provide the application of primers for detecting bases at positions 10,557,348 on chromosome A08 of Brassica napus in the screening and breeding of glucosinolate content in Brassica napus seeds.
[0008] The final objective of this invention is to provide a method for screening and breeding rapeseed seeds for glucosinolate content.
[0009] To achieve the above objectives, the present invention adopts the following technical measures:
[0010] The glucosinolate content in rapeseed seeds was significantly associated with the acquisition of PARMS markers:
[0011] (1) Total DNA was extracted from 331 materials of the core associated population of Brassica napus (Li et al., 2020) constructed by our team, and genotyping was performed on each sample using the Brassica napus 60K SNP chip (Clarke et al., 2016).
[0012] (2) The heterozygous rate, missing rate, and minor allele frequency of the population materials at each locus were calculated using Illumina BeadStudio genotyping software (http: / / www.illumina.com / ). Markers with no polymorphism, high deletion rate, no homozygous genotype, low allele frequency, high heterozygous genotype frequency, uncertain location, and multiple copy markers were removed, resulting in 24,508 high-quality SNP markers for subsequent analysis.
[0013] (3) The 331 materials of the core association population of Brassica napus constructed by our team were planted in eight environments (Nanchang 2014, Wuhan 2012-2016, Zhengzhou 2013-2014) (codes N14, W12, W13, W14, W15, W16, Z13, Z14). At maturity, 10 plants were harvested from each plot, dried and threshed, and the glucosinolate content was determined by near-infrared spectroscopy (Qiu et al., 2006).
[0014] (4) Based on the SNP genotypes, seed glucosinolate content phenotypes, population structure, and phylogenetic data of the core associated population, association analysis was performed using TASSEL 5.0 software (Bradbury et al., 2007). Finally, the locus qSGC.A8-3, significantly associated with multiple glucosinolates, was obtained on chromosome A08 of the rapeseed DarmorV4 reference genome. Its peak SNP marker, Bn-A08-p12638473, is located at bases 10, 557, and 348 (bases A or G), and can be repeatedly detected in four environments.
[0015] (5) Extract 100bp sequences upstream and downstream of the 10th, 557th, and 348th bases on the A08 chromosome of rapeseed, and obtain PARMS detection primer sequences according to primer design principles: qSGC.A8-3Fa: gaaggtgaccaagttcatgctGTTGTTGTAGTTTATCTTGATCAACAA, qSGC.A8-3Fg: gaaggtcggagtcaacggattGTTGTTGTAGTTTATCTTGATC AACAG, and qSGC.A8-3R: GCCTCCTTTCTGGATCAACC.
[0016] The scope of protection of this invention includes:
[0017] Application of reagents for detecting bases at positions 10, 557, 348 on chromosome A08 of Brassica napus in screening and breeding of glucosinolate content in Brassica napus seeds.
[0018] Application of reagents for detecting bases at positions 10, 557, and 348 on chromosome A08 of Brassica napus in the preparation of a screening kit for glucosinolate content in Brassica napus seeds.
[0019] If the base at position 10,557,348 on chromosome A08 of Brassica napus is detected as A, it indicates that the seeds of this variety have a high glucosinolate content.
[0020] If the base at position 10,557,348 on chromosome A08 of the above-mentioned application is detected to be G, it indicates that the glucosinolate content in the seeds of this variety is low.
[0021] The reagents described above are preferably primers.
[0022] The primers described above are preferably PARMS detection primers.
[0023] The primers described above are more preferably the primers provided by the present invention: qSGC.A8-3Fa: gaaggtgaccaagttcatgct GTTGTTGTAGTTTATCTTGATCAACAA, qSGC.A8-3Fg: gaaggtcggagtcaacggattGTTGTTGT AGTTTATCTTGATCAACAG, and qSGC.A8-3R: GCCTCCTTTCTGGATCAACC.
[0024] A method for screening and breeding rapeseed seeds for glucosinolate content includes detecting the 10,557,348th base on chromosome A08 of rapeseed using conventional methods in the art. These conventional methods include, but are not limited to: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry.
[0025] The method described above is preferably PCR detection, using the following primers: qSGC.A8-3Fa: gaaggtgaccaagttcatgctGTTGTTGTAGTTTATCTTGATCAACAA, qSGC.A8-3Fg: gaaggtcggagtcaacggattGTTGTTGTAGTTTATCTTGATCAACAG, and qSGC.A8-3R: GCCTCCTTTCTGGATCAACC.
[0026] The version number of the Brassica napus genome used in this invention is B. napus Darmor-bzh referencegenome sequence assembly (version 4.1) (Chalhoub et al., 2014).
[0027] Compared with the prior art, the present invention has the following advantages:
[0028] (1) The present invention obtained the site qSGC.A8-3, which is significantly associated with the glucosinolate content of rapeseed seeds and can be repeatedly detected. It can explain an average of 7.5% of the phenotypic variance and has an average additive effect of 9.6 μmol / g. It can be effectively applied to the genetic improvement of glucosinolate content in rapeseed seeds.
[0029] (2) The present invention obtains PARMS markers that are significantly associated with the glucosinolate content in rapeseed seeds. The detection method is simple and low cost, and can perform high-throughput screening of the genomic haplotype region of glucosinolates in rapeseed, thereby improving selection efficiency and accuracy. Detailed Implementation
[0030] Unless otherwise specified, the technical solutions described in this invention are all conventional techniques in the field; the reagents or materials described, unless otherwise specified, are all from commercial sources. The version number of the Brassica napus genome used in this invention is B. napusDa rmor-bzh reference genome sequence assembly (version 4.1) (Chalhoub et al., 2014). Most of the materials tested in the embodiments of this application are high-generation inbred lines; unless otherwise specified, there is no data on heterozygous genotypes. Example 1: Obtaining SNP markers that significantly correlate with glucosinolate content in rapeseed seeds.
[0031] (1) 1063 rapeseed inbred lines from various countries around the world were collected (Li et al., 2015), and 331 materials were selected from them to construct a core associated population (Li et al., 2020) based on their genotype and phenotypic data. Single leaves of each line in the associated population were collected, and total DNA was extracted using the CTAB method. Genotyping of each sample was performed using a rapeseed 60K SNP chip (Clarke et al., 2016).
[0032] (2) The heterozygosity rate, missing rate, and minor allele frequency of the population materials at each locus were calculated using Illumina BeadStudio genotyping software (http: / / www.illumina.com / ). Phylogenetic relationships among 331 Brassica napus accessions were calculated using SPAGeDi software (Hardy and Vekemans, 2002). SNP markers were filtered based on criteria including a missing rate ≤0.2, a heterozygosity rate ≤0.2, a minor allele frequency >0.05, and a unique match of the SNP marker in the Brassica napus genome. A total of 24,508 high-quality SNP markers were obtained for genome-wide association analysis.
[0033] (3) 331 strains of the core related population were planted in eight environments (Nanchang 2014, Wuhan 2012-2016, Zhengzhou 2013-2014) (codes: N14, W12, W13, W14, W15, W16, Z13, Z14). At maturity, 10 representative single plants from each plot were harvested, dried, threshed, and their glucosinolate content was determined by near-infrared spectroscopy (Qiu et al., 2006).
[0034] (4) Genome-wide association analysis was performed using TASSEL 5.0 software, combining genotypic data from the associated populations and phenotypic data of glucosinolates. By integrating significant association SNP markers detected in different environments and models, the significantly associated and reproducible locus qSGC.A8-3 was obtained on chromosome A08, which could be repeatedly detected in four environments. Its peak SNP marker Bn-A08-p12638473 was located at bases 10,557,348 (A or G) of the Darmor V4.1 reference genome, with an average additive effect of 9.6 μmol / g and an average contribution rate of 7.5%.
[0035] Table 1. Information on the qSGC.A8-3 site associated with glucosinolate content in rapeseed seeds.
[0036] Example 2:
[0037] A method for developing and using PARMS markers that are significantly correlated with rapeseed glucosinolate content:
[0038] The association markers obtained in Example 1 were derived from SNP chips and only contained probe sequence information for molecular hybridization. While rapeseed SNP chips can detect tens of thousands of sites at a time, their operation is cumbersome and requires specialized equipment. Furthermore, using rapeseed SNP chips to detect large quantities of intermediate breeding materials is expensive. Therefore, it is necessary to convert them into a simpler and cheaper PCR amplification-based detection method, such as PARMS (Penta-primer Amplification Refractory Mutation System). This marker system includes a pair of universal fluorescent primers (FAM and HEX as reporter fluorescence), a pair of SNP allele-specific primers, and a reverse common primer, enabling rapid and simple SNP allele detection.
[0039] (1) For the peak SNP marker Bn-A08-p12638473 associated with qSGC.A8-3, 100 bp sequences were extracted upstream and downstream of chromosome A08 at positions 10, 557, and 348 of the rapeseed DarmorV4.1 reference genome. The PARMS marker detection primer sequences were obtained according to primer design principles as follows:
[0040] qSGC.A8-3Fa: gaaggtgaccaagttcatgctGTTGTTGTAGTTTATCTTGATCAACAA; qSGC.A8-3Fg: gaaggtcggagtcaacggattGTTGTTGTAGTTTATCTTGATCAACAG; qSGC.A8-3R: GCCTCCTTTCTGGATCAACC.
[0041] The lowercase letters in the primers are fluorescent linkers.
[0042] (2) Using the genomic DNA of the rapeseed-related population as a template, the above primers were used to perform real-time PCR amplification. The FAM and HEX signals were scanned using a Tecan F200 and the results were output. Finally, the results were converted into genotypes.
[0043] Using the primers described above, the sequence amplified in the rapeseed variety Shuang 11 is as follows: GTTGTTGTAGTTTATCTTG ATCAACAG AAAACCACTTCTTCATCGAATGATA GGTTGATCCAGAAAGGAGGC .
[0044] Using the primers described above, the sequence amplified in the rapeseed variety Darmor is as follows: GTTGTTGTAGTTTATCTTGA T CAACAA AAAACCACTTCTTCATCGAATGATA GGTTGATCCAGAAAGGAGGC .
[0045] The determination method is:
[0046] If the AA genotype is detected, it indicates that the variety has a high glucosinolate content in its seeds; if the GG genotype is detected, it indicates that the variety has a low glucosinolate content in its seeds.
[0047] Example 3: Application of PARMS labeling in the selection of rapeseed glucosinolates
[0048] From 732 materials in non-core related populations (i.e., 1063 rapeseed inbred lines in Example 1 excluding 331 core related populations), 96 materials were randomly selected (for convenient PCR amplification). Using the PARMS marker qSG C.A8-3 provided in Example 2, 14 materials were identified as having the AA genotype, 81 materials as having the GG genotype, and the rest were heterozygous and not shown here. The seed glucosinolate content of the two genotype materials showed extremely significant differences in 8 environments, with an average difference of 54.04 μmol / g.
[0049] The following glucosinolates were detected by near-infrared spectroscopy, and the content unit is μmol / g (Qiu et al., 2006).
[0050] Table 2. Comparison of glucosinolate content in seeds of Brassica napus between two PARMS marker qSGC.A8-3 genotypes.
[0051]
[0052]
[0053] The above results are sufficient to demonstrate that the PARMS molecular marker qSGC.A8-3 we prepared is highly correlated with the glucosinolate content of rapeseed seeds and has a good selection effect.
Claims
1. The application of reagents for detecting bases at positions 10,557,348 on chromosome A08 of Brassica napus in screening breeding for glucosinolate content in Brassica napus seeds. The determination method in the application process is as follows: if the AA genotype is detected at positions 10,557,348 on chromosome A08 of Brassica napus, it indicates that the glucosinolate content in the Brassica napus seeds is high; if the GG genotype is detected at positions 10,557,348 on chromosome A08 of Brassica napus, it indicates that the glucosinolate content in the Brassica napus seeds is low. The version number of the Brassica napus genome used is B. napus Darmor-bzh reference genome sequenceassembly version 4.
1.
2. The application of reagents for detecting bases at positions 10, 557, 348 on chromosome A08 of Brassica napus in the preparation of a screening kit for glucosinolate content in Brassica napus seeds. The determination method in the application process is as follows: if the AA genotype is detected at positions 10, 557, 348 on chromosome A08 of Brassica napus, it indicates that the glucosinolate content in the Brassica napus seeds is high; if the GG genotype is detected at positions 10, 557, 348 on chromosome A08 of Brassica napus, it indicates that the glucosinolate content in the Brassica napus seeds is low. The version number of the Brassica napus genome used is B. napus Darmor-bzh reference genomesequence assembly version 4.
1.
3. The application according to claim 1 or 2, wherein the reagent is a primer.
4. The application according to claim 3, wherein the primer is a PARMS detection primer.
5. In the application according to claim 4, the pair of SNP allele-specific primers and one reverse common primer in the PARMS detection primers are: qSGC.A8-3Fa: gaaggtgaccaagttcatgctGTTGTTGTAGTTTATCTTGATCAACAA, qSGC.A8-3Fg: gaaggtcggagtcaacggattGTTGTTGTAGTTTATCTTGATCAACAG, and qSGC.A8-3R: GCCTCCTTTCTGGATCAACC.
6. A method for screening and breeding rapeseed seeds for glucosinolate content, comprising detecting bases at positions 10,557,348 on chromosome A08 of rapeseed. The detection method includes sequencing, TaqMan probe assay, AS-PCR, molecular beacon assay, high-resolution melting curve assay, CAPS assay, SNaPshot assay, KASP assay, PARMS assay, gene chip assay, or mass spectrometry. The determination method is as follows: if the AA genotype is detected at position 10,557,348 on chromosome A08 of rapeseed, it indicates that the rapeseed seed has a high glucosinolate content; if the GG genotype is detected at position 10,557,348 on chromosome A08 of rapeseed, it indicates that the rapeseed seed has a low glucosinolate content. The rapeseed genome version used is B. napus Darmor-bzh reference genome sequence assembly version 4.
1.
7. The method according to claim 6, wherein the detection method is the PARMS method, and the pair of SNP allele-specific primers and one reverse common primer used are: qSGC.A8-3Fa: gaaggtgaccaagttcatgctGTTGTTGTAGTTTATCTTGATCAACAA, qSGC.A8-3Fg: gaaggtcggagtcaacggattGTTGTTGTAGTTTATCTTGATCAACAG, and qSGC.A8-3R: GCCTCCTTTCTGGATCAACC.
Citation Information
Patent Citations
Brassica napus seed thioglycoside content main effect QTL locus and SNP molecular markers thereof, and applications of SNP molecular markers
CN110527739A
SNP marker based on glucosinolate content regulator in Brassica rapa and uses thereof
KR1020170080523A