Dry electrochemical luminescence lateral flow chip and application thereof in CRISPR-Cas (clustered regularly interspaced short palindromic repeats-associated proteins) detection
By designing a dry ECL lateral flow chip and combining it with the CRISPR-Cas reaction system to dry on the test strip, the problems of operational complexity and high cost of CRISPR-Cas detection are solved, realizing high-throughput, multiplex detection and portable detection, suitable for on-site testing in homes and remote areas.
Patent Information
- Application Number
- CN202511027072.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-24
- Publication Date
- 2025-11-21
AI Technical Summary
Existing CRISPR-Cas detection technologies require specialized operation, expensive equipment, and are difficult to promote and apply. Furthermore, CRISPR-Cas reactions have strict requirements for storage conditions, while traditional ECL microfluidic chips are complex to operate, costly, and difficult to achieve high throughput and multiplex detection.
A dry ECL lateral flow chip is designed, including a lateral flow test strip and an electrode sheet. The electrode is constructed using an integrated closed bipolar electrode and conductive carbon ink, and is dried on the test strip using a CRISPR-Cas reaction system. This simplifies the operation process and enables high throughput and multiplex detection through ECL detection.
It improves the stability and repeatability of CRISPR-Cas detection, simplifies operation, reduces costs, is suitable for portable testing, and is suitable for on-site, point-of-care testing in homes and remote areas, thus improving the accuracy and flexibility of testing.
Smart Images

Figure CN120992926A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microfluidic lateral flow chips, specifically relating to a dry electrochemiluminescence (ECL) lateral flow chip and its application in CRISPR-Cas detection. Background Technology
[0002] Bipolar electrodes (BPEs) have been widely used in sensing fields such as electrochemistry and electrochemiluminescence, and have become an emerging research hotspot.
[0003] BPE is a special type of electrical conductor that acts as both an anode and a cathode. It can be divided into open BPE (O-BPE) and closed BPE (C-BPE).
[0004] In C-BPE, the anode and cathode are located in different reaction cells and connected to two driving electrodes via different reaction solutions. Under an appropriate driving voltage, redox reactions occur simultaneously on the C-BPE anode and cathode, with electrons transferring from the anode to the cathode. This characteristic allows the ECL reaction to proceed efficiently on the C-BPE surface, significantly improving detection sensitivity and specificity. Furthermore, it features simple operation, low background signal, and no use of radioactive isotopes, making it suitable for high-throughput analysis and a proven effective method for detecting various biomarkers. In particular, the CBP-ECL lateral flow chip, combining C-BPE and ECL, has shown promising application prospects in the rapid detection of nucleic acids and proteins.
[0005] With the continuous development of bioscience and technology, novel virus diagnostic technologies have emerged, with CRISPR-based diagnostics becoming a new hot topic. CRISPR technology exhibits high specificity and signal amplification effects in virus detection, and its combination with ECL microfluidic chips for nucleic acid detection has gradually attracted attention. However, these studies require placing the CRISPR-Cas reaction in test tubes or on microfluidic chips, demanding high levels of operator skill and a suitable testing environment. Furthermore, the storage conditions for Cas proteins are extremely stringent, requiring "freshly prepared and used" solutions. In addition, traditional ECL microfluidic chips still require professional operation, have high manufacturing costs, and their associated detection instruments are very expensive. These factors hinder the widespread application of CRISPR-based nucleic acid detection technologies. Summary of the Invention
[0006] The purpose of this invention is to provide a dry ECL sideflow chip and its application in CRISPR-Cas detection.
[0007] The objective of this invention is achieved through the following technical solution:
[0008] A dry ECL lateral flow chip includes a lateral flow test strip and an electrode sheet;
[0009] The lateral flow test strip includes one or more test strips, one electrical conductivity test strip, and at least one quality control test strip;
[0010] To achieve high-throughput detection, the number of test strips is preferably two or more;
[0011] The test strip, quality control test strip, and electrical conductivity test strip have the same structure, consisting of an activation sheet, a binding sheet, a detection sheet, an absorption sheet, and a shared sample sheet; one end of each test strip is connected to the sample sheet, forming a radial branch centered on the sample sheet.
[0012] The electrode sheet includes an integrated closed-type bipolar electrode and a driving electrode;
[0013] The integrated closed bipolar electrode includes several electrodes; the integrated closed bipolar electrode is the same in shape as the lateral flow test strip, and one end of the electrodes is connected and branches out radially around the center of the bipolar electrode; the number of electrodes is the same as the sum of the number of the test strip, the quality control test strip, and the electrical conductivity test strip.
[0014] The electrode includes at least one control anode, one shared cathode, and the others are detection anodes;
[0015] The distances from the electrodes to their corresponding driving electrodes are equal;
[0016] The electrode anodes are arranged in parallel, and the parallel connection of several detection anodes can greatly improve the detection throughput.
[0017] The lateral flow test strip is placed upside down on the electrode sheet; wherein, the sample sheet coincides with the center of the bipolar electrode, the detection lateral flow test strip corresponds to the detection anode, the quality control lateral flow test strip corresponds to the quality control anode, and the electrical connection lateral flow test strip corresponds to the shared cathode.
[0018] The sample sheet, activation sheet, and binding sheet are made of glass fiber, the detection sheet is made of NC membrane, and the absorption sheet is made of absorbent paper.
[0019] The electrode sheet is constructed from conductive carbon ink via screen printing onto a hydrophobic PET plate.
[0020] The lateral flow test strip is pasted onto a transparent adhesive plate and then inverted onto the electrode sheet;
[0021] The transparent adhesive plate consists of two parts, a long one and a short one. Parts of the lateral flow test strip, including the binding sheet, the detection sheet, and the absorption sheet, are sequentially stacked on the long part of the transparent adhesive plate, with a 2mm overlap at each stacking point. The short part, which has a circular sample dispensing port, is used to fix the sample sheet, the activation sheet, and another part of the binding sheet. Therefore, the shorter part is connected to the longer part through the binding sheet.
[0022] Double-sided adhesive is applied to the integrated closed bipolar electrode to better fix part of the bonding sheet and part of the detection sheet.
[0023] The chip also includes a casing;
[0024] The casing includes an upper cover and a lower cover; the upper cover has at least three observation windows and two electrode contact areas, and the lower surface of the upper cover has several protrusions for fixing the lateral flow test strip; the lower cover has a fixing area for positioning the electrode sheet, and a handle is provided on the side of the lower cover for pushing the dry ECL lateral flow chip into and out of the detection device.
[0025] The chip described can be used for detection in the CRISPR-Cas system;
[0026] The chip described above uses test strips whose activation sheets are pretreated with bovine serum albumin (BSA) and then dried to fix different CRISPR-Cas reaction systems (such as LbCas12a Nuclease, crRNA, 10×HOLMES Buffer 1, sucrose, and trehalose for the CRISPR-Cas12a reaction system).
[0027] The concentration of BSA is 8–16 mg / mL;
[0028] The test strip is bound to a CRISPR-Cas system trans-cleaved single-stranded DNA (tc-ssDNA) through a dry-modified binding plate; the tc-ssDNA is linked to a ruthenium tripyridine (Ru(II)) modified anti-FAM antibody (mouse monoclonal antibody);
[0029] The quality control test strip is modified by drying the conjugate strip with an antibody (rabbit monoclonal antibody) linked only to Ru(II);
[0030] The test strip contains a T-line capture antibody (goat anti-mouse antibody) to capture an anti-FAM antibody linked to a DNA sequence cleaved by the CRISPR-Cas system.
[0031] The test strip of the quality control strip is coated with a C-line capture antibody (goat anti-rabbit antibody) to capture antibodies that are linked only to Ru(II).
[0032] The chip is used for testing in the CRISPR-Cas system, and includes the following steps:
[0033] (1) Design and preparation of primers, crRNA and tc-ssDNA
[0034] For the biomarker to be tested, a highly specific fragment is selected as the target sequence;
[0035] Design crRNA sequences targeting specific sequences;
[0036] The tc-ssDNA sequence is a T-rich sequence with biotin modified at the 5' end and FAM group modified at the 3' end;
[0037] (2) Preparation of signal antibodies and signal probes
[0038] The T-line signal antibody and C-line signal antibody preparation methods adopt existing technology methods (such as Chinese patent ZL202310708705.8). After the T-line signal antibody is prepared, it is reacted with tc-ssDNA to prepare the corresponding T-line signal probe.
[0039] (3) Sensing interface preparation
[0040] After the T-line signal probe and streptavidin were premixed and reacted for several tens of minutes, they were sprayed onto the surface of the test strip conjugate; the C-line signal antibody was sprayed onto the surface of the quality control test strip conjugate.
[0041] The T-line capture antibody was applied to the test strip to prepare the T-line, and the C-line capture antibody was applied to the control test strip to prepare the C-line.
[0042] The lateral flow test strip and electrode sheet are assembled in sequence to form a dry ECL lateral flow chip;
[0043] (4) Detection process
[0044] First, the sample solution that may contain the PCR product of the biomarker to be tested is dropped onto the sample slide. The solution flows to the activation slide to start the CRISPR-Cas reaction. The CRISPR-Cas system is then flushed to the binding slide for trans-cleavage. After waiting a few minutes at room temperature, the CRISPR reaction reaches the plateau phase.
[0045] Next, buffer solution is added to the sample slide to flush the CRISPR trans-cleavage product from the binding slide onto the downstream detection slide for antigen-antibody reaction over a few minutes.
[0046] Next, add buffer solution to wash away any remaining residue;
[0047] Finally, the chip is placed in the ECL detector, a driving voltage is applied to trigger the ECL reaction, the ECL luminescence video is acquired by the CMOS camera in the detector, and the video is automatically analyzed by a mobile application to calculate the ECL luminescence intensity on the T line and C line, and further calculate their ratio (T / C) to determine whether the sample contains the PCR product of the target biomarker and the concentration of the target biomarker PCR product.
[0048] The biomarkers to be tested are influenza A virus, influenza B virus, Escherichia coli, Staphylococcus aureus, etc.
[0049] The sample solution was added in a volume of 75–85 μL.
[0050] The CRISPR-Cas reaction time is 5–8 minutes;
[0051] The driving voltage ranges from 15 to 27V;
[0052] The buffer solution is PBS, Tris-HCl buffer, etc.
[0053] The present invention has the following advantages and effects compared with the prior art:
[0054] (1) This invention dries the CRISPR-Cas system on the test strip activation sheet, reduces the degradation of enzymes and other active ingredients, enhances the long-term storage stability of the CRISPR-Cas system, and enables the invented chip to be used under various environmental conditions. At the same time, by precisely controlling the drying conditions and using a suitable freeze-drying protectant formulation, the consistency and repeatability of the CRISPR-Cas system on the chip are greatly improved.
[0055] (2) This invention freeze-dries the CRISPR-Cas system onto test strips, enabling accurate multiplex detection of pathogens. This method simplifies the operation process, greatly shortens the detection time, reduces operational errors, improves the accuracy of results, reduces mutual interference between multiplex detections, and avoids false positive results.
[0056] (3) The chip of the present invention can be set with one quality control lateral flow test strip and one electrical connection lateral flow test strip. The number of detection lateral flow test strips can be flexibly adjusted according to the needs. The crRNA-Cas in the CRISPR-Cas system can be flexibly adjusted according to the biomarker to be tested, which makes it convenient to perform multiple detection of other pathogens.
[0057] (4) In view of the advantages of high specificity of CRISPR-Cas and high sensitivity of ECL technology, the present invention can effectively amplify the ECL signal and realize accurate detection of pathogens.
[0058] (5) The present invention uses a portable ECL detector to collect signals and automatically analyzes data through a mobile application. The operation process is simple and has the potential to be used for on-site real-time detection in different scenarios (including home self-testing, detection applications in remote areas, etc.).
[0059] (6) The chip of the present invention uses materials such as NC film, glass fiber, and PET, which are relatively inexpensive and easy to obtain, greatly reducing the chip manufacturing cost. Attached Figure Description
[0060] Figure 1 , Figure 2 This is a schematic diagram of the chip structure of the present invention; wherein:
[0061] 1: Electrode sheet; 2: Lateral flow test strip; 3: Transparent adhesive plate; 4: Clamping device;
[0062] 1-1: Integrated closed bipolar electrode; 1-2: Driving electrode; 1-1-1: Bipolar electrode center; 1-1-2, 1-1-4: Detection anode; 1-1-3: Quality control anode; 1-1-5: Shared cathode; 1-3: Double-sided adhesive.
[0063] 2-1: Electrical conductivity test strip; 2-2, 2-4: Inspection test strips; 2-3: Quality control test strip;
[0064] 2-1-1, 2-2-1, 2-3-1, 2-4-1: Activation tablets; 2-1-2, 2-2-2, 2-3-2, 2-4-2: Binding tablets; 2-1-3, 2-2-3, 2-3-3, 2-4-3: Detection tablets; 2-1-4, 2-2-4, 2-3-4, 2-4-4: Absorption tablets; 2-5: Sample tablets;
[0065] 3-1: Short section; 3-2, 3-3, 3-4, 3-5: Long sections; 3-1-1: Circular sample inlet;
[0066] 4-1: Top cover, 4-1-1: Sample loading window, 4-1-2, 4-1-3, 4-1-4: Observation window, 4-2: Bottom cover, 4-2-1: Bottom cover fixing area, 4-2-2: Handle, 4-2-3, 4-2-4: Electrode contact area.
[0067] Figure 3 This is a schematic diagram illustrating the principle of the chip detection method of the present invention.
[0068] Figure 4 This is a graph showing the relationship between fluorescence signal value and BSA concentration.
[0069] Figure 5 This is a graph showing the relationship between T / C and driving voltage.
[0070] Figure 6The graph shows the optimal amount of sample added.
[0071] Figure 7 This is a graph showing the relationship between T / C and the reaction time of CRISPR-Cas12a.
[0072] Figure 8 This is a graph showing the relationship between T / C and the type of sample solution.
[0073] Figure 9 The analysis curves for detecting PCR products from different concentrations of influenza A virus cultures are shown (the inset is a linear fit curve). Detailed Implementation
[0074] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0075] Example 1
[0076] A dry ECL lateral flow chip, the composition and structure of which are as follows: Figure 1 , 2 As shown, it includes a lateral flow test strip 2 and an electrode sheet 1;
[0077] The lateral flow test strip 2 includes two test strips 2-2 and 2-4, one quality control test strip 2-3, and one electrical conductivity test strip 2-1;
[0078] The four test strips have the same structure, consisting of, in order, activation strips (2-1-1, 2-2-1, 2-3-1 and 2-4-1), conjugation strips (2-1-2, 2-2-2, 2-3-2 and 2-4-2), detection strips (2-1-3, 2-2-3, 2-3-3 and 2-4-3), absorption strips (2-1-4, 2-2-4, 2-3-4 and 2-4-4), and a shared sample strip 2-5. Thus, one end of each of the four test strips is connected at sample strip 2-5, forming four radial branches centered on sample strip 2-5.
[0079] The activation pieces 2-2-1 and 2-4-1 of the test strips 2-2 and 2-4 were pretreated with bovine serum albumin (BSA) and then dried to fix different CRISPR-Cas12a systems; the activation pieces 2-1-1 and 2-3-1 of the other test strips 2-1 and 2-3 were not treated in any way.
[0080] The test strips 2-2 and 2-4 are modified by drying the conjugate pieces 2-2-2 and 2-4-2 of the CRISPR-Cas system to trans-cut single-stranded DNA (tc-ssDNA); the tc-ssDNA is linked to a ruthenium tripyridine (Ru(II)) modified anti-FAM antibody (mouse monoclonal antibody);
[0081] The quality control test strip 2-3 has a dry-modified binding piece 2-3-2 with an antibody (rabbit monoclonal antibody) linked only to Ru(II);
[0082] The test strips 2-2-3 and 2-4-3 of the test strips 2-2 and 2-4 are coated with T-line capture antibody (goat anti-mouse antibody) to capture anti-FAM antibody linked to a DNA sequence after being cut by the CRISPR-Cas12 system;
[0083] The detection strip 2-3-3 of the quality control test strip 2-3 is coated with C-line capture antibody (goat anti-rabbit antibody) to capture antibodies that are linked only to Ru(II);
[0084] The bonding piece 2-1-2 and the detection piece 2-1-3 of the electrical connection test strip 2-1 are not treated in any way.
[0085] The electrode sheet 1 is constructed on a hydrophobic PET board by screen printing of conductive carbon ink;
[0086] The electrode sheet 1 includes an integrated closed-type bipolar electrode 1-1 and a driving electrode 1-2;
[0087] The integrated closed bipolar electrode 1-1 includes four electrodes; the integrated closed bipolar electrode 1-1 is the same in shape as the lateral flow test strip 2, and the four electrodes are connected and branch out radially around the bipolar electrode center 1-1-1.
[0088] The four electrodes include two detection anodes 1-1-2 and 1-1-4, one quality control anode 1-1-3, and one shared cathode 1-1-5;
[0089] The bipolar electrode anodes 1-1-2, 1-1-3, and 1-1-4 are arranged in parallel. The parallel arrangement of two detection anodes 1-1-2 and 1-1-4 can greatly improve the detection throughput. The two detection anodes 1-1-2 and 1-1-4 are symmetrically distributed around the center 1-1-1 to ensure that the states of test strips 2-2 and 2-4 are consistent. The quality control anode 1-1-3 and the shared cathode 1-1-5 are also symmetrically distributed around the center 1-1-1.
[0090] The distances from the four electrodes to the corresponding driving electrodes 1-2 are equal.
[0091] The lateral flow test strip 2 is inverted on the electrode sheet 1; wherein, the sample sheet 2-5 coincides with the center 1-1-1 of the bipolar electrode, the test strips 2-2 and 2-4 correspond to the detection anodes 1-1-2 and 1-1-4, the quality control test strip 2-3 corresponds to the quality control anode 1-1-3, and the electrical connection test strip 2-1 corresponds to the shared cathode 1-1-5;
[0092] The T-lines of detection pieces 2-2-3 and 2-4-3 and the C-line of detection piece 2-3-3 correspond to the top of the anode of the bipolar electrode (i.e., the end furthest from the center 1-1-1 of the bipolar electrode). The front side of the NC film of the detection piece faces down and the backing side faces up.
[0093] Thus, when the driving electrode is energized, the ECL reaction can be triggered.
[0094] The lateral flow test strip 2 is pasted on the transparent adhesive plate 3 and then upside down onto the electrode sheet 1;
[0095] The transparent adhesive plate 3 consists of two parts. The binding sheet, detection sheet and absorption sheet of four test strips 2-1, 2-2, 2-3 and 2-4 are stacked sequentially on the long part 3-2, 3-3, 3-4 and 3-5 of the transparent adhesive plate 3, with a 2mm overlap at each layer. The short part 3-1 with a circular sample dispensing port 3-1-1 is used to fix the sample sheet, activation sheet and another binding sheet. Therefore, the shorter part is connected to the longer part through the binding sheet.
[0096] Double-sided adhesive tape 1-3 is provided on each of the bipolar electrode detection anodes 1-1-2, 1-1-4, quality control anode 1-1-3 and shared cathode 1-1-5 to better fix part of the bonding sheet and part of the detection sheet.
[0097] The chip also includes a casing 4;
[0098] Electrode 1 is attached to the lower cover 4-2 of the housing, and positioned using the fixing area 4-2-1 of the lower cover. After the CRISPR-Cas reaction on test strips 2-2 and 2-4 is complete, the upper cover 4-1 is closed. The lower surface of the upper cover 4-1 has several protrusions for fixing test strips 2-1, 2-2, 2-3, and 2-4. A handle 4-2-2 is located on the side of the lower cover 4-2 for pushing the chip in and out of the detection device.
[0099] Example 2
[0100] The dry ECL lateral flow chip in Example 1 is applied to the CRISPR-Cas system for detection, and its detection principle is as follows: Figure 3 As shown;
[0101] On test strips 2-2 and 2-4 ( Figure 3(Left side) The PCR product activates the CRISPR-Cas12a reaction, non-specifically cleaving the tc-ssDNA of the T-line signal probe on downstream binding pieces 2-2-2 and 2-4-2. The cleaved product flows downstream and binds to the T-line capture antibody on detection pieces 2-2-3 and 2-4-3 through the anti-FAM antibody, so that Ru(II) is captured on the T-line. After the reaction is complete, PBS is added to sample piece 2-5 to wash away the non-specifically bound signal antibody and unreacted substances.
[0102] On quality control test strips 2-3 ( Figure 3 (Right side) The PCR product solution carries the signal antibody on the binding strip 2-3-2 downstream, and binds to the capture antibody on the detection strip 2-3-3 through the antigen-antibody reaction, so that Ru(II) is captured on the C line. After the reaction is complete, PBS is added to the sample strip 2-5 to wash away the non-specifically bound signal antibody and unreacted substances.
[0103] Taking the detection of influenza A and B nucleic acid based on the dry CRISPR-Cas12a system as an example, the detection steps are as follows:
[0104] (1) Design and prepare A and B flow PCR primers, crRNA and tc-ssDNA
[0105] Highly specific sequences from the genomes of influenza A and B viruses were downloaded from the National Center for Biotechnology Information (NCBI). The total gene sequence was imported into the Benchling webpage, and crRNAs for influenza A and B were designed. Primers were designed for each virus using Primer Premier 6. The tc-ssDNA sequence was a T-rich sequence with biotin modified at the 5' end and a FAM group modified at the 3' end.
[0106] The sequence is as follows (5'-3'):
[0107] Upstream primer for influenza A: grccgatcctstcacctctgac
[0108] Downstream primers for influenza A: ggrgcattttggacaaagcgtctacg
[0109] Upstream primer for influenza B: tcctcaactcactcttcgagcg
[0110] Downstream primer for influenza B: cggtgctcttgaccaaattgg
[0111] Influenza A crRNA:
[0112] uaauuucuacuaaguguagauggauuuguguucacgcucac
[0113] Beta-2 crRNA:
[0114] uaauuucuacuaaguguagauaagcugcucgaauuggcuuug
[0115] tc-ssDNA: Biotin-ttttttttttt-6-FAM
[0116] (2) Preparation of Activation Tablets
[0117] Add 1 μL LbCas12a Nuclease (5 μM), 0.5 μL crRNA (10 μM), and 1 μL 10×HOLMES Buffer 1 to a test tube in sequence, vortex to mix, incubate at room temperature for 5 min, then add 10 μL of sucrose and trehalose mixture (final concentration 50 mg / mL), and then add DEPC water to make a 20 μL reaction system, vortex to mix, take 15 μL of CRISPR-Cas12a mixture and drop it onto activation tablets 2-2-1 and 2-4-1, place activation tablets 2-2-1 and 2-4-1 into an RNase-free box, freeze rapidly with liquid nitrogen, and then dry in a vacuum freeze dryer for 6 h.
[0118] (3) Preparation of signal antibodies and signal probes
[0119] The method for preparing the T-line signal antibody and C-line signal antibody is the same as the disclosed method (Chinese Patent ZL202310708705.8). The difference is that after the T-line signal antibody is prepared, it is reacted with tc-ssDNA for 2 hours (at room temperature) to prepare the corresponding T-line signal probe.
[0120] (4) Sensing interface preparation
[0121] The aforementioned T-line signal probe and 0.5 mg / mL streptavidin were premixed at a volume ratio of 5:1 and reacted for 30 min. Then, the mixture was sprayed onto the surfaces of test strips 2-2, 2-4, and 2-4-2 using a gold spraying membrane applicator. The C-line signal antibody was sprayed onto the surface of control test strip 2-3, 2-3-2 using a gold spraying membrane applicator. The mixture was then baked at 37°C for 1.5 h (gold spraying conditions: speed 50 mm / s, 6 μL / cm, repeated twice).
[0122] T-line capture antibody and C-line capture antibody were applied to test strips 2-2, 2-4, test pieces 2-2-3, 2-4-3 and control test strip 2-3, respectively, to prepare T-lines and C-lines. After application, test pieces 2-2-3, 2-3-3 and 2-4-3 were placed in a 37℃ oven for 2 hours (application conditions: speed 50 mm / s, 4 μL / cm, repeated application twice).
[0123] The lateral flow test strip 2, transparent adhesive plate 3, electrode sheet 1, and casing 4 are assembled in sequence to form a dry ECL lateral flow chip.
[0124] (5) Testing process
[0125] First, 1×10 5 PCR amplification was performed using DNA plasmids of copies / mL A and B: In a PCR tube, add 5 μL of DNA plasmid solution, 5 μL of Taq buffer (10×), 4 μL of dNTPs (2.5 mM), 0.24 μL of Taq enzyme, and 1 μL each of forward and reverse primers (10 μM). Mix well and place in a PCR instrument for amplification. Amplification parameters were set to 95℃ for 2 min of heat denaturation, followed by 20 thermal cycles (95℃, 15 s; 60℃, 30 s). After cycling, the temperature was lowered to 4℃ and maintained for a period of time. The resulting amplification products were stored at -20℃ for future use.
[0126] Next, open the top cover 4-1 of the cartridge and drop 80 μL of the A and B flow PCR product solution onto sample slide 2-5. The solution flows to activation slides 2-2-1 and 2-4-1 to start the CRISPR-Cas reaction, and then flush the CRISPR-Cas system to binding slides 2-2-2 and 2-4-2 for trans-cutting. Wait 7 minutes at room temperature until the CRISPR reaction reaches the plateau phase.
[0127] Then, cover the card holder with the top cover 4-1, add 30 μL of PBS to the sample slide 2-5, so that the products after CRISPR trans-cleavage on the binding slides 2-2-2 and 2-4-2 can be flushed onto the downstream detection slides 2-2-3 and 2-4-3 for antigen-antibody reaction for 3 min, and then add 30 μL of PBS to wash away the excess residue.
[0128] Finally, the dry ECL lateral flow chip was placed into the self-built ECL detector, and a 24V driving voltage was applied to trigger the ECL reaction. The ECL emission video was acquired by the CMOS camera in the detector, and the video was automatically analyzed by a mobile application to calculate the ECL emission intensity on the T line and C line, and further calculate their ratio (T / C).
[0129] Example 3
[0130] The key factors affecting T / C in Example 2 (activation chip pretreatment, sample volume, driving voltage, and on-chip CRISPR reaction time) were optimized:
[0131] (1) Optimization of activation piece preprocessing
[0132] 1. The concentration of the PCR product to be tested for influenza A was fixed, the BSA concentration ([BSA]) was 4-16 mg / mL, the driving voltage was 24V, the CRISPR-Cas12a reaction time was 5 min, the ECL signal antibody mixture was 6 μL, the T-line and C-line capture antibody concentration was 0.25 mg / mL, the immune reaction time was 3 min, and the sample volume was 80 μL.
[0133] 2. Set up experimental groups: Set up different [BSA] gradients (4 mg / mL, 8 mg / mL, 12 mg / mL, 16 mg / mL) to treat the activation tablets respectively, and then freeze-dry the CRISPR-Cas12a system onto the treated activation tablets.
[0134] 3. The testing process for the dry ECL lateral flow chip is the same as in Example 2, and the test results are as follows: Figure 4 As shown.
[0135] As shown in the figure, when the [BSA] concentration is below 12 mg / mL, the CRISPR-Cas12a reactivity increases with increasing concentration. However, when the concentration is above 12 mg / mL, the CRISPR-Cas12a reactivity decreases. This may be because higher [BSA] concentrations result in a large number of BSA molecules competing with Cas12a for binding sites or surfaces, causing steric hindrance and thus limiting the effective contact between Cas12a protein and crRNA, affecting its biological activity. When the [BSA] concentration is 12 mg / mL, the CRISPR-Cas12a reaction retains 79% of its activity on the activation tablet. Therefore, 12 mg / mL BSA is preferred as the pretreatment concentration for the activation tablet, and an acceptable BSA concentration is 8–16 mg / mL.
[0136] (2) Drive voltage optimization
[0137] 1. The concentration of the PCR product to be tested for influenza A was fixed, [BSA] was 12 mg / mL, the driving voltage was 12-27 V, the CRISPR-Cas12a reaction time was 5 min, the ECL signal antibody mixed solution was 6 μL, the concentration of T-line and C-line capture antibodies was 0.25 mg / mL, the immune reaction time was 3 min, and the sample volume was 80 μL.
[0138] 2. Set up experimental groups: Set different driving voltages (12V, 15V, 18V, 21V, 24V and 27V) to conduct optimization experiments.
[0139] 3. The testing process for the dry ECL lateral flow chip is the same as in Example 2, and the test results are as follows: Figure 5 As shown.
[0140] As shown in the figure, when the driving voltage increases from 12V to 24V, the T / C ratio rises accordingly; when the driving voltage exceeds 24V, the T / C ratio decreases slightly, and the detection error becomes larger. This phenomenon may be due to the fact that at lower driving voltages, the actual voltage distributed to each BPE in the parallel structure is insufficient, preventing the electron transfer process from occurring effectively and thus failing to fully excite the ECL reaction. At higher driving voltages, the water redox reaction may interfere with the normal ECL reaction, weakening the ECL signal intensity. Furthermore, excessively high driving voltages may cause localized temperature increases, further affecting the chemical equilibrium in the solution, leading to unstable detection results. Therefore, 24V is selected as the optimal driving voltage, and the acceptable driving voltage range is 15–27V.
[0141] (3) Optimization of sample loading
[0142] 1. The concentration of the PCR product to be tested for influenza A was fixed, [BSA] was 12 mg / mL, the driving voltage was 24 V, the CRISPR-Cas12a reaction time was 5 min, the ECL signal antibody mixture was 6 μL, the concentration of T-line and C-line capture antibodies was 0.25 mg / mL, the immune reaction time was 3 min, and the sample volume was 20-90 μL.
[0143] 2. Set up experimental groups: Set up different sample volumes (20, 40, 60, 80 and 90 μL) for optimization experiments.
[0144] 3. The testing process for the dry ECL lateral flow chip is the same as in Example 2, and the test results are as follows: Figure 6 As shown.
[0145] As shown in the figure, when the sample volume is less than 60 μL, the solution cannot flow onto the conjugate patch; when the sample volume is 90 μL, the solution overflows from the conjugate patch and flows into the detection area; when the sample volume is 80 μL, the solution just wets and fills the conjugate patch. Therefore, 80 μL is the optimal sample volume, and the acceptable sample volume is 75–85 μL.
[0146] (4) Optimization of on-chip CRISPR-Cas12a reaction time
[0147] 1. The concentration of the PCR product to be tested for influenza A was fixed, [BSA] was 12 mg / mL, the driving voltage was 24 V, the CRISPR-Cas12a reaction time was 5-8 min, the ECL signal antibody mixture was 6 μL, the concentration of T-line and C-line capture antibodies was 0.25 mg / mL, the immune reaction time was 3 min, and the sample volume was 80 μL.
[0148] 2. Set up experimental groups: Set different CRISPR-Cas12a reaction times (5, 6, 7 and 8 min) for optimization experiments.
[0149] 3. The testing process for the dry ECL lateral flow chip is the same as in Example 2, and the test results are as follows: Figure 7 As shown.
[0150] As shown in the figure, when the reaction time is less than 7 minutes, the T / C ratio increases with the reaction time; at 7 minutes, the T / C ratio reaches its maximum; after 7 minutes, the T / C ratio no longer increases with the reaction time. This phenomenon is likely due to the CRISPR-Cas12a reaction reaching a plateau. Therefore, 7 minutes is chosen as the optimal CRISPR-Cas12a reaction time on the chip, and the acceptable range for CRISPR-Cas12a reaction time is 5–8 minutes.
[0151] Example 4
[0152] The dual detection and selectivity experiments of the dry ECL lateral flow chip were carried out using the optimized conditions explored in Example 3.
[0153] 1. The concentration of the PCR product to be tested for influenza A was fixed, [BSA] was 12 mg / mL, the driving voltage was 24 V, the CRISPR-Cas12a reaction time was 7 min, the ECL signal antibody mixture was 6 μL, the concentration of T-line and C-line capture antibodies was 0.25 mg / mL, the immune reaction time was 3 min, and the sample volume was 80 μL.
[0154] 2. Set up one C line and two T lines (T1 is the detection line for influenza A DNA and T2 is the detection line for influenza B DNA) on the dry ECL lateral flow chip (at this time, the ratio of ECL luminescence intensity on the T line and the C line is represented by T1 / C and T2 / C, respectively). The added sample solutions are PBS (as blank control), influenza A plasmid PCR product, influenza B plasmid PCR product, and PCR products of influenza A and influenza B plasmids, respectively.
[0155] 3. The dry ECL lateral flow chip detection process is the same as in Example 2, and the above four sample solutions are detected respectively. The results are as follows: Figure 8 As shown.
[0156] As shown in the figure: when the sample solution is PBS, both T1 / C and T2 / C are less than 0.6, indicating that no influenza A or B DNA was detected. When the sample solution is influenza A plasmid PCR product, T1 / C is greater than 0.6 and T2 / C is less than 0.6, indicating that the sample solution contains only influenza A DNA and no influenza B DNA interference. When the sample solution is influenza B plasmid PCR product, T1 / C is less than 0.6 and T2 / C is greater than 0.6, indicating that the sample solution contains only influenza B DNA and no influenza A DNA interference. When the sample solution is both influenza A and influenza B plasmid PCR products, both T1 / C and T2 / C are greater than 0.6, indicating that the sample solution contains both influenza A and influenza B DNA. Therefore, this detection method has good selectivity for detecting influenza A or influenza B, and also demonstrates the potential for dual detection of influenza A and influenza B.
[0157] Example 5
[0158] The H1N1 virus culture was detected using the optimized conditions explored in Example 3 on a dry ECL lateral flow chip.
[0159] 1. The concentration of the PCR product to be tested for influenza A was fixed, [BSA] was 12 mg / mL, the driving voltage was 24 V, the CRISPR-Cas12a reaction time was 5 min, the ECL signal antibody mixture was 6 μL, the concentration of T-line and C-line capture antibodies was 0.25 mg / mL, the immune reaction time was 3 min, and the sample volume was 80 μL.
[0160] 2. The known concentration (1×10⁻⁶) 5 The influenza A virus culture was diluted to five concentration gradients (10 copies / mL, 1×10⁻⁶ ...). 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL and 1×10 5 (copies / mL).
[0161] 3. The testing process for the dry ECL lateral flow chip is the same as in Example 2, and the test results are as follows: Figure 9 As shown.
[0162] As shown in the figure, the T / C ratio gradually increases with increasing concentration of influenza A virus culture. This result effectively confirms the detection principle of the chip in this invention, namely, that higher concentrations of influenza A DNA activate the CRISPR-Cas12a reaction to produce more trans-cleavage products, thereby forming more complexes containing signal probes at the T line. 1 ~1×10 5Within the range of copies / mL, there was a good linear correlation between T / C and the logarithm of the influenza A virus culture concentration. The linear equation can be expressed as Y = 0.30303X + 1.79597, with a correlation coefficient (R²) of [missing value]. 2 The value was 0.99204. Therefore, this detection method can perform qualitative and semi-quantitative detection of influenza A virus and has good stability.
[0163] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A dry ECL lateral flow chip, characterized in that... Includes lateral flow test strips and electrode pads; The lateral flow test strip includes one or more test strips, one electrical conductivity test strip, and at least one quality control test strip; The test strip, quality control test strip, and electrical conductivity test strip have the same structure, consisting of an activation sheet, a binding sheet, a detection sheet, an absorption sheet, and a shared sample sheet; one end of each test strip is connected to the sample sheet, forming a radial branch centered on the sample sheet. The electrode sheet includes an integrated closed-type bipolar electrode and a driving electrode; The integrated closed bipolar electrode includes several electrodes; the integrated closed bipolar electrode is the same in shape as the lateral flow test strip, and one end of the electrodes is connected and branches out radially around the center of the bipolar electrode; The electrode includes at least one control anode, one shared cathode, and the others are detection anodes; The lateral flow test strip is placed upside down on the electrode sheet; wherein, the sample sheet coincides with the center of the bipolar electrode, the detection lateral flow test strip corresponds to the detection anode, the quality control lateral flow test strip corresponds to the quality control anode, and the electrical connection lateral flow test strip corresponds to the shared cathode.
2. The dry ECL lateral flow chip according to claim 1, characterized in that: The number of test strips is two or more.
3. The dry ECL lateral flow chip according to claim 1, characterized in that: The distances from the electrodes to their corresponding driving electrodes are equal.
4. The dry ECL lateral flow chip according to claim 1, characterized in that: The electrode anodes are arranged in parallel.
5. The dry ECL lateral flow chip according to claim 1, characterized in that: The lateral flow test strip is pasted onto a transparent adhesive plate and then inverted onto the electrode sheet.
6. The dry ECL lateral flow chip according to claim 1, characterized in that: The dry ECL lateral flow chip also includes a casing.
7. The application of the dry ECL lateral flow chip according to any one of claims 1 to 6 in the detection of CRISPR-Cas system.
8. The application according to claim 7, characterized in that: The dry ECL lateral flow chip described herein uses test strips whose activation sheets are pretreated with bovine serum albumin and then dried to fix different CRISPR-Cas reaction systems.
9. The application according to claim 7, characterized in that: The dry ECL lateral flow chip detects test strips by drying and modifying the binding layer to trans-cleave single-stranded DNA; the trans-cleaved single-stranded DNA is linked to a ruthenium terpyridine-modified anti-FAM antibody.
10. The application according to claim 7, characterized in that: The dry ECL lateral flow chip described herein has a quality control test strip whose binding layer is dried and modified only to be linked to the antibody with terpyridine ruthenium.
11. The application according to claim 7, characterized in that: The dry ECL lateral flow chip described herein detects antibodies captured by the T line in the test strip's detection pad.
12. The application according to claim 7, characterized in that: The dry ECL lateral flow chip has its control test strips containing antibody-capturing C-line.
13. The application according to any one of claims 8 to 12, characterized in that... Includes the following steps: (1) Design and preparation of primers, crRNA and tc-ssDNA For the biomarker to be tested, a highly specific fragment is selected as the target sequence; Design crRNA sequences targeting specific sequences; The tc-ssDNA sequence is a T-rich sequence with biotin modified at the 5' end and FAM group modified at the 3' end; (2) Preparation of signal antibodies and signal probes T-line signal antibodies and C-line signal antibodies were prepared. The T-line signal antibody was reacted with tc-ssDNA to prepare the corresponding T-line signal probe. (3) Sensing interface preparation After the T-line signal probe and streptavidin were premixed and reacted for several tens of minutes, they were sprayed onto the surface of the test strip conjugate; the C-line signal antibody was sprayed onto the surface of the quality control test strip conjugate. The T-line capture antibody was applied to the test strip to prepare the T-line, and the C-line capture antibody was applied to the control test strip to prepare the C-line. The lateral flow test strip and electrode sheet are assembled in sequence to form a dry ECL lateral flow chip; (4) Detection process First, the sample solution that may contain the biomarker to be tested is dropped onto the sample slide. The solution flows to the activation slide to start the CRISPR-Cas reaction. The CRISPR-Cas system is then flushed onto the binding slide for trans-cleavage. After waiting a few minutes at room temperature, the CRISPR reaction reaches the plateau phase. Next, buffer solution is added to the sample slide to flush the CRISPR trans-cleavage product from the binding slide onto the downstream detection slide for antigen-antibody reaction over a few minutes. Next, add buffer solution to wash away any remaining residue; Finally, the chip is placed in the ECL detector, a driving voltage is applied to trigger the ECL reaction, the ECL emission video is acquired by the CMOS camera in the detector, and the video is automatically analyzed by a mobile application to calculate the ECL emission intensity on the T line and C line, and further calculate their ratio to determine whether the sample contains the target biomarker and the concentration of the target biomarker.
14. The application according to claim 13, characterized in that: The biomarker to be tested is one or more of influenza A virus, influenza B virus, Escherichia coli, or Staphylococcus aureus.
Citation Information
Patent Citations
Method for rapidly synthesizing self-enhanced electrochemical luminescence probe based on polylysine in water phase and application of self-enhanced electrochemical luminescence probe
CN116948169A
Cited By
Application of three-dimensional closed bipolar electrochemical luminescence lateral flow chip in immunodetection
CN122150359A