Antibodies and biosensors for detecting PFAS compounds

Abstract

Antibodies and antibody fragments that bind to polyfluoroalkyl and perfluoroalkyl species (PFAS) are described for use in biosensors for detecting PFAS compounds in environmental samples. A detector comprising the biosensor and a kit for use with the detector are also described.

Description

Cross Reference to Related Applications

[0001] This application claims priority to U.S. Patent Application No. 63 / 455,650, filed March 30, 2023, which is incorporated by reference in its entirety. SEQUENCE LISTING

[0002] The present application is being filed along with an electronic format XML sequence listing in compliance with WIPO Standard ST.26, which is incorporated herein by reference in its entirety. The sequence listing file, entitled “P4372WO-Sequence Listing 3-28-2024.xml” was created on March 28, 2024, and is 139 kilobytes in size. The information contained in the electronic format of the sequence listing is incorporated by reference herein in its entirety. TECHNICAL FIELD

[0003] The present technology relates to antibodies and antibody fragments that bind to polyfluoroalkyl and perfluoroalkyl substances (PFAS) and detectors for detecting PFAS compounds in environmental samples using the antibodies and antibody fragments. BACKGROUND

[0004] Polyfluoroalkyl and perfluoroalkyl substances (PFAS) constitute a large class of persistent anthropogenic chemicals that have been used in industrial processes and commercial products over the past 60 years. Widespread use and extreme resistance to degradation have resulted in the ubiquitous presence of these compounds in the environment. The U.S. National Health and Nutrition Examination Survey (2011-2012) reported that serum PFAS concentrations were detectable in almost all individuals (97%). Human PFAS exposure has been linked to cancer, elevated cholesterol, obesity, immune suppression, and endocrine disruption. Health concerns have prompted manufacturers in Europe and North America to phase out the production of some long-chain PFAS. Limited available data suggest that widespread exposure to replacement (short-chain) PFAS can also have negative effects on human health. Human PFAS exposure includes dietary sources, household dust, air, and drinking water. Exposure from drinking water is a serious concern due to the high water solubility of many PFAS. Relatively lower PFAS concentrations can result in increased exposure for the general population. Elevated PFAS concentrations in drinking water have been reported in many areas of the United States, particularly near industrial sites where these PFAS were produced or used (Hu et al., Environ. Sci. Technol. Lett. 2016, 3, 10, 344-350, incorporated by reference in its entirety).

[0005] Current techniques for detecting PFAS can reliably quantify about 50 specific PFAS, but these techniques cannot detect or quantify the thousands of other PFAS known to exist. A common conventional method for detecting PFAS compounds is LC-MS / MS, which is expensive and time consuming.

[0006] There is a need for improved techniques for detecting PFAS compounds, particularly detector systems that can be operated outside of a laboratory. SUMMARY

[0007] According to one embodiment, an antibody or antibody fragment that binds at least to perfluorononanoic acid (PFNA) is provided, the antibody or antibody fragment comprising: a CDR1 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 55, 60, 64, and 67; a CDR2 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 56, 61, 65, and 68; and a CDR3 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 57, 62, 66, and 69.

[0008] The antibody or antibody fragment can comprise a CD4 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 58, 59, 63, and 70.

[0009] The antibody or antibody fragment can comprise a VHH antibody sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 1-8.

[0010] According to another embodiment, an antibody or antibody fragment that binds at least to perfluorooctane sulfonate (PFOS) is provided, the antibody or antibody fragment comprising: a CDR1 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 71 and 75; a CDR2 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 72 and 76; and a CDR3 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 73 and 77.

[0011] The antibody or antibody fragment can comprise a CD4 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 74 and 78.

[0012] The antibody or antibody fragment can include a VHH antibody sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 9 and 10.

[0013] According to another embodiment, there is provided an antibody or antibody fragment that binds at least to perfluorobutane sulfonate (PFBS), the antibody or antibody fragment comprising: a CDR1 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 55 and 79; a CDR2 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 56 and 80; and a CDR3 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 57 and 81.

[0014] The antibody or antibody fragment can include a CD4 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 58 and 59.

[0015] The antibody or antibody fragment can include a VHH antibody sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 11-13.

[0016] According to another embodiment, there is provided an antibody or antibody fragment that binds at least to perfluorooctanoic acid (PFOA), the antibody or antibody fragment comprising: a CDR1 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 55, 82, 86, 90, 93, 131, 135, 139, and 143; a CDR2 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 56, 83, 87, 91, 94, 132, 136, 140, and 144; and a CDR3 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 57, 84, 88, 92, 95, 133, 137, 141, and 145.

[0017] The antibody or antibody fragment can include a CD4 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 58, 59, 85, 89, 134, 138, and 142.

[0018] The antibody or antibody fragment can include a VHH antibody sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 14-18.

[0019] According to another embodiment, there is provided an antibody or antibody fragment that binds at least to perfluorohexanesulfonate (PFHxS), the antibody or antibody fragment including: a CDR1 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 96, 100, 104, 107, 110, and 114; a CDR2 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 97, 101, 105, 108, 111, and 115; and a CDR3 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 98, 102, 106, 109, 112, and 116.

[0020] The antibody or antibody fragment can include a CD4 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 59, 74, 99, 103, and 113.

[0021] The antibody or antibody fragment can include a VHH antibody sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 19-24.

[0022] According to another embodiment, there is provided an antibody or antibody fragment that binds at least to hexafluoropropylene oxide dimer acid (GenX), the antibody or antibody fragment including: a CDR1 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 55; a CDR2 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 56; and a CDR3 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 57 and 117.

[0023] The antibody or antibody fragment can include a CD4 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 58.

[0024] The antibody or antibody fragment can include a VHH antibody sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 25-27.

[0025] In some embodiments, the antibody or antibody fragment described herein binds to more than one PFAS compound selected from the group consisting of PFNA, PFOS, PFOA, PFBS, PFHxS, and GenX.

[0026] In some embodiments, the antibody or antibody fragment that binds to more than one PFAS compound has an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 13-17, and 23.

[0027] In some embodiments, the antibody or antibody fragment comprises one or more variants of one or more CDRs, wherein the one or more variants comprise one or more substitutions of hydrophilic amino acid residues with hydrophobic residues, thereby exhibiting greater binding affinity for PFAS compounds.

[0028] In some embodiments, the antibody or antibody fragment comprises an affinity tag configured to facilitate binding of a detection molecule.

[0029] According to another embodiment, there is provided an isolated nucleic acid sequence encoding any of the antibodies or antibody fragments described herein.

[0030] In some embodiments, the isolated nucleic acid sequence has a sequence selected from the group consisting of SEQ ID NOs: 28-54.

[0031] According to another embodiment, there is provided a cell or virus comprising the isolated nucleic acid sequence described herein.

[0032] According to another embodiment, there is provided a detector system for identifying PFAS compounds, the detector system comprising the antibody or antibody fragment described herein.

[0033] In some embodiments of the detector system, the PFAS compound binds to the antibody or antibody fragment in an ELISA assay.

[0034] According to another aspect, there is provided an antibody or antibody fragment that binds at least to perfluorooctanoic acid (PFOA), the antibody or antibody fragment comprising: a CDR1 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 139; a CDR2 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 140; and a CDR3 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 141. The antibody or antibody fragment can comprise a CD4 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 142. The antibody or antibody fragment can comprise a VHH antibody sequence having at least about 80% sequence identity to SEQ ID NO: 125. In some embodiments, there is provided an isolated nucleic acid sequence encoding a VHH antibody, which can be the sequence of SEQ ID NO: 129.

[0035] According to another aspect, there is provided an antibody or antibody fragment that binds at least to perfluorooctanoic acid (PFOA), the antibody or antibody fragment comprising: a CDR1 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 93; a CDR2 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 94; and a CDR3 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 95. The antibody or antibody fragment can comprise a CD4 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 58. The antibody or antibody fragment can comprise a VHH antibody sequence having at least about 80% sequence identity to SEQ ID NO: 17. In some embodiments, there is provided an isolated nucleic acid sequence encoding a VHH antibody, which can be the sequence of SEQ ID NO: 44.

[0036] According to another aspect, there is provided an antibody or antibody fragment that binds at least to PFNA, the antibody or antibody fragment comprising: a CDR1 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 55; a CDR2 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 56; and a CDR3 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 57. The antibody or antibody fragment can comprise a CD4 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 59. The antibody or antibody fragment can have a VHH antibody sequence having at least about 80% sequence identity to SEQ ID NO: 2. In some embodiments, there is provided an isolated nucleic acid sequence encoding a VHH antibody, which can be the sequence of SEQ ID NO: 29.

[0037] According to another aspect, there is provided an antibody or antibody fragment that binds at least to PFNA, the antibody or antibody fragment comprising: a CDR1 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 55; a CDR2 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 56; and a CDR3 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 57. The antibody or antibody fragment can comprise a CD4 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 59. The antibody or antibody fragment can have a VHH antibody sequence having at least about 80% sequence identity to SEQ ID NO: 2. In some embodiments, there is provided an isolated nucleic acid sequence encoding a VHH antibody, which can be the sequence of SEQ ID NO: 29.

[0038] According to another aspect, there is provided an antibody or antibody fragment that binds at least to perfluorooctanoic acid (PFOA), the antibody or antibody fragment comprising: a CDR1 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 143; a CDR2 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 144; and a CDR3 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 145. The antibody or antibody fragment can comprise a CD4 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 59. The antibody or antibody fragment can have a VHH antibody sequence having at least about 80% sequence identity to SEQ ID NO: 126. In some embodiments, there is provided an isolated nucleic acid sequence encoding a VHH antibody, which can be the sequence of SEQ ID NO: 130.

[0039] According to another aspect, there is provided an antibody or antibody fragment that binds at least to perfluorooctanoic acid (PFOA), the antibody or antibody fragment comprising: a CDR1 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 143; a CDR2 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 144; and a CDR3 amino acid sequence having at least about 80% sequence identity to SEQ ID NO: 145. The antibody or antibody fragment can comprise a CD4 amino acid sequence having at least about 80% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 59. The antibody or antibody fragment can have a VHH antibody sequence having at least about 80% sequence identity to SEQ ID NO: 126. In some embodiments, there is provided an isolated nucleic acid sequence encoding a VHH antibody, which can be the sequence of SEQ ID NO: 130.

[0040] According to some embodiments, there is provided a cell or virus comprising any one of the isolated nucleic acid sequences described herein.

[0041] In some embodiments, the antibody or antibody fragment described herein binds to one or more additional PFAS compounds selected from the group consisting of PFNA, PFOS, PFOA, PFBS, PFHxS, and GenX.

[0042] According to another aspect, a detector system for identifying PFAS compounds is provided, the detector system comprising one or more of the antibodies or antibody fragments described herein. In some embodiments of the detector system, the PFAS compounds bind to the antibodies or antibody fragments in an ELISA assay. The ELISA assay can be a direct ELISA or a competitive ELISA.

[0043] In some embodiments, the ELISA assay is configured to detect free PFAS compounds in an aqueous sample. The free PFAS compounds can comprise one or more PFAS compounds selected from the group consisting of PFOA, PFNA, PFOS, PFBS, PFHxS, and GenX.

[0044] In some embodiments, the ELISA assay comprises an immobilized PFAS compound. The immobilized PFAS compound can be immobilized using a biotin-streptavidin interaction. The competitive ELISA can include binding of a PFAS molecule conjugated to a biotin moiety.

[0045] In some embodiments, the detector system comprises a detection plate coated with streptavidin, wherein the PFAS molecule conjugated to the biotin moiety provides the immobilized PFAS compound when the biotin moiety binds to the streptavidin.

[0046] In some embodiments, the VHH antibody comprises an affinity tag, and the secondary antibody binds to the affinity tag.

[0047] In some embodiments, the competitive ELISA includes a tertiary antibody conjugated to peroxidase, wherein the tertiary antibody binds to the secondary antibody, thereby providing a detectable antibody complex through a peroxidase substrate reaction.

[0048] In some embodiments, the competitive ELISA includes a cyclodextrin that binds to the free PFAS compounds and the immobilized PFAS compounds. BRIEF DESCRIPTION OF DRAWINGS

[0049] Various objects, features, and advantages of specific embodiments of the present disclosure will become more apparent from the following description and accompanying drawings. Figure 1 A is a gel RNA profile obtained from lymphocytes. Figure 1 B is a gel VHH DNA profile after nested PCR, showing bands at 600 bp to 900 bp. Figure 1 C is a gel VHH DNA profile after nested PCR, showing bands at 400 bp and below 400 bp. Figure 2Gel VHH map of 19 randomly picked colonies of bacterial cell transformants with VHH vectors for phage display library. Figure 3A Bar graph of ELISA detection showing binding of VHH antibodies of PFNA V2 to PFNA in methanol solution and control samples in carbonate buffer. Figure 3B Bar graph of ELISA detection showing binding of VHH antibodies of PFNA V2 to PFNA in DMSO solution and control samples in carbonate buffer. Figure 4 Plot of absorbance measured in a competitive ELISA assay using PFNA coated plates versus concentration of free PFAS in solution (ppm). Figure 5 Plot of absorbance measured in a direct type ELISA assay of PFAS compounds immobilized on plates using a streptavidin protein-biotin interaction versus concentration of free PFAS in solution (ppm). Figure 6 Bar graph showing direct type ELISA assay analysis results of VHH antibodies PFNA V1 to PFNA V8, where absorbance was measured in the absence of immobilized PFAS compounds and in the presence of 200 ppm immobilized PFAS compounds. Figure 7 Bar graph showing direct type ELISA assay analysis results of VHH antibodies PFOA V1 to PFOA V6, PFBS V1 to PFBS V3, PFOS V1 and PFOS v2, where absorbance was measured in the absence of immobilized PFAS compounds and in the presence of 200 ppm immobilized PFAS compounds. Figure 8 Bar graph showing direct type ELISA assay analysis results of VHH antibodies PFHxS V1 to PFHxS V6 and GenX V1 to GenX V3, where absorbance was measured in the absence of immobilized PFAS compounds and in the presence of 200 ppm immobilized PFAS compounds. Figure 9 Bar graph showing direct type ELISA assay analysis results of VHH antibodies BPL1 to BPL4, where absorbance was measured in the absence of immobilized PFAS compounds and in the presence of 200 ppm immobilized PFAS compounds. Figure 10 Bar graph comparing direct type ELISA assay results of VHH antibodies showing the maximum degree of binding to immobilized PFAS compounds. Figures 6-9 Bar graph comparing direct type ELISA assay results of VHH antibodies showing the maximum degree of binding to immobilized PFAS compounds. Figure 11 is a bar graph comparing the results of direct ELISA assays for three VHH antibodies (PFNA V2, PFOA V5, and BPL3) showing the maximum extent of binding of the three VHH antibodies to immobilized PFAS compounds. Figure 12 is a plot of absorbance versus free PFOA concentration (ppm) for three VHH antibodies (PFNA V2, PFOA V5, and BPL3) showing the maximum extent of binding of the three VHH antibodies to immobilized PFAS compounds. Shown are the EC 10 and EC 05 values calculated from these plots for each VHH antibody. DETAILED DESCRIPTION INTRODUCTION

[0050] The present inventors have been involved in the development of field-deployable electrochemical detectors for the analysis of environmental samples of various analytes (see, e.g., U.S. Patents 9,689,046 and 10,415,102, each incorporated herein by reference in its entirety).

[0051] In recognition of the need for rapid detection of PFAS compounds in environmental samples, the present inventors recognized that antibodies can be generated to selectively bind to PFAS molecules and combined with detector molecules that recognize binding complexes between the antibodies and a given PFAS compound as the basis for an initial detection step based on a biosensor, where recognition of the binding complex results in the release of an electrochemically or spectrophotometrically detectable molecule whose signal is related to the level of PFAS molecules in the environmental sample. The present inventors selected the class of VHH antibodies as the basis for the antibodies because such antibodies are expected to provide superior binding results for binding PFAS molecules relative to larger antibodies such as immunoglobulins (IgG). ANTIBODIES

[0052] As used herein, "antibody" refers generally to a protein consisting of one or more polypeptides substantially encoded by immunoglobulin genes or fragments of immunoglobulin genes. When the term "antibody" is used, it is also contemplated that the term "antibody fragment" can also be involved. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively. The basic immunoglobulin (antibody) structural unit comprises a tetramer or dimer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (L) (about 25 kD) and one "heavy" (H) chain (about 50-70 kD). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids that is primarily responsible for antigen recognition. The terms "variable light chain" and "variable heavy chain" refer to these variable regions of the light and heavy chains, respectively. Alternatively, an antibody or immunological portion of an antibody can be chemically conjugated to a fusion protein with other proteins, or expressed as a fusion protein with other proteins. The antibodies described herein are intended to bind to PFAS compounds.

[0053] "Specific binding" is understood by those of skill in the art, where the skilled artisan is well aware of the various experimental procedures that can be used to test for binding and binding specificity. Some cross-reactivity or background binding can be unavoidable in many protein-protein interactions; this does not detract from the binding "specificity" between an antibody and an epitope. The term "directed against" is also applicable when the term "specificity" is considered in understanding the interaction between an antibody and an epitope.

[0054] Embodiments of antibodies include, but are not limited to, polyclonal antibodies, monoclonal antibodies, bispecific antibodies, human antibodies, humanized antibodies or chimeric antibodies, single variable fragments (ssFv), single domain antibodies (e.g., VHH fragments from nanobodies), single chain fragments (scFv), Fab fragments, F(ab')2 fragments, fragments produced by a Fab expression library, anti-idiotypic antibodies, and epitope-binding fragments, or combinations thereof of any of the above, provided that they retain the original binding properties provided by the CDR sequences or variants thereof. Minibodies and multivalent antibodies, such as diabodies, triabodies, tetravalent antibodies, and peptide antibodies produced from the antibodies described herein can also be used. Embodiments of such multivalent antibodies are contemplated to have enhanced binding affinity for PFAS compounds. The immunoglobulin molecule can be of any class (i.e., IgG, IgE, IgM, IgD, and IgA) or subclass of immunoglobulin molecule. Accordingly, as used herein, the term antibody also includes antibodies and antibody fragments that are either generated by modifications to whole antibodies or synthesized de novo using recombinant DNA methods.

[0055] The present application also relates to the use of an antibody or fragment thereof, e.g., a variable region, as described herein, in a recognition molecule or affinity reagent suitable for selective binding to a target. Antibodies or fragments thereof according to the present application can be chemically modified by covalent attachment of a chemical or biochemical affinity moiety to the antibody using conventional conjugation techniques, thereby providing flexibility in the development of various detection assays, including but not limited to ELISA assays, which can be competitive, non-competitive, direct, indirect, or sandwich-type ELISA assays.

[0056] The "variable region" of an antibody refers to the variable region of the antibody light chain or the variable region of the antibody heavy chain, either alone or in combination. The variable regions of the heavy and light chains each consist of four framework regions (FRs) connected by three complementarity determining regions (CDRs) also known as hypervariable regions. The CDRs in each chain are held together in close proximity by the FRs and, with the CDRs from the other chain, contribute to the formation of the antigen binding site of antibodies. There are at least two techniques for determining CDRs: (1) an approach based on cross-species sequence variability; and (2) an approach based on crystallographic studies of antigen-antibody complexes. As used herein, CDRs can relate to CDRs defined by either approach or by a combination of the two approaches.

[0057] In some embodiments, the present application provides antibodies comprising at least one CDR, at least two, at least three, or more CDRs that are substantially identical to at least one CDR, at least two, at least three, or more CDRs of an antibody of the present application. Other embodiments include antibodies having at least two, three, four, five, or six CDRs that are substantially identical to at least two, three, four, five, or six CDRs of an antibody of the present application or that are derived from an antibody of the present application. In some embodiments, at least one, two, three, or four CDRs are at least about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 95%, 96%, 97%, 98%, or 99% identical to at least one, two, or three CDRs of an antibody of the present application. It will be appreciated that, for purposes of the present application, the binding specificity and / or overall activity is generally preserved, although the degree of activity can differ (possibly be greater or less) from that of the recited antibody. Using routine genetic engineering techniques, the CDRs of the VHH antibodies described herein can be provided on alternative antibody frameworks, which can be chimeric antibodies of various classes and formed from domains from different species. Such modifications can be provided for any reason, for example, to provide increased stability in a detection system.

[0058] Sequence variants of the claimed nucleic acids, proteins, and antibodies (e.g., defined by the claimed % sequence identity) that also retain the recited properties of the present application are included within the scope of the present application. Such variants that show alternative sequences but retain substantially the same binding properties (e.g., target specificity) as the particular sequences provided are referred to as functional analogues / functionally analogous. Sequence identity relates to the percentage of identical nucleotides or amino acids when a sequence alignment is performed.

[0059] One of ordinary skill in the art will appreciate that, as a result of the degeneracy of the genetic code, there are many nucleotide sequences that encode the polypeptides described herein. Some of these polynucleotides have minimal homology or sequence identity to the nucleotide sequence of any natural gene. Nonetheless, the present application specifically contemplates polynucleotides that vary due to differences in codon usage. Deletions, substitutions, and other changes to the sequences within the recited sequence identity are also contemplated by the present application.

[0060] Protein sequence modifications that can occur by substitution are also included within the scope of the present application. Substitution as defined herein is a modification made to the amino acid sequence of a protein by which one or more amino acids are replaced with the same number of (different) amino acids, thereby resulting in a protein containing a different amino acid sequence than the primary protein, preferably without significantly altering the function of the protein. The addition and / or substitution can be natural or artificial. It is well known in the art that amino acid substitutions can be made without significantly altering the function of the protein. This is particularly true when the modification involves a "conservative" amino acid substitution, which is the substitution of one amino acid for another similar amino acid. Such "conservative" amino acids can be natural or synthetic amino acids that can be substituted for the amino acid without significantly affecting the structure and function of the protein due to size, charge, polarity, and conformation. Generally, many amino acids can be replaced by conservative amino acids without adversely affecting the function of the protein.

[0061] Generally, the non-polar amino acids Gly, Ala, Val, lie, and Leu; the non-polar aromatic amino acids Phe, Trp, and Tyr; the neutral polar amino acids Ser, Thr, Cys, Gin, Asn, and Met; the positively charged amino acids Lys, Arg, and His; and the negatively charged amino acids Asp and Glu, represent the group of conservative amino acids. This list is not exhaustive. For example, it is well known that Ala, Gly, Ser, and sometimes Cys can be substituted for one another, even though they belong to different groups.

[0062] Substitution variants remove at least one amino acid residue from an antibody molecule and insert a different residue in its place. The most interesting sites for substitution mutations include the hypervariable regions, but FR alterations are also contemplated.

[0063] According to some embodiments, one or more hydrophobic amino acid residues are used to replace one or more hydrophilic amino acid residues of one or more CDRs of an antibody of the application, with the aim of enhancing the binding affinity for PFAS compounds through hydrophobic interactions.

[0064] Substantial modifications in the biological properties of an antibody are accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.

[0065] Conservative amino acid substitutions are not limited to naturally occurring amino acids, but also include synthetic amino acids. Commonly used synthetic amino acids are: omega amino acids of various chain lengths and cyclohexylalanine, which are neutral, nonpolar analogs; citrulline and methionine sulfoxide as neutral, nonpolar analogs; phenylglycine as an aromatic, neutral analog; cysteine, which is a negatively charged analog, and ornithine, which is a positively charged amino acid analog. As with naturally occurring amino acids, this list is not exhaustive, but merely exemplary substitutions well known in the art.

[0066] Antibodies of the present application can be produced by transfecting host cells with expression vectors containing the coding sequences of the antibodies of the present application. The expression vectors or recombinant plasmids are prepared by operably binding the coding sequences of the antibodies with conventional regulatory control sequences capable of controlling replication and expression in the host cell and / or secretion from the host cell. The regulatory sequences include promoter sequences, such as the CMV or T7 promoter, and signal sequences that can be derived from other known antibodies. Similarly, a second expression vector can be prepared having a DNA sequence encoding the light chain or heavy chain of the complementary antibody. In certain embodiments, the second expression vector is identical to the first expression vector except for the coding sequences and a selectable marker, to ensure as much as possible that each polypeptide chain is functionally expressed. Alternatively, the heavy and light chain coding sequences of the antibodies can be located on a single vector. The antibodies described herein are VHH antibodies. However, the CDRs of the antibodies described herein can be engineered into any class of immunoglobulin (e.g., IgG, IgM, IgA, IgD, and IgE) and any antibody fragment thereof, to provide chimeric antibodies or fragments thereof.

[0067] The selected host cells are co-transfected (or simply transfected by a single vector) using both the first and second vectors by conventional techniques to produce the transfected host cells of the present application containing both recombinant or synthetic light and heavy chains. The transfected cells are then cultured by conventional techniques to produce the engineered antibodies of the present application. The culture is screened by appropriate assays (e.g., ELISA or RIA) for antibodies containing both recombinant heavy and / or light chains that bind. Similar conventional techniques can be used to construct other antibodies.

[0068] Suitable vectors for the cloning and subcloning steps employed in the construction of the methods and compositions of the application can be selected by those of skill in the art. For example, conventional pUC series cloning vectors can be used. In one embodiment, a vector known as pUC19 is commercially available. Components of such vectors (e.g., replicon, selectable gene, enhancer, promoter, signal sequence, etc.) can be obtained from commercial or natural sources or can be synthesized by known methods for directing expression and / or secretion of recombinant DNA products in a selected host. Other suitable expression vectors can be selected for this purpose, among the many types of expression vectors known in the art for mammalian, bacterial, insect, yeast, and fungal expression.

[0069] The present application also includes cell lines transfected with recombinant plasmids containing the coding sequences for the antibodies of the present application. Host cells useful for cloning and other manipulation of these cloning vectors are also conventional.

[0070] Suitable host cells or cell lines for expression of the antibodies of the present application include mammalian cells, such as NSO, Sp2 / 0, CHO (e.g., DG44), COS, HEK, fibroblast (e.g., 3T3), and myeloma cells, for example. It can be expressed in CHO or myeloma cells, for example. Human cells can be used, enabling the molecule to be modified using the human glycosylation pattern. Alternatively, other prokaryotic or eukaryotic cell lines can be used, such as E. coli, P. pastoris, or S. cerevisiae. Selection of suitable mammalian or prokaryotic host cells and methods for transformation, culturing, amplification, screening, and product production and purification are known in the art. PFAS compounds

[0071] The U.S. Environmental Protection Agency (EPA) currently maintains a master list of PFAS compounds on its website at comptox.epa.gov Some of the more common PFAS compounds include perfluorononanoic acid (PFNA), perfluorooctanoic acid (PFOA), perfluorooctane sulfonate (PFOS), perfluorohexane sulfonate (PFHxS), perfluorobutane sulfonate (PFBS), and hexafluoropropylene oxide dimer acid (HFPO-DA, also commonly known as GenX). Notably, each of these compounds includes at least one ionizable functional group that will be either protonated or deprotonated, depending on the pH of the solution and the pKa value of each individual ionizable group. For simplicity, the compound names listed above are intended herein to refer to both the protonated and deprotonated forms as well as salts thereof.

[0072] In considering the challenges associated with producing antibodies that bind to small molecules, the inventors recognized that VHH antibodies are well suited for small molecule analysis. VHH antibodies, also known as “nanobodies,” are antigen-binding fragments of antibodies that are naturally produced by camelids and sharks and consist of only heavy chains. VHH antibodies, discovered nearly 25 years ago, have been studied for clinical treatments and immunodiagnosis, and more recently for environmental monitoring applications. VHH antibodies are a novel and valuable immunoreagent for the analysis of small molecular weight environmental chemicals, and are expected to overcome many of the pitfalls encountered by conventional reagents. In work to date, VHH antibodies have generally performed as well as conventional antibodies in small molecule analysis, are amenable to many genetic engineering techniques, and have shown ease of adaptation to other immunodiagnostic platforms for environmental monitoring (Bever et al., Anal. Bioanal. Chem., 2016, 408(22): 5985-6002, incorporated by reference in its entirety).

[0073] In a typical conventional method of isolating a VHH antibody that binds to a given compound from a camelid, the camelid is injected with a solution containing the compound, and blood is collected from the camelid, from which mRNA is collected and converted to cDNA by reverse transcriptase PCR. The cDNA is amplified and digested to isolate VHH genes for incorporation into a plasmid and expression by phage, resulting in a VHH library. The library is then panned to identify VHH antibodies of interest (Bever et al., infra). After isolation of the VHH antibodies, testing is performed to determine the binding affinity of the VHH antibodies to the compound of interest.

[0074] The present application describes antibodies and fragments thereof that have binding affinity for PFAS compounds, including but not limited to six of the most common and potentially dangerous PFAS compounds; PFNA, PFOA, PFOS, PFHxS, PFBS, and GenX.

[0075] The present application includes antibodies that bind to more than one of the above-listed compounds, including two or more, three or more, four or more, five or more, or all six of PFNA, PFOA, PFOS, PFHxS, PFBS, and GenX. Some antibodies can also bind additional PFAS compounds, including but not limited to PFAS compounds listed in the PFAS Master List at comptox.epa.gov Detection of PFAS compounds

[0076] ​The antibodies described herein were developed to provide the basis for biosensors for detecting PFAS compounds. In one embodiment, the biosensor comprises an ELISA-based recognition assay in which specific binding of the antibody to a given PFAS compound results in an immobilized complex that is detected by a recognition molecule, such as a secondary antibody or an affinity-based molecule conjugated to an enzyme. The enzyme catalyzes a reaction of a precursor molecule to produce a detectable molecule that can be quantified by electrochemical, spectrophotometric, colorimetric, or fluorescent techniques. In one example of an ELISA-based biosensor assay, an environmental sample is provided for testing for the presence of a PFAS compound. An anti-PFAS antibody that recognizes the PFAS compound is contacted with the sample and incubated under conditions that immobilize the resulting complex on a substrate. The sample is washed and a secondary antibody developed to recognize the anti-PFAS compound antibody is added to the sample. The secondary antibody comprises a conjugated horseradish peroxidase. A peroxidase substrate, such as 3,3',5,5'-tetramethylbenzidine (TMB), is added to the sample and is converted by the peroxidase to an electrochemically active species that provides an electrochemical signal that is related to the level of PFNA in the sample. Examples of enzymes and molecules that provide electrochemically active molecules in a field-deployable chemical detector are described in U.S. Patents 9,689,046 and 10,415,102, each of which is incorporated by reference herein in its entirety.

[0077] In some detector embodiments, the PFAS compound is immobilized on a substrate and pre-mixed with the antibody or antibody fragment. The antibody will bind to any PFAS compound in the sample, meaning that less of the available antibody or antibody fragment is available to interact with the PFAS compound on the substrate. The decrease in signal observed will be proportional to the concentration of PFAS compound in the original sample. This can be done while the plate is exposed to the sample or pre-mixed. Alternatively, the PFAS compound can be immobilized on the plate as a “free” PFAS or by conjugation, such as labeling BSA with the PFAS compound, or using a streptavidin-coated plate and exposing it to a biotin-conjugated PFAS compound.

[0078] Another detector implementation can use a capture antibody on a surface, such as an anti-camel or anti-hemagglutinin antibody, and expose it to an anti-PFAS antibody or antibody fragment simultaneously or in a separate tube containing a sample of interest with a known concentration of a "detectable" PFAS compound. This detectable molecule can be radiolabeled, conjugated to an enzyme, or conjugated to another moiety that can be detected later, such as conjugated biotin, providing for interaction with streptavidin-linked peroxidase, which is then exposed. In alternative implementations, other interacting moieties can be used in place of biotin and streptavidin. The greater the concentration of PFAS compound in the sample, the smaller the fraction of detectable PFAS bound by the antibody or antibody fragment, which will translate to less detectable PFAS captured on the surface.

[0079] In some implementations, the antibody backbone can be adjusted to reduce overall size, to add additional recognition sites for secondary antibodies (e.g., to add a GST tag), to add a cleavage tag (e.g., TEV before a purification tag), or to directly attach HRP / AP / LacZ / Enzymatic reporter, so that no secondary antibody is needed. The antibody can include an affinity tag, such as polyhistidine, maltose binding protein, glutathione-S-transferase, Strep tag, calmodulin binding protein, FLAG tag, S tag, chitin binding domain, hemagglutinin, and c-Myc tag. These and other affinity tags and tag strategies are described in Zhao et al., J. Anal, Methods Chem., 2013, Article ID 581093, which is incorporated by reference herein in its entirety. The antibody can include a non-enzymatic reporter molecule, such as green fluorescent protein, luciferase, and anthocyanin.

[0080] In some implementations, a peroxidase is attached to an affinity tag (e.g., small polypeptide, small molecule, or metal chelate) in place of a secondary antibody, and the anti-PFAS antibody is provided with a moiety that binds the affinity tag, if needed. In other implementations, an affinity tag can be provided on the antibody or antibody fragment, and a binding sequence can be provided on the reporter molecule.

[0081] In certain preferred implementations of the biosensor system of the present invention, mixing, reactions, and detection occur in the channels and chambers of a cartridge, and the reagents outlined above are provided in a kit product along with the cartridge. The kit can include instructions for performing a sample assay. Some implementations of the kit can include antibodies that can bind to more than one PFAS compound for use as a general survey assay, while other implementations can include a series of antibodies for specific detection of particular PFAS compounds, such as any of the PFAS compounds identified herein, and PFAS compounds in the master list compiled by the U.S. EPA, for example. Examples: Example 1: Generation of VHH antibodies recognizing PFAS compounds

[0082] Preparation of antigen solution - Antigen solutions of PFAS compounds were prepared according to the protocol provided by the commercial supplier of the PFAS compounds. PFNA (CAS# 335-95-1) was obtained from Fischer Scientific (Hampton, NH, USA), PFOA (CAS# 335-67-1) was obtained from Sigma-Aldrich (St. Louis, MO, USA), PFOS (CAS# 1763-23-1) was obtained from Sigma-Aldrich, PFHxS (CAS# 355-46-4) was obtained from Clinisciences (Nanterre, France), PFBS (CAS# 375-73-5) was obtained from Sigma Aldrich, GenX (CAS# 13252-13-6) was obtained from Wellington Laboratories (Guelph, ON, Canada).

[0083] Immunization - Healthy 2-year-old dromedary camels (Camelus dromedarius) were immunized mainly with samples of PFAS compounds mixed with an equal volume of Freund’s complete and incomplete adjuvants. To stimulate antigen-specific B cells, samples of PFAS compounds were injected every week. After 8 injections and 3 to 4 days after the last injection, 100 mL of anticoagulated blood was collected from the jugular vein of the immunized animals. Blood was concentrated to a final volume of 30 mL using a tube. After centrifugation at 1,000 x g for 10 minutes at room temperature, the plasma (top layer) was removed without disturbing the interface and peripheral blood lymphocytes (PBLs) were collected at the interface. PBLs were then isolated by Ficoll-Paque™ PLUS (GE Healthcare, USA) following the manufacturer’s instructions and used to construct libraries.

[0084] ELISA - To assess the specificity of the ELISA, sera were adsorbed in 96-well Maxisorp plates (Nunc, Denmark) at a dilution of 1:2000. After blocking, the plates were incubated with 100 ng / mL of PFAS antigens. After washing, the plates were incubated with a 1:1000 dilution of a rabbit anti-PFAS serum. After washing, the plates were incubated with a 1:1000 dilution of a goat anti-rabbit IgG conjugated with horseradish peroxidase (HRP). After washing, the plates were incubated with a 1:1000 dilution of TMB substrate (Invitrogen, USA). The reaction was stopped with 1 M H3P04 and the absorbance was measured at 450 nm. TM ​The microtiter plates were incubated overnight at 4°C. On the next day, the solution was removed and the wells were washed 5 times with PBS / Tween. Then, 200 μΐ, of a 5% (w / v) solution of skimmed milk powder in PBS was added to each of the antigen-coated wells for 2 hours at room temperature to block the remaining protein binding sites on the plastic. After the removal of the skimmed milk solution from the wells, 100 μΐ, of anti-IgG antibodies conjugated to horseradish peroxidase diluted 1 :3,000 in PBS were added and the solution was left to stand for 1 hour at room temperature. The wells were washed 5 times with PBS / Tween and the absorbance was measured at 405 nm using a microtiter plate reader 10 to 30 minutes after the addition of the ELISA substrate.

[0085] Construction of the VHH library - Total RNA was isolated from peripheral blood lymphocytes using the Total RNA Miniprep Kit (Sigma-Aldrich). To avoid contamination with VH genes, the variable region of the heavy chain immunoglobulin (VHH) was amplified by nested PCR. First-strand cDNA was used in each PCR reaction together with primers CALL001 (GTCCTGGCTGCTCTTCTACAAGG, SEQ ID NO: 118) and CALL002 (GGTACGTGCTGTTGAACTGTTCC, SEQ ID NO: 119). The protocol for the first PCR consisted of an initial denaturation step at 94°C for 7 minutes, followed by 30 cycles of 1 minute at 94°C, 1 minute at 55°C and 72°C, and a final extension step at 72°C for 10 minutes. The VHH genes of the first PCR product were analyzed by agarose gel electrophoresis. DNA was extracted using a gel plug from a band of approximately 700 base pairs (bp) to be used as a template in the second PCR. The second PCR was performed using primers VHH BACK-1 (GATGTGCAGCTGCAGGAGTCTGGAGGAGG, SEQ ID NO: 120), VHH-BACK-2 (GATGTGCAGCTGCAGGAGTCTGGGGGAGG, SEQ ID NO: 121) and PMCF (CTAGTGCGGCCGCTGAGGAGACGGTGACCTGGGT, SEQ ID NO: 122) containing restriction enzyme sites Pstl and Notl, using the same protocol as for the first PCR. The PCR product was run on a 1% agarose gel and a band of approximately 400 bp was extracted from the gel.

[0086] The amplified second PCR product (1 μg) was digested using Pstl and Notl restriction enzymes (NEB, France) and then inserted into linearised phagemid (3 μg). The ligation product was transformed into Escherichia coli TG1 cells by electroporation. Transformants were plated onto 2xYT containing 10% glucose and 100 μg / mL ampicillin and incubated at 37°C for 16 hours. An aliquot of the library was plated and the colony count was used to determine the library size. A number of clones were randomly selected and used for colony PCR to estimate the percentage of clones in the library with the appropriate insert size. An initial denaturation step at 95°C for 5 minutes was performed to lyse the bacterial cells, followed by 28 cycles of 94°C for 45 seconds, 55°C for 45 seconds and 72°C for 45 seconds, and a final extension step at 72°C for 10 minutes.

[0087] Selection of VHH antibodies - 1 mL of the VHH library was grown and infected with M13 helper phage to express the VHHs at the tip of the phage particles. Samples of PFAS compounds (10 μg) as antigens in coating buffer (0.1 M NaHC03, pH 8.2) were coated onto microtiter plates (Nunc Immuno Maxsorp, Roskilde, Denmark) overnight at 4°C. The control was 0.1 M NaHC03(pH 8.2). After blocking with 2% milk in phosphate buffered saline (PBS) for 2 hours and incubation with phage displayed sdAbs in PBS for 1 hour at room temperature, specific phage were eluted using 100 mM triethylamine, transferred to a fresh tube, immediately neutralised with 1.0 M Tris-HCl (pH 7.4) and used to infect TG1 cells. This process represents one round of panning. Then, a portion of the TG1 cell sample was plated at various dilutions (ranging from 10 -1 to 10 -7 ) while the rest of the culture was superinfected with helper phage M13. The resulting phage particles were used for the next round of panning. Protein specific phage were gradually enriched during two to three rounds of panning.

[0088] Periplasmic extract ELISA - To detect antigen-specific clones, 192 clones were randomly selected for periplasmic extract ELISA. After the cells were disrupted by osmotic shock and a centrifugation step to provide the periplasmic extract, the VHH antibodies reside in the supernatant, the VHH antibodies were incubated with the antigen coated in a microtiter plate. Each clone was cultured in 1 mL LB medium containing 100 pg / mL ampicillin, then the expression of VHH was induced by 1 mM isopropyl beta-d-l-thiogalactopyranoside (IPTG). The cells were collected and resuspended in 200 pL TES (0.5 M sucrose, 0.2 M Tris-HCl pH 8.0, 0.5 mM EDTA) for 30 min at 4 °C, and 300 pL cold TES / 4 was added for 30 min. The supernatant was transferred to the wells of a microtiter plate containing coated antigen (1 pg / mL). After 1 hour, mouse anti-HIS tag antibody diluted 1 / 1,000 in PBS (Thermo Fisher Scientific, USA) was added, and the samples were left for 1 hour. Then anti-mouse IgG-HRP (Sigma-Aldrich, USA, St. Louis) was diluted 1 / 2,000 in PBS, and the samples were left for 1 hour. After washing with PBST (PBS containing 0.05% Tween 20) and adding the color development solution ABTS (Sigma-Aldrich, USA, St. Louis, MO), the absorbance was measured at 405 nm using an ELISA reader.

[0089] Immune results - To verify the immune response, the serum was analyzed before injection, 28 days later, and 3 days after the last injection. The results are shown in Table 1 and indicate the immune response generated against each of the PFAS compounds. Table 1: Analysis of serum immune response

[0090] Results - Construction of the immune phage display library - VHH sequences were amplified from the cDNA of the lymphocytes of the camel. First, RNA was extracted from the lymphocytes obtained from the blood collected (A). Two PCR products were amplified using primers CALL001 and CALL002, including a 900 bp fragment for the VH-CH1-CH2 exon and a 600 bp fragment for the VHH-CH2 exon (B). Using the 600 bp PCR fragment as a template, the gene of the VHH domain of about 400 bp was amplified using the nested primers PMCF, BACK-1 and BACK-2 (C). Figure 1 A). Two PCR products were amplified using primers CALL001 and CALL002, including a 900 bp fragment for the VH-CH1-CH2 exon and a 600 bp fragment for the VHH-CH2 exon (B). Using the 600 bp PCR fragment as a template, the gene of the VHH domain of about 400 bp was amplified using the nested primers PMCF, BACK-1 and BACK-2 (C). Figure 1 A). Two PCR products were amplified using primers CALL001 and CALL002, including a 900 bp fragment for the VH-CH1-CH2 exon and a 600 bp fragment for the VHH-CH2 exon (B). Using the 600 bp PCR fragment as a template, the gene of the VHH domain of about 400 bp was amplified using the nested primers PMCF, BACK-1 and BACK-2 (C). Figure 1 A). Two PCR products were amplified using primers CALL001 and CALL002, including a 900 bp fragment for the VH-CH1-CH2 exon and a 600 bp fragment for the VHH-CH2 exon (B). Using the 600 bp PCR fragment as a template, the gene of the VHH domain of about 400 bp was amplified using the nested primers PMCF, BACK-1 and BACK-2 (C).

[0091] For library construction, two restriction enzymes, Pstl and Notl, were introduced to the 5' and 3' end of the final VHH PCR fragment, respectively. A total of 1 pg of purified VHH PCR product and 3 pg of linearized vector were used for ligation. A total of 25 electroporations were performed to transform the ligation mixture into bacterial cells and a high quality library with high diversity was expected. The size of the constructed library was calculated from the number of individual colonies on the plate and showed to reach 7 x 10 8 colonies. Colony PCR analysis of 19 randomly picked colonies revealed plasmids with VHH inserts to 95%( Figure 2 ). Sequencing of these clones showed that the VHH fragments had unique sequences. These results demonstrated the successful construction of the phage display library.

[0092] The VHH library generated from PFOA included 1.5 x 10 7 colonies. The VHH library generated from PFOS included 1.0 x 10 7 colonies. The VHH library generated from PFNA included 1.2 x 10 4 colonies. The VHH library generated from PFBS included 1.5 x 10 7 colonies. The VHH library generated from PFHxS included 5.0 x 10 6 colonies. The VHH library generated from GenX included 2.0 x 10 6 colonies.

[0093] Biopanning was performed to isolate VHHs against the inactivated proteins. A total of about 2 x 10 11 bacteriophage particles from the library were used for panning. After three rounds of biopanning, 192 colonies were randomly picked and tested to determine if ELISA would reveal the presence of VHHs that bound to PFAS compounds.

[0094] ELISA results - The ELISA results identified VHH antibody groups that bound to PFAS compounds. The amino acid sequences of the VHH antibodies are shown in Tables 2-7, where the VHH antibody name and sequence identifier are listed. The DNA sequences encoding the VHH antibodies are shown in Tables 8-13. The CDR sequences of the VHH antibodies are listed in Tables 14-19. Table 2: Amino acid sequences of antibodies generated against PFNA Table 3: Amino acid sequences of antibodies generated against PFOS Table 4: Amino acid sequences of antibodies generated against PFBS Table 5: Amino acid sequence of antibodies raised against PFOA Table 6: Amino acid sequence of antibodies raised against PFHxS Table 7: Amino acid sequence of antibodies raised against GenX Table 8: DNA sequence encoding antibodies raised against PFNA Table 9: DNA sequence encoding antibodies raised against PFOS Table 10: DNA sequence encoding antibodies raised against PFBS Table 11: DNA sequence encoding antibodies raised against PFOA Table 12: DNA sequence encoding antibodies raised against PFHxS Table 13: DNA sequence encoding antibodies raised against GenX Table 14: CDR sequences of antibodies raised against PFNA Table 15: CDR sequences of antibodies raised against PFOS Table 16: CDR sequences of antibodies raised against PFBS Antibody Name CDR Number CDR Sequence SEQ ID NO: PFBS V1 CDR1 EFTWETDQMA 55 PFBS V1 CDR2 RIGGGALQLRT 56 PFBS V1 CDR3 GPSSTWDIGAYRY 57 PFBS V1 CDR4 DNAKNM 58 PFBS V3 CDR1 TYRYCTYDMT 79 PFBS V3 CDR2 IIDRAGSTT 80 PFBS V3 CDR3 RPPVLGIYCHGEVAMWNY 81 PFBS V3 CDR4 DNAKNT 59 PFBS V2 CDR1 EFTWETDQMA 55 PFBS V2 CDR2 RIGGGVLQLRT 56 PFBS V2 CDR3 GPSSTWDIGAYRY 57 PFBS V2 CDR4 DNAKNM 58 Table 17: CDR sequences of antibodies raised against PFOA Table 18: CDR sequences of antibodies raised against PFHxS Antibody Name CDR Number CDR Sequence SEQ ID NO: PFHxS V1 CDR1 GITSGANYMG 96 PFHxS V1 CDR2 VIHFGSGTTY 97 PFHxS V1 CDR3 GLVGGGTWSCGYNY 98 PFHxS V1 CDR4 DNAKDT 99 PFHxS V2 CDR1 GDRNCKYDMS 100 PFHxS V2 CDR2 VIDNDGRSR 101 PFHxS V2 CDR3 GYPDYSLLLGTPGYDF 102 PFHxS V2 CDR4 DNAKST 103 PFHxS V3 CDR1 GHFHRTYCMG 104 PFHxS V3 CDR2 SIFSDGSSTY 105 PFHxS V3 CDR3 ETRIDLCNEGSFFTTARY 106 PFHxS V3 CDR4 DNAKNT 59 PFHxS V4 CDR1 GFTFTNYYMY 107 PFHxS V4 CDR2 TINFDGSNTG 108 PFHxS V4 CDR3 DDVGGE 109 PFHxS V4 CDR4 DNAKNT 59 PFHxS V5 CDR1 GYTNTKDYIG 110 PFHxS V5 CDR2 LFFTDDGTAW 111 PFHxS V5 CDR3 NTVGSWSWPLVPTDFHF 112 PFHxS V5 CDR4 DRFALA 113 PFHxS V6 CDR1 GFTFDNYAMG 114 PFHxS V6 CDR2 TINSEGKTS 115 PFHxS V6 CDR3 GRSPSVLVTTDPP 116 PFHxS V6 CDR4 DNARNT 74 Table 19: CDR sequences of antibodies raised against GenX Antibody Name CDR Number CDR Sequence SEQ ID NO: GenX V1 CDR1 EFTWETDQMA 55 GenX V1 CDR2 RIGGGVLQLRT 56 GenX V1 CDR3 GPSSTWDIGAYRH 117 GenX V1 CDR4 DNAKNM 58 GenX V3 CDR1 EFTWETDQMA 55 GenX V3 CDR2 RIGGGVLQLRT 56 GenX V3 CDR3 GPSSTWDIGAYRY 57 GenX V3 CDR4 DNAKNM 58 GenX V2 CDR1 EFTWETDQMA 55 GenX V2 CDR2 RIGGGVLQLRT 56 GenX V2 CDR3 GPSSTWDIGAYRY 57 GenX V2 CDR4 DNAKNM 58

[0095] In the CDR sequences, the CDR1 sequences range in length from 9 to 21 amino acid residues, the CDR2 sequences range in length from 8 to 11 amino acid residues, and the CDR3 sequences range in length from 6 to 18 amino acid residues. In the CDR sequences, the CDR1 sequence EFTWETDQMA (SEQ ID NO: 55), the CDR2 sequence RIGGGVLQLRT (SEQ ID NO: 56), and the CDR3 sequence GPSSTWDIGAYRY (SEQ ID NO: 57) together appear in 11 different antibodies raised against four different PFAS compounds.

[0096] The following summarizes the characteristics of the length and location of the three main CDR sequences (CDR1, CDR2, and CDR3) of the VHH antibody set of SEQ ID NOs: 1-27. This information was obtained based on an analysis workflow developed by Wilton et al. (ACS Synth. Biol. 2018, 7(11), 2480-2484, incorporated by reference herein in its entirety).

[0097] CDR1 has a starting position that includes the first cysteine residue, followed by three unspecified residues, which has a sequence of 6 to 15 residues in length that includes cysteine, followed by a tryptophan residue. CDR2 starts 10 to 20 residues after the end of CDR1, with residues selected from isoleucine, leucine, valine, and methionine, followed by a residue selected from glycine, alanine, and serine, which is 8 to 15 residues in length, and followed by a residue selected from tyrosine, phenylalanine, isoleucine, leucine, threonine, asparagine, serine, valine, and histidine, followed by three unspecified residues, followed by a residue selected from alanine, isoleucine, leucine, methionine, and valine, followed by a residue selected from glutamine, lysine, arginine, alanine, glutamic acid, glycine, leucine, and threonine. CDR3 starts 30 to 50 residues after the end of CDR2, with a sequence that starts with a cysteine residue, followed by two unspecified residues, which is 3 to 25 residues in length, and followed by a residue selected from tryptophan, alanine, glutamic acid, phenylalanine, histidine, lysine, leucine, glutamine, tyrosine, glycine, serine, or arginine, followed by a residue selected from glycine or serine; followed by unspecified residues, followed by glycine, followed by three unspecified residues, followed by a residue selected from threonine, valine, or serine.

[0098] It was determined that certain VHH antibodies bind to more than one of the PFAS compounds among the VHH antibodies having the amino acid sequences of SEQ ID NOs: 1-27. Table 20 lists each of the 27 VHH antibodies and indicates the confirmed binding of each antibody to a single PFAS compound. Notably, antibodies PFNA V1 (SEQ ID NO: 1), PFNA V3 (SEQ ID NO: 3), PFBS V2 (SEQ ID NO: 13), PFOA V1 (SEQ ID NO: 15), PFOA V2 (SEQ ID NO: 14), PFOA V3 (SEQ ID NO: 16), PFOA V5 (SEQ ID NO: 17), and PFHxS V5 (SEQ ID NO: 23) each bind to more than one of the PFAS compounds among PFNA, PFOS, PFBS, PFOA, PFHxS, and GenX. Table 20: Antibody Binding to PFAS Compounds

[0099] One or more of the VHH antibodies that bind to more than one PFAS compound can be used for inclusion in a broad PFAS compound investigation kit configured for use with the detection systems described herein, while the remaining VHH antibodies can be used to confirm the specific presence of a particular PFAS compound. Example 2: Confirmation of binding of anti-PFNA antibodies to PFNA in an ELISA assay

[0100] PFNA solutions dissolved in methanol or DMSO were diluted in 100 mM carbonate buffer (NaHC03 12.5 mM, Na2C03 87.5 mM) at pH 10.2 to make solutions at a final concentration of 20 pg / mL. These solutions were used to coat 96-well flat-bottom MaxiSorp TM to provide Nunc-Immuno plates with immobilized PFNA. After coating and after each subsequent step, the plates were washed three times using 0.01 M phosphate-buffered saline (PBS, 138 mM NaCl, 2.7 mM KCl, pH 7.4) containing 0.05% Tween 20 (PBST). Unbound sites on the plates were blocked using 5% skimmed milk prepared in PBS. Affinity-purified VHHs diluted in PBS or in LB medium containing PBS (final concentration of 28%) were then added to the wells and incubated for two hours. This was followed by peroxidase-conjugated affinity-purified anti-hemagglutinin IgG diluted 1:10,000 in 2.5% skimmed milk in PBS. One hundred microliters of 3,3',5,5'-tetramethylbenzidine (TMB) substrate (routine peroxidase substrate) was then added for 3 minutes, followed by an equal amount of 2% HC1 to stop the reaction and stop the color development produced by peroxidase activity. The plates were read in a spectrophotometric ELISA plate reader at 450 nm, showing values as the average of duplicate wells. Binding data for VHH antibody PFNA V2 are shown in FIG. 2. The results show that antibody PFNA V2 binds to PFNA at a higher level for methanol-dissolved PFNA-coated plates. In contrast, controls measured in the absence of VHH antibody, in the absence of PFAS compound, and in the absence of both do not show significant absorbance at 450 nm. Figure 3A and Figure 3B The results show that antibody PFNA V2 binds to PFNA at a higher level for methanol-dissolved PFNA-coated plates. In contrast, controls measured in the absence of VHH antibody, in the absence of PFAS compound, and in the absence of both do not show significant absorbance at 450 nm.

[0101] This example demonstrates the use of antibodies raised against PFAS compounds as a basis for biosensors for the detection of PFAS compounds. Example 3: Competitive ELISA detection of PFOA and PFNA

[0102] This embodiment describes a competitive ELISA system with PFAS compounds directly adsorbed onto the surface of an ELISA plate, competing with free PFAS compounds in the sample to be analyzed. During the assay, if a His-labeled VHH antibody binds to the PFAS compound adsorbed on the plate, and a secondary anti-His IgG HRP-linked antibody binds to the His-labeled VHH, the resulting antibody complex will remain immobilized during the plate washing step to remove unbound components from the plate. The addition of a peroxidase substrate will generate an absorbance signal from the reaction of the peroxidase with the substrate. The absorbance decreases when free PFAS compounds in solution compete with the VHH antibody for binding to the immobilized PFAS compound.

[0103] PFNA dissolved in methanol and diluted to a final concentration of 10 or 50 μg / mL in 100 mM carbonate buffer (12.5 mM NaHCO3, 87.5 mM Na2CO3, pH 8.2) was used to prepare a 96-well flat-bottom MaxiSorp array. TM Nunc-Immuno TM The plates were coated. After coating, and after each subsequent step, the plates were washed three times with PBS (138 mM NaCl, 2.7 mM KCl, 2.7 mM, pH 7.4) containing 0.05% Tween 20 (PBST). Unbound sites on the plates were blocked using 2% skim milk prepared in PBS. Then, affinity-purified His-labeled VHH (PFNA V2) diluted in PBS (final concentration 135 nM) and test samples containing different concentrations of PFOA or PFNA were added to the wells and incubated for 2 hours. Affinity-purified anti-His IgG antibody diluted 1:400 in PBS was then added and incubated for 1 hour at room temperature; followed by peroxidase-conjugated anti-mouse IgG HRP at a final concentration of 1:500. Then, 100 μL of ABTS with hydrogen peroxide substrate was added and incubated for 90 minutes. The plates were read at 415 nm using an EIA microplate reader. Results were... Figure 4 As shown, the values ​​are averages from replicate wells. The decrease in absorbance observed at higher concentrations of PFAS compounds provides an indication of the concentration of free PFAS in the sample. Example 4: Generation and selection of VHH antibodies recognizing PFOA using an alternative ELISA method

[0104] Improved streptavidin-biotin VHH ELISA - A second set of VHH antibodies against PFOA were generated according to the methods outlined in Example 1, with the difference being that the assay was performed using an improved ELISA as described below. The improved ELISA was developed because the inventors recognized that the ELISA system described in Example 1 above, which has PFAS molecules adsorbed directly to the surface of the ELISA assay plate, can not be robust enough for incorporation into a biosensor system, and that an assay improvement should be investigated. In a first alternative competitive ELISA assay using a streptavidin-biotin interaction, the ELISA assay plate was coated with streptavidin, and PFOA was conjugated to biotin via an 11-mer of polyethylene glycol (PEG11) to provide a conjugate named “biotin-PEG11-PFOA”. The addition of the biotin-PEG11-PFOA conjugate to the streptavidin-coated plate provided an increased stability of the immobilized PFOA for the competitive ELISA, where free PFOA (or other PFAS compounds in the analyzed sample) would compete with the immobilized PFOA. In this ELISA, a hexahistidine tag was conjugated to the VHH antibody to provide a His-tagged VHH antibody. The His tag provided a recognition site for an anti-His IgG secondary antibody, which in turn was recognized by a tertiary anti-IgG antibody conjugated to horseradish peroxidase (the tertiary anti-IgG antibody was provided to enhance the signal due to additional sites of binding to the anti-His secondary antibody). During the assay, if the His-tagged VHH antibody binds to the immobilized PFOA, and the secondary and tertiary antibodies bind to the His-tagged VHH, then the complete antibody complex will remain immobilized during the plate washing steps to remove unbound components from the plate. The addition of the peroxidase substrate will produce an absorbance signal from the reaction of the peroxidase with the substrate. When testing an aqueous sample suspected of containing PFOA, the sample is added to the ELISA plate along with the bound antibody complex. Free PFOA compounds compete with the bound PFOA for binding to the His-tagged VHH. After washing the plate to remove unbound components, including His-tagged VHH bound to free PFOA, the decrease in absorbance is measured, which correlates to the concentration of PFOA in the sample.

[0105] In this competitive ELISA, streptavidin was used at a final concentration of 10 pg / mL diluted in 100 mM carbonate buffer (12.5 mM NaHC03 12.5 mM, Na2C087.5 mM, pH 8.2) to coat the 96-well flat bottom MaxiSorp plates (Nunc, Cat# 439454) overnight at 4°C. The plates were washed with 1x PBS-T (1x PBS with 0.05% Tween-20) and blocked with 1x PBS-T with 1% BSA (Sigma-Aldrich, Cat# A7976) for 1 hour at room temperature. The plates were washed with 1x PBS-T and the biotin-PEG11-PFOA conjugate was added to the plates at a final concentration of 10 ng / mL in 1x PBS-T with 1% BSA. The plates were incubated for 1 hour at room temperature. The plates were washed with 1x PBS-T and the His-tagged VHH antibody was added to the plates at a final concentration of 10 ng / mL in 1x PBS-T with 1% BSA. The plates were incubated for 1 hour at room temperature. The plates were washed with 1x PBS-T and the anti-His IgG secondary antibody was added to the plates at a final concentration of 1 pg / mL in 1x PBS-T with 1% BSA. The plates were incubated for 1 hour at room temperature. The plates were washed with 1x PBS-T and the tertiary anti-IgG antibody conjugated to horseradish peroxidase was added to the plates at a final concentration of 1 pg / mL in 1x PBS-T with 1% BSA. The plates were incubated for 1 hour at room temperature. The plates were washed with 1x PBS-T and the peroxidase substrate was added to the plates. The plates were incubated for 10 minutes at room temperature. The plates were read at 450 nm and the absorbance signal was recorded. TM Nunc-Immuno TMThe plates were coated. After coating, and after each subsequent step, the plates were washed three times with PBS (138 mM NaCl, 2.7 mM KCl 2.7, pH 7.4). Unbound sites on the plates were blocked with 0.1% sodium caseinate salt prepared in protein-free buffer (PFB, Cat. No: 37572) for 1 hour. Biotin-PEG11-PFOA diluted in PBS at a final concentration of 200 ppm at pH 7.4 was then added to the wells and incubated for 16 hours at room temperature. Five samples of affinity purified VHHs (at a final concentration of 200 nM) diluted in PBS with different concentrations of biotin-PEG11-PFOA (used as an experimental surrogate for free PFOA) were then added to the wells and the plates were incubated for two hours. Affinity purified anti-His IgG diluted 1:500 in PBS was then added and incubated for 1 hour at room temperature. This was followed by a step of adding peroxidase-conjugated anti-mouse IgG HRP at a final concentration of 1:1000. 100 μL of ABTS and hydrogen peroxide (1:1000) substrate were then added and the plates were incubated for 30 minutes. The plates were read in an EIA plate reader at 410 nm, showing values as the average of duplicate wells. The results of the test analysis of the 5 samples with different concentrations of biotin-PEG11-PFOA are shown in Figure 5 Figure 6, where it can be seen that the absorbance at 410 nm decreases as the concentration of biotin-PEG11-PFOA in the test sample increases.

[0106] ELISA results - The ELISA results identified four VHH antibody groups that bound to PFOA. The amino acid sequences of the VHH antibodies are shown in Table 21, where the VHH antibody name and sequence identifier are listed. The DNA sequences encoding the VHH antibodies are shown in Table 22. The CDR sequences of the VHH antibodies are listed in Table 23. Table 21: Amino acid sequences of the second antibody group Table 22: DNA sequences encoding the second antibody group Table 23: CDR sequences of the second antibody group Example 5: Testing of the complete set of VHH antibodies for binding in a direct type ELISA

[0107] In this experiment, the binding capacity of a complete set of VHH antibodies (including a first set of 27 VHH antibodies and a second set of 4 VHH antibodies) to biotin-PEG11-PFOA was tested in a direct ELISA system. Since there was no competition with free PFAS in this experiment, an increase in absorbance was measured to indicate efficient binding of a given VHH antibody. Streptavidin was diluted to a final concentration of 10 μg / mL in 100 mM carbonate buffer (12.5 mM NaHCO3, 87.5 mM, pH 8.2) against a set of 96-well flat-bottom MaxiSorp... TM Nunc-Immuno TM The plates were coated. After coating, and after each subsequent step, the plates were washed three times with PBS (138 mM NaCl, 2.7 mM KCl, pH 7.4). Unbound sites on the plates were blocked for 1 hour using 0.1% sodium caseinate prepared in protein-free buffer (PFB, catalog number: 37572). Biotin-PEG11-PFOA diluted to a final concentration of 0 or 200 ppm in PBS at pH 7.4 was then added to the wells and incubated at room temperature for 16 hours. Affinity-purified VHH diluted in PBS (final concentration 200 nM) was then added to the wells and incubated for 2 hours. Subsequently, affinity-purified anti-His IgG antibody diluted 1:500 in PBS was added and incubated at room temperature; followed by peroxidase-conjugated anti-mouse IgGHRP at a final concentration of 1:1000. Then add 100 μL of ABTS containing hydrogen peroxide (1:1000) substrate, and incubate the plate for 30 minutes. Read the plate at 410 nm using an EIA microplate reader. Figures 6 to 10 The values ​​shown in the bar chart are the average values ​​of at least the repeated holes. Figure 10 This paper presents a comparison of 10 VHH antibodies that exhibit the most efficient binding to immobilized PFOA in direct ELISA. Figure 11 This paper presents a comparison of three VHH antibodies that exhibit the most efficient binding to immobilized PFOA in direct ELISA.

[0108] The results of this experiment indicate that the most effective antibodies for binding to PFOA in this direct ELISA assay are PFNA V2 (SEQ ID NO:2), PFOA V5 (SEQ ID NO:17), and BPL3 (SEQ ID NO:125), as assessed by increasing absorbance from baseline to 200 ppm PFAS. Other antibodies demonstrating favorable binding properties to PFOA are PFNA V7 (SEQ ID NO:7), PFHxSV3 (SEQ ID NO:21), and PFHXSV6 (SEQ ID NO:24). Example 6: Cyclodextrin improved competitive ELISA

[0109] PFAS compounds are generally known to have limited solubility, and cyclodextrins can be used to isolate PFAS compounds. The inventors conceived of an improved competitive ELISA using biotin-PEG11-PFOA, which incorporates cyclodextrin to bind to free PFAS compounds in solution, thereby improving their solubility and increasing the ability of VHH antibodies to detect PFAS compounds in the ELISA. β-cyclodextrin was selected for this improved assay. It was determined that in the absence of free PFOA, cyclodextrin binds to immobilized PFOA and blocks the binding of His-labeled VHH antibodies to immobilized PFAS. After washing, due to the lack of formation of a tertiary antibody complex, there was no detectable amount of immobilized VHH antibody in the peroxidase reaction, and the absorbance level at 410 nm was low. When the test solution contains increasingly higher concentrations of free PFAS, the cyclodextrin in the solution will bind to the free PFAS molecules in the solution. This results in fewer immobilized PFOA sites for cyclodextrin binding and more binding of His-labeled VHH antibodies, which in turn leads to the formation of a larger amount of detectable tertiary antibody complexes, with increased absorbance measured at 410 nm.

[0110] In an experiment studying three VHH antibodies that were identified as most effective at binding to immobilized PFOA in a direct ELISA assay described in Example 5, a cyclodextrin-modified competitive ELISA was performed on BPL3, PFNA V2, and PFOA V5 at PFOA concentrations ranging from less than 0.1 ppm to 1000 ppm. Streptavidin diluted to a final concentration of 10 μg / mL in 100 mM carbonate buffer (12.5 mM NaHCO3, 87.5 mM Na2CO3 mM, pH 8.2) was used on a 96-well flat-bottom MaxiSorp array. TM Nunc-Immuno TMThe plates were coated. After coating, and after each subsequent step, the plates were washed three times with PBS (138 mM NaCl, 12.7 mM KCl 2.7 nM, pH 7.4). Unbound sites on the plates were blocked for 1 hour using 0.1% sodium caseinate prepared in protein-free buffer (PFB, catalog number: 37572). Biotin-PEG11-PFOA diluted in PBS at pH 7.4 was then added to the wells to a final concentration of 200 ppm, followed by incubation at room temperature for 16 hours. Different concentrations of free PFOA from a stock solution diluted in methanol were then added to a competitive solution comprising affinity-purified VHH (final concentration 200 nM) diluted in 0.5X PBS and 1.4 ppm β-cyclodextrin, followed by incubation for 2 hours. Next, affinity-purified anti-HIS IgG antibody diluted 1:500 in PBS was added, and the mixture was incubated at room temperature for 1 hour. Then, peroxidase-conjugated anti-mouse IgGHRP was added to a final concentration of 1:1000. Then, 100 μL of ABTS with hydrogen peroxide (1:1000) substrate was added and incubated for 30 minutes. The plate was read at 410 nm using an EIA microplate reader, and the values ​​shown are the average values ​​of the replicate wells.

[0111] The results of this experiment are as follows: Figure 12 As shown in [the image]. Figure 12 EC50 of each of the three antibodies shown above 10 and EC 05 The values ​​indicate that 10% and 5% showed significant improvement relative to baseline concentrations. VHH antibody BPL3 exhibited the best detection sensitivity, with its EC50 values... 10 =13.47ppm and EC 05 =6.79ppm. VHH antibody PFNA V2 has the second best detection sensitivity, with an EC50 of 6.79ppm. 10 =22.07ppm and EC 05 =14.84ppm. The remaining VHH antibody PFOA V5 has EC 10 =35.60ppm and EC 05 =20.24 ppm. All three VHH antibodies are suitable for use in PFAS detection systems.

[0112] A noteworthy observation is that, in terms of the absorbance difference between 0 ppm and 200 ppm measurements in direct ELISA, VHH antibody BPL3 showed a greater difference compared to PFNA V2 and PFOA V5. Figure 11 The study did not provide optimal data. However, BPL3 has advantages over competing ELISA results. Figure 12The best standard curve in the set of BPL3, BPL2, BPL4, and PBL1 (SEQ ID NOs: 127-130) was used to determine the concentration of PFAS in the sample. Thus, although BPL3 currently appears to be the most effective VHH antibody for PFAS binding in view of the current data, further testing of the other VHH antibodies can reveal that other VHH antibodies disclosed herein can be even more effective at binding free PFAS molecules in a competitive cyclodextrin ELISA and provide a basis for a biosensor for detecting PFAS molecules in a sample. Thus, it should be understood that any of the 31 VHH antibodies disclosed herein will likely be found suitable for incorporation into a PFAS detection system. Moreover, based on the results of the first set of VHH antibodies described above, it can be reasonably predicted that the second set of VHH antibodies (BPL1, PBL2, BPL3, and PBL4; (SEQ ID NOs: 127-130) will be found to have the ability to bind to PFAS compounds other than PFOA with sufficient affinity to use them to detect other PFAS compounds. EQUIVALENTS AND EXTENSIONS

[0113] While various embodiments of the present disclosure have been shown and described in the present disclosure, one skilled in the art will readily devise many other variations of these specific embodiments without departing from the scope of the embodiments disclosed herein and the scope of the appended claims.

[0114] One skilled in the art will recognize or be able to ascertain using not more than routine experimentation many equivalents of the specific embodiments described herein. The scope of the present disclosure is not intended to be limited to the above description but is instead meant to encompass any variations within the scope of the appended claims.

[0115] In the claims, articles such as “a,” “an,” and “the” can mean one or more than one unless indicated otherwise or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group of members imply many alternatives (e.g., ANDing) of individual members of the group. When used in the claims, the terms “comprises,” “comprising,” “includes,” “including” or “has,” “having” or the like are used in the sense of “including” and not of “consisting only of.” The disclosure includes embodiments in which one, more, or all of the members of a group of members are present in, are used in, or are otherwise associated with a given product or method. The disclosure includes embodiments in which one, more, or all of the members of a group of members are present in, are used in, or are otherwise associated with a given product or method.

[0116] It is also noted that the terms "comprising", "including", "containing", "have" and "including" when used herein, are meant to be open-ended and allow for the possibility that there are additional elements or steps. When the term "comprising" is used, also "consisting of" and / or "including" are encompassed and disclosed.

[0117] Where a range is given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from context and understanding by those of ordinary skill in the art, values denoted as ranges can assume any particular value or sub-range within the range as the different embodiments of the disclosure can assume units of one-tenth of the lower limit of the range unless the context clearly dictates otherwise.

[0118] Furthermore, it is to be understood that any particular embodiment of the disclosure falling within the prior art can be expressly excluded from any one or more of the claims. As such embodiments are considered known to those of ordinary skill in the art, they can be excluded even if not expressly stated herein. Any particular embodiment of the compositions disclosed herein can be excluded from any one or more of the claims for any reason, whether or not related to the existence of prior art.

[0119] All cited sources, such as references, publications, databases, database entries, and techniques cited herein, are incorporated by reference into this application, even if the cited sources are not explicitly stated to be incorporated by reference. In the event of a conflict between the cited sources and the statements made in this application, the statements in this application control.

Claims

1. An antibody or antibody fragment binding to perfluorooctanoic acid (PFOA), said antibody or antibody fragment comprising: The CDR1 amino acid sequence has at least about 80% sequence identity with SEQ ID NO:139; The CDR2 amino acid sequence, wherein the CDR2 amino acid sequence has at least about 80% sequence identity with SEQ ID NO:140; and The CDR3 amino acid sequence has at least about 80% sequence identity with SEQ ID NO:

141.

2. The antibody according to claim 1, wherein the antibody comprises a CDR4 amino acid sequence having at least about 80% sequence identity with a sequence selected from the group consisting of SEQ ID NO:

142.

3. The antibody or antibody fragment according to claim 1 or 2, wherein the antibody or antibody fragment comprises a VHH antibody sequence having at least about 80% sequence identity with SEQ ID NO:

129.

4. The antibody or antibody fragment according to any one of claims 1 to 3, wherein the antibody or antibody fragment is bound to one or more additional PFAS compounds selected from the group consisting of PFNA, PFOS, PFBS, PFHxS and GenX.

5. The antibody or antibody fragment according to any one of claims 1 to 4, wherein the antibody or antibody fragment comprises one or more variants of one or more of the described CDR, wherein the one or more variants comprise one or more substitutions of hydrophobic residues for hydrophilic amino acid residues, and the antibody or antibody fragment comprising the one or more variants exhibits greater binding affinity to PFAS compounds.

6. The isolated nucleic acid sequence encoding the antibody according to any one of claims 1 to 5.

7. The isolated nucleic acid sequence according to claim 6, wherein the isolated nucleic acid sequence has the sequence of SEQ ID NO:

129.

8. A cell or virus comprising the isolated nucleic acid sequence according to claim 6 or 7.

9. A detector system for recognizing PFAS compounds, said detector system comprising an antibody or antibody fragment according to any one of claims 1 to 8.

10. The detector system of claim 9, wherein the PFAS compound binds to the antibody or antibody fragment in the ELISA assay.

11. The detector system of claim 10, wherein the ELISA assay is a direct ELISA or a competitive ELISA.

12. The detector system of claim 10 or 11, wherein the ELISA assay is configured to detect free PFAS compounds in an aqueous sample.

13. The detector system of claim 12, wherein the free PFAS compound comprises one or more PFAS compounds selected from the group consisting of PFOA, PFNA, PFOS, PFBS, PFHxS, and GenX.

14. The detector system according to any one of claims 11 to 13, wherein the ELISA assay comprises an immobilized PFAS compound.

15. The detector system of claim 14, wherein the immobilized PFAS compound is immobilized using a biotin-streptavidin interaction.

16. The detector system of claim 15, wherein the competitive ELISA comprises binding to a PFAS molecule conjugated to the biotin moiety.

17. The detector system of claim 16, the detector system comprising a detection plate coated with streptavidin, wherein the PFAS molecule conjugated to the biotin moiety provides an immobilized PFAS compound when the biotin moiety binds to streptavidin.

18. The detector system according to any one of claims 12 to 17, wherein the VHH antibody comprises an affinity tag, and a secondary antibody binds to the affinity tag.

19. The detector system of claim 18, wherein the detector system comprises a tertiary antibody conjugated to a peroxidase, wherein the tertiary antibody binds to the secondary antibody to provide a detectable antibody complex via a peroxidase substrate reaction.

20. The detector system according to any one of claims 12 to 19, wherein the competitive ELISA comprises a cyclodextrin bound to a free PFAS compound and an immobilized PFAS compound.

Images