Cone cell specific promoter and use thereof
By using specific nucleic acid sequences to drive gene expression in cone cells, the problems of specificity and efficiency of gene expression in cone cells have been solved, achieving effective treatment of hereditary retinal diseases and restoring some vision.
Patent Information
- Application Number
- CN202580000985.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-06-20
- Filing Date
- 2025-06-17
- Publication Date
- 2025-11-21
AI Technical Summary
Existing technologies struggle to achieve specific and efficient gene expression in cone cells, limiting treatment strategies for hereditary retinal diseases.
A nucleic acid comprising a nucleotide sequence having at least 50% identity with any one of the nucleotide sequences in SEQ ID NO:1-9 is provided for specifically driving high levels of gene expression in cone cells, and the nucleic acid is delivered via a viral vector such as an AAV vector to achieve cone cell-specific expression.
This technology enables efficient gene expression in cone cells, providing a new treatment strategy for hereditary retinal diseases such as retinitis pigmentosa and achromatopsia, and restoring partial vision.
Smart Images

Figure HSB0000212871160000011 
Figure HSB0000212871160000021 
Figure HSB0000212871160000031
Abstract
Description
TECHNICAL FIELD
[0001] The present invention relates to a nucleic acid sequence having promoter activity in cone cells. In particular, the present invention relates to a cone cell-specific promoter and its use in medicine, in particular in the treatment of eye diseases. BACKGROUND
[0002] Inherited retinal diseases (IRDs) are among the most common genetic diseases in humans, defining a group of clinically heterogeneous diseases that lead to vision loss due to improper development, dysfunction, or premature death of retinal photoreceptor cells. Common forms of IRDs include retinitis pigmentosa (RP), cone / rod dystrophies (CD / CRD), Leber congenital amaurosis (LCA), macular dystrophy (MD), and achromatopsia (rod monochromacy), etc. IRDs are also one of the most genetically heterogeneous diseases in humans, with more than 270 associated genes identified so far. It can be inherited by autosomal recessive (AR), autosomal dominant (AD), or X-linked (XL), and mitochondrial and digenic inheritance patterns have also been reported. The pathogenesis of IRDs often occurs due to the apoptosis response of photoreceptor cells themselves due to gene mutations or the imbalance of the retinal microenvironment (such as the death of neovascularization, retinal pigment epithelial cells, etc.) exacerbating the apoptosis of photoreceptor cells. According to the pathogenesis, the treatment strategies mainly focus on (1) overexpression or gene editing to repair the associated mutant genes to delay the degeneration of photoreceptor cells; (2) inhibition of neovascularization to reduce damage to photoreceptor cells; and (3) expression of photopigments in retinal cells to perform photoreceptor function.
[0003] Cone cells are a type of photoreceptor cell located in the retina, which have a high resolution of light and color, hence also known as photoreceptors. Cone cells contain photoreceptive substances, which can undergo a series of photochemical changes and potential changes under light stimulation, causing cone cells to fire nerve impulses. Therefore, the damage to cone cells will seriously affect their photopic vision, and may further affect scotopic vision with varying degrees of damage to rod cells.
[0004] The strategy of using retinal cells to express photopigments to restore vision is currently the most popular. Photopigments include endogenous photopigments (such as opsin, rhodopsin, melanopsin, etc.) and exogenous photopigments. Studies have found that expressing endogenous photopigments or their respective fusions with metabotropic glutamate receptors mGLUR can restore partial vision in blind mice. Using exogenous photopigments, such as light-sensitive ion channel proteins (such as chr2, chrimsonR, MCO, etc.), has also achieved vision restoration in mice, and related products have reached the clinic.
[0005] Gene expression in retinal cells has been achieved by using ubiquitous promoters. Ubiquitous promoters provide a strong but unrestricted pattern of gene expression in tissues. Ubiquitous eukaryotic promoters are derived from the chicken beta-actin (CBA) gene or the promoters of phosphoglycerate kinase (PGK) or elongation factor 1 alpha (EF1 alpha). Other viral-derived ubiquitous promoters include the promoter derived from cytomegalovirus (CMV) or synthetic promoter sequences such as CAG. However, it has been demonstrated that
[0006] The regulation of CMV promoters depends on a number of cellular signaling pathways that can alter the expression of transgene. In addition, these promoters are not restricted to a given cell type and cause expression in all cells into which they are delivered, for example, retinal pigment epithelial (RPE), retina and other ocular tissues outside the retina, for example, ciliary body, iris, cornea, etc.
[0007] Gene expression restricted to retinal cells has also been achieved using tissue-specific promoters that cause expression in RPE or photoreceptor cells. Promoters such as those based on RPE65, VMD2 and OA1 cause gene expression in RPE cells, while the promoters of human (RK) or bovine (RHO) rhodopsin kinase or the promoter of mouse opsin (mOP) cause expression restricted to photoreceptor cells.
[0008] To achieve expression of photoproteins in retinal cells, such as cone cells, a promoter that specifically and efficiently expresses them is required, i.e., a cell-specific promoter. Cell-specific promoters are important elements in gene regulation that play a key role in maintaining cell specificity and tissue specificity within an organism. Promoters are regulatory regions of genes responsible for initiating the process of gene transcription, thus allowing gene expression to produce corresponding proteins. Cell-specific promoters have the ability to initiate gene expression in specific types of cells, thus allowing precise regulation of the function of genes in specific cell types.
[0009] Cell-specific promoters can serve as an important resource for gene therapy applications. Designing gene expression vectors with cell-specific promoters of varying expression strengths can achieve gene therapy and gene regulation in specific cell types. In addition, the specificity of the promoter can also be used in gene editing techniques to achieve precise editing and regulation of specific cell populations.
[0010] Therefore, the screening of cell-specific promoters is a complex and critical research work, and the results are of great significance for understanding the mechanisms of cell fate determination, the development of diseases, and especially the development of new treatment strategies. SUMMARY
[0011] The present application provides a new transcriptional promoter that can specifically drive high levels of gene expression in cone cells.
[0012] In a first aspect of the application, there is provided an isolated nucleic acid (hereinafter also referred to as a promoter) having promoter activity in cone cells and comprising a nucleotide sequence which is at least about 50% identical to a nucleotide sequence selected from any one of SEQ ID NOs: 1-9.
[0013] In one embodiment, the isolated nucleic acid comprises a nucleotide sequence which is at least about 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identical to a nucleotide sequence selected from any one of SEQ ID NOs: 1-9.
[0014] In one embodiment, the isolated nucleic acid has cone cell-specific promoter activity.
[0015] In one embodiment, the isolated nucleic acid comprises or consists of a nucleotide sequence selected from any one of SEQ ID NOs: 1-9.
[0016] In a second aspect of the application, there is provided an expression cassette comprising an isolated nucleic acid according to the first aspect of the application.
[0017] In one embodiment, the expression cassette further comprises a nucleic acid of interest operably linked to the isolated nucleic acid of the application.
[0018] In one embodiment, the nucleic acid of interest is a nucleic acid encoding a polypeptide of interest.
[0019] In one embodiment, the polypeptide of interest is a therapeutic protein, an optogenetic driver protein, or a reporter protein.
[0020] In one embodiment, the target polypeptide is a therapeutic protein, wherein the therapeutic protein can be selected from MT-ND4, MT-ND1, MT-ND6, MT-CYB, MT-CO3, MT-ND5, MT-ND2, MT-COI, MT-ATP6, MT-ND4L, OPA1, OPA3, OPA7, GUCA1A, PDE6C, GNAT2, ABCA4, RPGR, CRX, CNGA3, CNGB3 and ACO2, or can be a neurotrophic factor selected from GDNF, VEGF, CNTF, FGF2, BDNF and EPO, an anti-apoptotic protein selected from BCL2 and BCL2L1, an anti-angiogenic factor selected from endostatin, angiostatin and sFlt, an anti-inflammatory factor selected from IL10, IL1R1, TGFBI and IL4, or a retinal- derived cone cell active factor (RdCVF).
[0021] In one embodiment, the target polypeptide is a Cas9 protein.
[0022] In one embodiment, the target polypeptide is a optogenetic kinesin, wherein the optogenetic kinesin can be an optogenetic activator, which is preferably selected from a rhodopsin, a photopsin, a melanopsin, a pinealopsin, a pinealopsin, a VA opsin, a peropsin, a neuroopsin, a cerebellum opsin, a retinal pigment, a RGR opsin, a microbial opsin with red-shifted spectral properties (e.g. ReaChR, Chrimson or ChrimsonR), a vertebrate opsin that recruits Gi / o signaling (e.g. a short-wavelength vertebrate opsin or a long-wavelength vertebrate opsin), a channelrhodopsin from Chlorella microalgae (e.g. channelrhodopsin-1 and channelrhodopsin-2), and a variant of the above proteins; or an optogenetic inhibitor, which is preferably selected from a halorhodopsin (e.g. NpHR, eNpHR2.0, eNpHR3.0 and Halo57), an archaeal rhodopsin (e.g. Arch and AR-3), a bacterial rhodopsin (e.g. eBR, Proteus rhodopsin and Xanthomonas rhodopsin), a fungal opsin from Leptosphaeria discolor (Mac), a cross-species halorhodopsin from the great white shark, and a variant of the above proteins.
[0023] In one embodiment, the target polypeptide is a reporter protein, wherein the reporter protein can be selected from a fluorescent protein, a calcium indicator, an alkaline phosphatase, a beta-galactosidase, a beta-lactamase, a horseradish peroxidase, and a variant of the above proteins.
[0024] In one embodiment, the target nucleic acid encodes a nucleic acid selected from an siRNA, an shRNA, an RNAi, an miRNA, an antisense RNA, a ribozyme and a deoxyribozyme (DNAzyme).
[0025] In a third aspect of the application, a vector comprising the isolated nucleic acid according to the first aspect of the application or the expression cassette according to the second aspect of the application is provided.
[0026] In one embodiment, the vector is a viral vector.
[0027] In one embodiment, the vector is a retroviral vector or a parvovirus vector. In one embodiment, the vector is a Moloney murine leukemia virus (MoMLV), MSCV, SFFV, MPSV or SNV vector, a lentivirus vector (e.g. derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) or equine infectious anemia virus (EIAV)), an adenovirus (Ad) vector, an adeno-associated virus (AAV) vector, a simian virus 40 (SV-40) vector, a bovine papilloma virus vector, an Epstein-Barr virus vector, a herpes virus vector, a vaccinia virus vector, a Harvey murine sarcoma virus vector, a murine mammary tumor virus vector or a Rous sarcoma virus vector. In one embodiment, the vector is an adeno-associated virus (AAV) vector and can comprise two ITRs flanking the nucleic acid of interest.
[0028] In a fourth aspect of the application, a viral particle comprising the vector according to the third aspect of the application is provided.
[0029] In one embodiment, the vector is an AAV vector. In one embodiment, the viral particle further comprises an AAV-derived capsid. In one embodiment, the AAV serotype includes, but is not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74 and AAVdj. In one embodiment, the AAV serotype is preferably selected from the group consisting of AAV-2, AAV-5, AAV2-7m8, AAV-9 and AAV-8, more preferably AAV-2, AAV-8 or AAV2-7m8.
[0030] In a fifth aspect of the application, a cell comprising the isolated nucleic acid according to the first aspect of the application, the expression cassette according to the second aspect of the application, the vector according to the third aspect of the application or the viral particle according to the fourth aspect of the application is provided.
[0031] In one embodiment, the cell is a cone cell. In another embodiment, the cell is a retinal pigment epithelial cell (RPE).
[0032] In a sixth aspect of the application, there is provided a pharmaceutical composition comprising the isolated nucleic acid according to the first aspect of the application, the expression cassette according to the second aspect of the application, the vector according to the third aspect of the application, the viral particle according to the fourth aspect of the application, the cell according to the fifth aspect of the application, or the pharmaceutical composition according to the sixth aspect of the application, and a pharmaceutically acceptable excipient.
[0033] In a seventh aspect of the application, there is provided a method of treating an eye disease, comprising administering to a patient in need thereof a therapeutically effective amount of the isolated nucleic acid according to the first aspect of the application, the expression cassette according to the second aspect of the application, the vector according to the third aspect of the application, the viral particle according to the fourth aspect of the application, the cell according to the fifth aspect of the application, or the pharmaceutical composition according to the sixth aspect of the application.
[0034] In one embodiment, the nucleic acid, expression cassette, vector, viral particle, cell, or pharmaceutical composition is administered by intraocular administration. In one embodiment, the nucleic acid, expression cassette, vector, viral particle, cell, or pharmaceutical composition is administered by subretinal or intravitreal or suprachoroidal injection.
[0035] In one embodiment, the eye disease is an inherited retinal disease (IRD). In one embodiment, the eye disease is selected from the group consisting of retinitis pigmentosa (RP), age-related macular degeneration, Stargardt disease, Leber’s hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Leber’s congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best’s disease, choroideremia, tapetoretinal degeneration, and achromatopsia (rod monochromacy).
[0036] In one embodiment, the method further comprises administering to the patient at least one additional therapeutic agent. In one embodiment, the therapeutic agent includes, but is not limited to, corticosteroids, antibiotics, analgesics, immunosuppressants, trophic factors, and any combination thereof.
[0037] In an eighth aspect of the application, there is provided the use of the isolated nucleic acid according to the first aspect of the application, the expression cassette according to the second aspect of the application, the vector according to the third aspect of the application, the viral particle according to the fourth aspect of the application, the cell according to the fifth aspect of the application, or the pharmaceutical composition according to the sixth aspect of the application, in the manufacture of a medicament for the treatment of an eye disease.
[0038] In one embodiment, the medicament is administered by intraocular administration. In one embodiment, the medicament is administered by subretinal or intravitreal or suprachoroidal administration.
[0039] In one embodiment, the eye disease is an inherited retinal disease (IRD). In one embodiment, the eye disease is selected from the group consisting of retinitis pigmentosa (RP), age-related macular degeneration, Stargardt disease, Leber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best disease, choroideremia, tapetoretinal degeneration, and achromatopsia (rod monochromacy).
[0040] In one embodiment, the medicament further comprises at least one additional therapeutic agent. In one embodiment, the therapeutic agent includes, but is not limited to, corticosteroids, antibiotics, analgesics, immunosuppressants, trophic factors, and any combination thereof.
[0041] In one embodiment, the eye disease is an inherited retinal disease (IRD). In one embodiment, the eye disease is selected from the group consisting of retinitis pigmentosa (RP), age-related macular degeneration, Stargardt disease, Leber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best disease, choroideremia, tapetoretinal degeneration, and achromatopsia (rod monochromacy).
[0042] In a ninth aspect of the application, there is provided a method for expressing a polypeptide of interest or a nucleic acid of interest in a cell, comprising introducing into said cell an isolated nucleic acid according to the first aspect of the application, an expression cassette according to the second aspect of the application, a vector according to the third aspect of the application, or a viral particle according to the fourth aspect of the application. In one embodiment, the method is an in vitro method. In one embodiment, the method is an in vivo method. In one embodiment, the method is an ex vivo method. In one embodiment, the cell is a cone cell. In another embodiment, the cell is a retinal pigment epithelial cell (RPE). In yet another embodiment, the expression is specific expression in a cone cell. BRIEF DESCRIPTION OF DRAWINGS
[0043] The application will be better understood with reference to the following drawings.
[0044] Figure 1 A VB220218-1080bsm plasmid map is shown for construction of expression vectors.
[0045] Figure 2Photos showing promoter activity validation in two mice. Photos were taken at three magnifications (40x / 100x / 200x), each magnification including three photos, the first one taken at the indicated exposure time (2000ms / 1000ms / 500ms) showing the red fluorescent expression driven by the promoter; the second one a merged image of the cell expressing fluorescence (red) and immunofluorescence staining (green) (exposure times for each channel were adjusted); the third one a merged image of the cell expressing fluorescence (red), immunofluorescence staining (green) and DAPI staining (blue) (exposure times for each channel were adjusted).
[0046] Figure 3 Photos showing promoter activity validation in cynomolgus monkey. Two fields of view (A) and (B) were randomly selected and photos were taken at three magnifications (40x / 100x / 200x), each magnification including three photos, the first one taken at the indicated exposure time (500ms / 200ms / 100ms) showing the red fluorescent expression driven by the promoter; the second one taken at the indicated exposure time (500ms / 200ms / 100ms) showing the presence or absence of autofluorescence (green); the third one a merged image of the cell expressing fluorescence (red) and DAPI staining (blue) (exposure times for each channel were adjusted).
[0047] Figure 4 VB231203-1125 phu plasmid map showing the construction of the expression vector.
[0048] Figure 5 Photos showing promoter activity validation in mice. Photos were taken at a magnification (200x), the first one taken at an exposure time (2000ms) for the observation of lacZ and HA protein expression (green); the second one a merged image of the immunofluorescence staining (green) and DAPI staining (blue) (exposure times for each channel were adjusted).
[0049] Figure 6Photos showing the validation of the activity of each promoter variant A7V1, A7V2, A7V3, A7V4, A7V5, A7V6, A7V7 and A7V8 in mice. Photos were taken at two magnifications (100x / 200x), each magnification including three photos, the first one being a photo taken at the annotated exposure time (1000ms / 500ms) showing the red fluorescent expression driven by the promoter; the second one being a merged picture of the cell expressing fluorescence (red) and immunofluorescence staining (green) (exposure times for each channel were adjusted); the third one being a merged picture of the cell expressing fluorescence (red), immunofluorescence staining (green) and DAPI staining (blue) (exposure times for each channel were adjusted). DETAILED DESCRIPTION
[0050] The present inventors have identified a cone cell specific promoter. This promoter can specifically drive high level gene expression in cone cells. Using this promoter therapeutic proteins can be expressed in cone cells, providing a new therapeutic strategy to restore sight to blind patients in the clinic by similar means.
[0051] In this application, the use of the singular includes the plural, the word "one" means "at least one", and the use of "or" means "and / or", unless specifically stated otherwise. Furthermore, the terms "comprising" and "including" are open-ended terms that are intended to include both closed- and
[0052] The term "about", as used herein when used in connection with a percentage or other quantity, means all values within 10% of that percentage or other quantity. For example, "about 80%" includes all values within 8% of 80%.
[0053] All documents cited in this application, including but not limited to patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference in their entirety for any purpose. To the extent that the definition of any term in any of the incorporated documents conflicts with the definition of that term in the present application, the definition in the present application prevails.
[0054] The term "nucleic acid" or "polynucleotide" as used herein refers to a polymeric form of nucleotides of any length, which can be either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, a DNA-RNA hybrid, or a polymer comprising both purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The backbone of the polynucleotide can comprise sugars and phosphate groups, as can normally be found in RNA or DNA, or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can comprise a synthetic subunit, such as a phosphoramidate, and thus can be an oligodeoxynucleoside phosphoramidate (P-NH2) or a mixed phosphoramidatc-phosphodiester oligomer. The nucleic acids of the present application can be prepared by any technique known to one of skill in the art, including chemical synthesis, recombination, and mutation. In a preferred embodiment, the nucleic acids of the present application are DNA molecules, which are preferably synthesized by recombinant methods well known to one of skill in the art.
[0055] The term "isolated nucleic acid" as used herein refers to a nucleic acid molecule that has been identified and separated from a component of its natural environment. In particular, the term refers to a nucleic acid molecule that is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid molecule. For example, with regard to genomic DNA, the term "isolated" includes a nucleic acid molecule that is separated from the chromosome with which it is naturally associated. Preferably, an "isolated" nucleic acid molecule is free of sequences that naturally flank the nucleic acid molecule in the genome of the organism from which the nucleic acid molecule is derived.
[0056] The term "promoter" as used herein refers to a regulatory element that directs transcription of a nucleic acid to which it is operably linked. A promoter can regulate both the rate and efficiency of transcription of operably linked nucleic acids. A promoter can also be operably linked to other regulatory elements that enhance ("enhancers") or repress ("repressors") promoter-dependent transcription of a nucleic acid.
[0057] The term "promoter activity" as used herein refers to the ability of a promoter to initiate transcription of a nucleic acid operably linked thereto. Promoter activity can be measured using procedures known in the art. For example, promoter activity can be measured as the amount of transcribed mRNA using, for example, Northern blotting or the polymerase chain reaction (PCR). Alternatively, promoter activity can be measured as the amount of translated protein product, for example, by Western blotting, ELISA, colorimetric assays, and various activity assays, including reporter gene assays.
[0058] The term "operably linked" as used herein refers to the association of nucleic acid sequences on a single nucleic acid molecule such that one is influenced by the other. For example, a promoter is operably linked to a coding sequence when the promoter is capable of influencing the expression of the coding sequence, i.e., the coding sequence is under the transcriptional control of the promoter.
[0059] The terms "polypeptide" and "protein" are used interchangeably herein to refer to polymers of amino acid residues, and are not limited to a minimum length. Such polymers of amino acid residues can contain naturally occurring amino acid residues or non-naturally occurring amino acid residues, and include without limitation peptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Both full-length proteins and fragments thereof are encompassed by this definition. The term also includes post-translational modifications of the polypeptide, e.g., glycosylation, sialylation, acetylation, phosphorylation, etc. Furthermore, for purposes of the present application, "polypeptide" can refer to proteins that include modifications of the parent sequence, e.g., deletions, additions and substitutions, as long as the protein maintains the desired activity. These modifications can be deliberate, as through site-directed mutagenesis, or can be accidental, such as by mutation of the host that produces the protein or by errors caused by PCR amplification.
[0060] The term "sequence identity" or "identity" as used herein refers to the number of positions in an alignment of two polynucleotide sequences that match (identical nucleic acid residues). Sequence identity is determined by comparing the sequences when aligned so as to maximize overlap and identity while minimizing gaps between sequences. In particular, sequence identity can be determined using any of a variety of mathematical global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar length are preferably aligned using a global alignment algorithm that optimally aligns the sequences over their entire length (e.g. the Needleman and Wunsch algorithm; Needleman and Wunsch, 1970), while sequences of significantly different length are preferably aligned using a local alignment algorithm (e.g. the Smith and Waterman algorithm (Smith and Waterman, 1981) or the Altschul algorithm (Altschul et al., 1997; Altschul et al., 2005)). Alignment for determining percent nucleic acid sequence identity can be achieved using various different ways within the skill in the art, for example using publicly available computer software available at websites such as http: / / blast.ncbi.nlm.nih.gov / or http: / / www.ebi.ac.uk / Tools / emboss / . The skilled person can determine suitable parameters for measuring alignment, including any algorithm required to obtain maximum alignment over the full length of the sequences being compared. For the purposes of the present application, the percent nucleic acid sequence identity value refers to the value produced using the pairwise sequence alignment program EMBOSS Needle, which produces the optimal global alignment of two sequences using the Needleman-Wunsch algorithm, with all search parameters set to default, i.e. scoring matrix = BLOSUM62, gap opening penalty = 10, gap extension penalty = 0.5, end gap penalty = error, end gap opening penalty = 10, end gap extension penalty = 0.5.
[0061] For purposes of comparing sequence identity, the two polynucleotide sequences being aligned can comprise any proportion of reverse complement sequence segments without affecting the calculation of the percent sequence identity. For example, the two polynucleotide sequences can comprise less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% of reverse complement sequence segments. The two polynucleotide sequences can comprise 10%-90% of reverse complement sequence segments. The two polynucleotide sequences can comprise 30%-70% of reverse complement sequence segments. The two polynucleotide sequences can comprise 50%-60% of reverse complement sequence segments. The two polynucleotide sequences can comprise 100% of reverse complement sequence segments, i.e., the two polynucleotide sequences are completely reverse complement over the entire sequence. The reverse complement sequence segments can be present anywhere in the two polynucleotide sequences being aligned, e.g., starting at the 1st, 2nd, 3rd, 4th, or n-th nucleotide and ending at the m-4th, m-3rd, m-2nd, m-1st, or m-th nucleotide, where m is the length of the nucleotide sequence of the two polynucleotide sequences being aligned and n < m. There can be one or more reverse complement sequence segments in the two polynucleotide sequences being aligned, e.g., 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 reverse complement sequence segments. In one embodiment, there are 1-100 reverse complement sequence segments in the two polynucleotide sequences being aligned. The number of reverse complement sequence segments is not limited in sequence identity alignment, and the present application is intended to include two aligned polynucleotide sequences comprising any number of reverse complement sequence segments. The reverse complement sequence segments can be obtained by dot plot-based sequence alignment algorithms, e.g., publicly available computer software available at https: / / www.ebi.ac.uk / jdispatcher / emboss. Those skilled in the art will appreciate that the presence of reverse complement sequence segments in the two polynucleotide sequences being aligned does not affect the calculation of the percent sequence identity, which means that the percent sequence identity is 100% if the two polynucleotide sequences are completely reverse complement over the entire length, or if part of the sequence is reverse complement and the other sequence is identical.
[0062] The term "subject" or "patient" as used herein refers to an animal having a retina, preferably a mammal, and even more preferably a human, including adults, children, and humans at pre-natal stages.
[0063] In a first aspect, an isolated nucleic acid is provided, which has promoter activity in a cone cell and comprises a nucleotide sequence selected from any one of SEQ ID NOs: 1-9, or a nucleotide sequence having at least 50% identity to a nucleotide sequence selected from any one of SEQ ID NOs: 1-9. In one embodiment, the isolated nucleic acid consists of a nucleotide sequence selected from any one of SEQ ID NOs: 1-9, or a nucleotide sequence having at least 50% identity to a nucleotide sequence selected from any one of SEQ ID NOs: 1-9.
[0064] The nucleic acid of the application exhibits promoter activity in a cone cell, i.e. when introduced into a cone cell, it can initiate transcription of a nucleic acid operably linked thereto. Preferably, the promoter activity is cone cell specific. The term "cone cell specific" as used herein is to be interpreted as a promoter that is active predominantly in cone cells. It is to be understood that a residual expression, typically lower, in other tissues or cells cannot be completely excluded. The term "residual expression, typically lower" means herein that the activity of a cone cell specific promoter in a non-cone cell is less than about 90%, e.g. less than about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80% or about 90% of the activity in a cone cell; in one embodiment, the activity of a cone cell specific promoter in a non-cone cell is between 1-10%, 1-20%, 1-30%, 1-40% or 1-50% of the activity in a cone cell. Such residual expression is also referred to as "essentially no activity" in the present application. In one embodiment, a cone cell specific promoter is inactive or essentially inactive in non-cone cells. In a preferred embodiment, the promoter of the application is inactive or essentially inactive in ganglion, bipolar, amacrine, horizontal, Muller, rod and / or glial cells.
[0065] The term "variant" or "functional variant" as used herein refers to a nucleotide sequence that differs from an original sequence but retains its essential properties. Generally, a variant is closely similar in sequence to the original polynucleotide and is identical in many regions. The sequence difference of the variant can be due to nucleotide substitution, deletion or insertion of one or more nucleotides in the sequence, which does not impair the promoter activity. The variant can have the same length as the original sequence, or can be shorter or longer.
[0066] In one embodiment, the promoter of the application comprises a functional variant of the nucleotide sequence selected from any one of SEQ ID NOs: 1-9. In one embodiment, the functional variant has at least 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity to the nucleotide sequence selected from any one of SEQ ID NOs: 1-9. In one embodiment, the identity can be any sub-range or point value between 50-100%, inclusive. In one embodiment, the identity can be 50-60%, 50-70%, 50-80%, 50-90%, or 50-99%, and any sub-range or point value therebetween, inclusive. In one embodiment, the functional variant can differ by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, or 130 nucleotide substitutions, deletions, and / or insertions from the nucleotide sequence selected from any one of SEQ ID NOs: 1-9.
[0067] In one embodiment, the functional variant is capable of hybridizing to the nucleotide sequence selected from any one of SEQ ID NOs: 1-9, or the complement thereof, under low, medium, or high stringency conditions.
[0068] The term "low stringency conditions" as used herein means prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms / mL sheared and denatured salmon sperm DNA, and 25% formamide, followed by washing in 2X SSC with 0.2% SDS at 50°C, and final washing at 55°C for 15 min.
[0069] The term "medium stringency conditions" as used herein means prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms / mL sheared and denatured salmon sperm DNA, and 35% formamide, followed by washing in 2X SSC with 0.2% SDS at 55°C, and final washing at 55°C for 15 min.
[0070] As used herein, the term "high stringency conditions" means prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms / mL denatured and sheared salmon sperm DNA, and 50% formamide followed by washes at 65°C with 2X SSC, 0.2% SDS, for 15 min each.
[0071] In one embodiment, the promoter of the application comprises or consists of the nucleotide sequence of SEQ ID NO: 1.
[0072] In one embodiment, the promoter of the application comprises or consists of the nucleotide sequence of SEQ ID NO: 2.
[0073] In one embodiment, the promoter of the application comprises or consists of the nucleotide sequence of SEQ ID NO: 3.
[0074] In one embodiment, the promoter of the application comprises or consists of the nucleotide sequence of SEQ ID NO: 4.
[0075] In one embodiment, the promoter of the application comprises or consists of the nucleotide sequence of SEQ ID NO: 5.
[0076] In one embodiment, the promoter of the application comprises or consists of the nucleotide sequence of SEQ ID NO: 6.
[0077] In one embodiment, the promoter of the application comprises or consists of the nucleotide sequence of SEQ ID NO: 7.
[0078] In one embodiment, the promoter of the application comprises or consists of the nucleotide sequence of SEQ ID NO: 8.
[0079] In one embodiment, the promoter of the application comprises or consists of the nucleotide sequence of SEQ ID NO: 9.
[0080] In a second aspect, an expression cassette is provided comprising the isolated nucleic acid according to the first aspect of the application. In one embodiment, the expression cassette further comprises a nucleic acid of interest operably linked to the isolated nucleic acid of the application.
[0081] The term "expression cassette" as used herein refers to a nucleic acid construct comprising a coding sequence and one or more control sequences required for the expression of said coding sequence. In particular, one of these control sequences is the promoter of the application. Typically, the expression cassette comprises the coding sequence required for the expression of a selected gene product and regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence. Thus, an expression cassette typically comprises a promoter sequence, a coding sequence, and a 3' non-translated region which usually contains a polyadenylation site and / or a transcription termination signal. The expression cassette can also comprise other regulatory elements, such as enhancer sequences, a multiple cloning site sequence to facilitate insertion of the DNA fragment within a vector, and / or a splicing signal sequence. The expression cassette is usually comprised within a vector to facilitate cloning and transformation.
[0082] In a preferred embodiment, the nucleic acid of interest is a heterologous nucleic acid. The term "heterologous" as used herein means a nucleic acid other than the nucleic acid to which the promoter is operably linked in a naturally occurring genome.
[0083] In one embodiment, the nucleic acid of interest is a nucleic acid encoding a polypeptide of interest. The polypeptide of interest can be any polypeptide that needs to be expressed in a cone cell. In particular, the polypeptide of interest can be a therapeutic protein, an optogenetic driver protein or a reporter protein.
[0084] In one embodiment, the nucleic acid of interest is a therapeutic gene, i.e. a gene encoding a therapeutic protein.
[0085] The term "therapeutic gene" as used herein refers to a gene encoding a therapeutic protein useful in the treatment of a pathological condition. The therapeutic gene, when expressed, provides a beneficial effect to the cell or tissue in which it is present or to the patient in which the gene is expressed in vivo. Examples of beneficial effects include improvement of a sign or symptom of a disorder or disease, prevention or inhibition of a disorder or disease, or provision of a desirable characteristic. Therapeutic genes include genes that partially or completely correct a genetic deficiency in a patient. In particular, the therapeutic gene can be, but is not limited to, a nucleic acid sequence encoding a protein useful in gene therapy to alleviate a deficiency caused by the absence, deficiency or suboptimal level of the protein in the cells or tissues of the subject. The therapeutic polypeptide can for example provide a polypeptide and / or enzymatic activity that is absent, deficient or present at a suboptimal level in the cone cells, provide a polypeptide and / or enzymatic activity that indirectly counteracts an imbalance in the cone cells. The therapeutic polypeptide can also be used to reduce the activity of a polypeptide by for example acting as a dominant negative polypeptide. Preferably, the therapeutic polypeptide provides a polypeptide and / or enzymatic activity that is absent, deficient or present at a suboptimal level in the cone cells, more preferably a polypeptide and / or enzymatic activity that is absent or deficient in the cone cells.
[0086] Examples of therapeutic genes include, but are not limited to, nucleic acids for replacing missing or mutated genes known to cause retinal diseases, such as MT-ND4, MT-ND1, MT-ND6, MT-CYB, MT-CO3, MT-ND5, MT-ND2, MT-COI, MT-ATP6, MT-ND4L, OPAl, OPA3, OPA7, GUCA1A, PDE6C, GNAT2, ABCA4, RPGR, CRX, CNGA3, CNGB3 and ACO2.
[0087] The therapeutic gene can also encode a neurotrophic factor such as GDNF, CNTF, FGF2, BDNF and EPO, an anti-apoptotic gene such as BCL2 and BCL2L1, an anti-angiogenic factor such as endostatin, angiostatin and sFlt, an anti-inflammatory factor such as IL10, IL1R1, TGFBI and IL4, or a rod-derived cone viability factor (RdCVF).
[0088] Additional signal peptides can be added to the therapeutic proteins, in particular in order to import them into certain organelles (e.g. mitochondria), to secrete them out of the cell, or to insert them into the cell membrane.
[0089] In one embodiment, the polypeptide of interest is a tool enzyme used in gene editing methods. In one embodiment, the polypeptide of interest is a Cas9 protein.
[0090] In one embodiment, the polypeptide of interest is a light-driven kinesin. As used herein, the term "light-driven kinesin" refers to a photochemically reactive polypeptide that uses vitamin A or an isoform thereof as a chromophore. Light-driven kinesins are light-gated ion pumps or channels that absorb light and are activated by light. The light-driven kinesin can be from a prokaryote or a eukaryote. In particular, it can be a microbial opsin or a vertebrate opsin. The light-driven kinesin can be a light-driven activator or a light-driven inhibitor.
[0091] Light-driven activators cause cells to depolarize after exposure to light. When a cell depolarizes, the internal negative charge of the cell becomes positive for a short period of time. The shift from negative to positive in the internal environment of the cell allows for the transmission of an electrical pulse both within and optionally between cells. Examples of light-driven activators include, but are not limited to, rhodopsin, photopsin, melanopsin, pinealopsin, parapinealopsin, VA opsin, peropsin, neuroopsin, caeroopsin, retioneopsin, RGR opsin, microbial opsin with red-shifted spectral properties (e.g., ReaChR, Chrimson or ChrimsonR), vertebrate opsin that recruits Gi / o signaling (e.g., short-wavelength vertebrate opsin or long-wavelength vertebrate opsin), channelrhodopsin from Chlamydomonas microalgae (e.g., channelrhodopsin-1 and channelrhodopsin-2 from Chlamydomonas reinhardtii), and variants of the above proteins. Numerous variants of channelrhodopsin (e.g., codon-optimized variants, mutants, chimeras) are continually being generated to improve certain characteristics of these proteins. Examples of these variants include, but are not limited to, hChR2(L132C), ChR2(H134R), ChETA(E123T), C1V1(E122T), C1V1(E162T), C1V1(E122 / 162T), hChR2(C128A), hChR2(C128S), hChR2(C128T), hChR2(C128A / H134R), hCatch(T159S), hChief, hChR2(C128S / D156A), hChR2(T159C), hChR2(E123T / T159C), hChR2c(C128T), ChR2c(C128T), ChR2e(Q117C), and SwitChR (for a review, see Prakash et al., Nat Methods. 2012 Dec;9(12):1171-9).
[0092] Light-driven activators cause cells to depolarize after exposure to light. When a cell depolarizes, the internal negative charge of the cell becomes positive for a short period of time. The shift from negative to positive in the internal environment of the cell allows for the transmission of an electrical pulse both within and optionally between cells. Examples of light-driven activators include, but are not limited to, rhodopsin, photopsin, melanopsin, pinealopsin, parapinealopsin, VA opsin, peropsin, neuroopsin, caeroopsin, retioneopsin, RGR opsin, microbial opsin with red-shifted spectral properties (e.g., ReaChR, Chrimson or ChrimsonR), vertebrate opsin that recruits Gi / o signaling (e.g., short-wavelength vertebrate opsin or long-wavelength vertebrate opsin), channelrhodopsin from Chlamydomonas microalgae (e.g., channelrhodopsin-1 and channelrhodopsin-2 from Chlamydomonas reinhardtii), and variants of the above proteins. Numerous variants of channelrhodopsin (e.g., codon-optimized variants, mutants, chimeras) are continually being generated to improve certain characteristics of these proteins. Examples of these variants include, but are not limited to, hChR2(L132C), ChR2(H134R), ChETA(E123T), C1V1(E122T), C1V1(E162T), C1V1(E122 / 162T), hChR2(C128A), hChR2(C128S), hChR2(C128T), hChR2(C128A / H134R), hCatch(T159S), hChief, hChR2(C128S / D156A), hChR2(T159C), hChR2(E123T / T159C), hChR2c(C128T), ChR2c(C128T), ChR2e(Q117C), and SwitChR (for a review, see Prakash et al., Nat Methods. 2012 Dec;9(12):1171-9).
[0093] Optogenetic inhibitors cause cell hyperpolarization upon exposure to light. When a cell hyperpolarizes, the internal negative charge of the cell becomes more negative for a short period of time. The shift to more negative inhibits action potentials by increasing the stimulus needed to shift the membrane potential toward the action potential threshold. In particular embodiments, the optogenetic inhibitor is a light-gated ion pump that transports chloride ions inwards and / or cations outwards upon absorption of a photon. Any suitable light-gated, retinal-dependent ion pump that transports chloride ions inwards or cations outwards upon absorption of a photon can be used as an optogenetic inhibitor. Examples of optogenetic inhibitors include, but are not limited to, halorhodopsins such as halorhodopsin (NpHR), enhanced halorhodopsin (eNpHR2.0 and eNpHR3.0), and red-shifted halorhodopsin Halo57, archaeorhodopsin-3 (AR-3), archaerhodopsin (Arch), bacterial rhodopsins such as enhanced bacterial rhodopsin (eBR), proteorhodopsin, xanthorhodopsin, Aspergillus maculosus fungal opsin (Mac), great white shark cross-halorhodopsin, and variants of the above proteins.
[0094] In a particularly preferred embodiment, the optogenetic driver is an optogenetic activator, preferably selected from the group consisting of channelrhodopsin, ChrimsonR and variants thereof.
[0095] In an embodiment, the polypeptide of interest is a reporter protein. Preferably, the reporter protein is detectable in a living cone cell. Expression of the reporter protein under the control of the promoter of the application allows for specific detection or recognition of cone cells. The reporter protein can be, for example, a fluorescent protein (such as GFP), a calcium indicator (such as GCamP), luciferase, alkaline phosphatase, beta-galactosidase, beta-lactamase, horseradish peroxidase and variants thereof. In particular embodiments, the reporter protein is selected from the group consisting of a fluorescent protein, a calcium indicator, alkaline phosphatase, beta-galactosidase, beta-lactamase, horseradish peroxidase and variants thereof.
[0096] In an embodiment, the nucleic acid of interest encodes any nucleic acid that needs to exert an effect in a cone cell. In particular, the nucleic acid of interest can be a therapeutic nucleic acid. In an embodiment, the therapeutic nucleic acid is selected from the group consisting of siRNA, shRNA, RNAi, miRNA, antisense RNA, sgRNA, ribozyme and DNAzyme. In particular embodiments, the nucleic acid of interest, when transcribed by the promoter of the application, can treat or prevent a disease associated with an abnormal or excessive protein by interfering with the translation or transcription of said protein. For example, the nucleic acid of interest can encode an RNA that treats the disease by highly specific elimination or reduction of mRNA encoding an abnormal and / or excessive protein.
[0097] In a third aspect, a vector comprising a promoter or expression cassette according to the application is provided.
[0098] The term "vector" as used herein refers to a nucleic acid molecule used as a vehicle to transfer genetic material, in particular to deliver a nucleic acid into a host cell, either in vitro or in vivo. Vectors include, but are not limited to, plasmids, phagemids, cosmids, transposable elements, viruses and artificial chromosomes (e.g. YACs). Preferably, the vector of the application is a vector suitable for use in gene or cell therapy, in particular suitable for targeting the eye, e.g. the cone cells or the retinal pigment epithelium (RPE).
[0099] The vector of the application is preferably a viral vector, which comprises any element necessary for establishing the expression of the polypeptide of interest in a host cell, such as a promoter, ITR, ribosome binding element, terminator, enhancer, selection marker, intron, polyA signal and / or origin of replication.
[0100] In certain embodiments, the vector is a viral vector, such as a vector derived from Moloney murine leukemia virus (MoMLV), MSCV, SFFV, MPSV or SNV, a lentiviral vector (e.g. derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) or equine infectious anemia virus (EIAV)), an adenoviral (Ad) vector, an adeno-associated viral (AAV) vector, a simian virus 40 (SV-40) vector, a bovine papilloma virus vector, an Epstein-Barr virus vector, a herpes virus vector, a vaccinia virus vector, a Harvey murine sarcoma virus vector, a murine mammary tumor virus vector or a Rous sarcoma virus vector. In particular embodiments, the vector is a retroviral vector, preferably a lentiviral vector, or a non-pathogenic parvovirus vector. As known in the art, depending on the specific viral vector contemplated for use, appropriate sequences should be introduced into the vector of the application to obtain a functional viral vector, such as AAV ITRs for AAV vectors or LTRs for lentiviral vectors. In one embodiment, the vector is an adeno-associated viral (AAV) vector.
[0101] The human parvovirus adeno-associated virus (AAV) is a dependovirus, naturally defective for replication, able to integrate into the genome of the infected cell to establish a latent infection. This last property appears to be unique among mammalian viruses, as the integration occurs in the human genome on chromosome 19 in a region called AAVS1.
[0102] AAV Sl at a specific site (19ql3.3-qter). Thus, AAV has generated considerable interest as a potential vector for human gene therapy. Favorable properties of the virus include its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and its ability to infect a broad range of cell lines derived from different tissues. The term "AAV vector" as used herein refers to a polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequences not of AAV origin) flanked by at least one AAV inverted terminal repeat (ITR), preferably two ITRs. Such AAV vectors, when present in a host cell that has been infected with a suitable helper virus (or a virus expressing suitable helper virus functions) and that expresses AAV rep and cap gene products (i.e., AAV Rep and Cap proteins), can be replicated and packaged into infectious viral particles. An "inverted terminal repeat" or "ITR" sequence is a term well known in the art and refers to a relatively short sequence present at the end of the viral genome in the opposite orientation. An "AAV inverted terminal repeat (ITR)" sequence is a sequence of approximately 145 nucleotides present at both ends of the native single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be present in either of two alternative orientations, giving rise to heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contain several shorter regions of self-complementarity (referred to as the A, A', B, B', C, C, and D regions), allowing for intrastrand base pairing to occur within this portion of the ITR. The AAV ITR used in the vectors of the present application can have a wild-type nucleotide sequence, or can be altered by insertion, deletion, or substitution. The terminal inverted repeat (ITR) of the AAV vector can be selected from any known human or non-human AAV serotype. The promoter or expression cassette of the present application can be introduced into the vector by any method known to the skilled artisan.
[0103] The vector can also comprise one or more of the following nucleic acid sequences encoding a selectable marker such as an auxotrophic marker (e.g. LEU2, URA3, TRP 1 or HIS3), a detectable tag such as a fluorescent or luminescent protein (e.g. GFP, eGFP, DsRed, CFP) or a protein providing resistance to a chemical / toxic compound (e.g. the MGMT gene providing resistance to temozolomide). These markers can be used to select or detect host cells comprising the vector and can be easily selected by the skilled person depending on the host cell.
[0104] In a fourth aspect, a viral particle is provided comprising a vector according to the present application.
[0105] In particular embodiments, the vector is an AAV vector and is packaged in an AAV-derived capsid to generate an "adeno-associated viral particle" or "AAV particle". Thus, the term "AAV particle" as used herein refers to a viral particle composed of at least one AAV capsid protein and an encapsidated AAV vector genome. AAV serotypes include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, and AAVdj, among others. In addition, non-natural engineered variants and chimeric AAVs can also be useful. In particular, the capsid protein can be a variant comprising one or more amino acid substitutions that enhance transduction efficiency. In one embodiment, the capsid is preferably selected from the group consisting of AAV-2, AAV-5, AAV2-7m8, AAV-9, and AAV-8 serotype capsids, more preferably AAV-2, AAV-5, AAV2-7m8, and AAV-9 serotype capsids, and most preferably AAV-2 and AAV2-7m8 serotype capsids.
[0106] AAV-2 derived capsids such as AAV-2 or AAV2-7m8 capsids.
[0107] Different AAV serotypes are used to optimize transduction of particular target cells or to target particular cell types within a particular target tissue (e.g., cone cells). The AAV particles can comprise viral proteins and viral nucleic acids of the same serotype or any natural or artificial sequence variant of AAV. For example, the AAV particles can comprise AAV2 capsid proteins and at least one, preferably two, AAV2 ITRs. Any combination of AAV serotypes for producing AAV particles is provided herein. AAV viruses can be engineered using conventional molecular biology techniques such that these particles can be optimized for cell-specific delivery of nucleic acid sequences, for minimizing immunogenicity, for modulating stability and particle longevity, for efficient degradation, for accurate delivery to the nucleus.
[0108] A large number of methods for producing viral particles, in particular AAV particles, are known in the art, including transfection, stable cell line production, and infectious hybrid virus production systems, including adenovirus-AAV hybrids, herpes virus-AAV hybrids (Conway, JE et al., (1997) Virology 71(11):8780-8789), and baculovirus-AAV hybrids. AAV production cultures for producing AAV viral particles require: 1) a suitable host cell, including for example a cell line of human origin such as HeLa, A549, or 293T cells, or in the case of baculovirus production systems a cell line of insect origin such as SF-9; 2) a suitable helper virus function, provided by a wild-type or mutant adenovirus (e.g. temperature sensitive adenovirus), herpes virus, baculovirus, or a plasmid construct providing helper virus functions; 3) AAV rep and cap genes and gene products; 4) a nucleic acid of interest flanked by at least one AAV ITR sequence, such as a vector of the application; and 5) suitable media and media components known in the art that support AAV production.
[0109] In the present application, host cells for producing AAV particles include mammalian cells, insect cells, plant cells, microorganisms, and yeast. The host cell can be a packaging cell in which AAV rep and cap genes are stably maintained in the host cell or a producer cell in which AAV vector genomes are stably maintained. Exemplary packaging and producer cells are derived from 293T, A549, or HeLa cells. AAV particles are then purified and formulated using standard techniques known in the art.
[0110] In a fifth aspect, there is provided a cell comprising or transformed with an isolated nucleic acid, expression cassette, vector, or viral particle according to the present application. The cell can be any animal cell, plant cell, bacterial cell, or yeast. Preferably, the cell is a mammalian cell or an insect cell. More preferably, the cell is a human cell. In one embodiment, the cell is a cone cell. In another embodiment, the cell is a retinal pigment epithelial cell (RPE).
[0111] The nucleic acid, expression cassette, vector, or viral particle of the application can be transferred into a host cell using any known technique, including but not limited to calcium phosphate-DNA precipitation, DEAE-Dextran transfection, electroporation, microinjection, gene gun, lipofection, or viral infection, and can be maintained in the host cell in an episomal form or can be integrated into the genome. In preferred embodiments, the nucleic acid, expression cassette, vector, or viral particle of the application is transferred into the cell by viral infection, preferably using a viral particle of the application, more preferably using an AAV particle of the application.
[0112] In a sixth aspect, there is provided a pharmaceutical composition comprising an isolated nucleic acid, expression cassette, vector, viral particle, or cell according to the application, and a pharmaceutically acceptable excipient.
[0113] The term "pharmaceutically acceptable" as used herein means approved by a regulatory agency or a generally recognized pharmacopeia for use in animals and / or humans. The term "excipient" refers to a diluent, adjuvant, carrier, or vehicle with which a therapeutic agent is administered.
[0114] As is well known in the art, a pharmaceutically acceptable excipient is a relatively inert substance that facilitates administration of a pharmacologically effective substance, and can be provided as a liquid solution or suspension, an emulsion, or a solid form suitable for dissolution or suspension in a liquid prior to use. For example, an excipient can provide bulk or consistency, or act as a diluent. Suitable excipients include, but are not limited to, stabilizers, wetting and emulsifying agents, salts for varying osmotic pressure, encapsulating agents, pH buffering substances, and buffers. Suitable excipients include any agent suitable for direct delivery to the eye, which can be administered without undue toxicity. Pharmaceutically acceptable excipients include, but are not limited to, sorbitol, any of a variety of Tween compounds, and liquids such as water, saline, glycerol, and ethanol. Pharmaceutically acceptable salts can be included therein, for example, inorganic salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like, and salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. A thorough discussion of pharmaceutically acceptable excipients is available in Remington's Pharmaceutical Sciences, 15th Ed.
[0115] Preferably, the composition is formulated for administration to the eye, in particular by intraocular injection, for example by subretinal and / or intravitreal or suprachoroidal administration. Thus, the composition can be administered with a pharmaceutically acceptable excipient, such as saline, Ringer's balanced salt solution (pH 7.4), and the like.
[0116] The pharmaceutical compositions described herein can be packaged in unit dose or multiple dose form. As used herein, the term "unit dose" refers to preparations made in a form that is suitable for administration in a single dose to a patient. As used herein, the term "multiple dose" refers to preparations made in a form that is suitable for administration in multiple doses to a patient.
[0117] In another embodiment, the pharmaceutical composition comprises a cell of the application, preferably a human cell, i.e. a cell transformed or transfected with an expression cassette, a vector or a viral particle of the application, preferably with an AAV particle. Optionally, the composition comprising the cell can be stored frozen at any temperature suitable for storing the cell. For example, the cell can be frozen at about -20°C, -80°C or any other suitable temperature. Cryogenically frozen cells can be stored in suitable containers and prepared for storage to reduce the risk of cell damage and maximize the likelihood of cell survival upon thawing. Alternatively, the cell can also be maintained at refrigerated room temperature, e.g. about 4°C.
[0118] The amount of the pharmaceutical composition to be administered can be determined by standard procedures known to those of ordinary skill in the art. In order to determine the appropriate dose, the physiological data of the patient (e.g. age, size and weight) and the type and severity of the disease to be treated must be taken into account. In a particular embodiment, the composition comprises a viral particle of the application and each unit dose comprises 10 8 to 10 13 viral particles, preferably 10 9 to 10 12 particles. The pharmaceutical composition can also comprise one or several other active compounds such as corticosteroids, antibiotics, analgesics, immunosuppressants, trophic factors or any combination thereof.
[0119] In a seventh aspect, there is provided a method of treating an eye disease comprising administering to a patient in need thereof a therapeutically effective amount of an isolated nucleic acid, an expression cassette, a vector, a viral particle, a cell or a pharmaceutical composition according to the application.
[0120] In one embodiment, the eye disease is an inherited retinal disease (IRD).
[0121] In one embodiment, the eye disease is a disease associated with photoreceptor degeneration. Examples of diseases associated with photoreceptor degeneration include, but are not limited to, retinitis pigmentosa (RP), age-related macular degeneration, Stargardt disease, Leber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Leber congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best disease, choroideremia, tapetochoroidal dystrophy, and achromatopsia (rod monochromacy).
[0122] In one embodiment, the patient is a mammal, preferably a human.
[0123] The term "treatment" as used herein refers to any action aimed at improving the health condition of a patient, such as therapy, prevention, prophylaxis and retardation of a disease. In certain embodiments, this term refers to the improvement or eradication of a disease or symptoms associated with a disease. In other embodiments, this term refers to the minimization of the spread or worsening of a disease resulting from the administration of one or more therapeutic agents to a subject suffering from the disease. In particular, the term "treatment of an eye disease" can refer to a treatment that provides improved vision, prevents the disease from progressing to complete blindness, prevents the spread of damage to non-damaged eye cells, improves damage in damaged eye cells, prevents the occurrence of retinal damage, or rescues eyes with mild or late-stage disease. In certain embodiments, this term refers to a treatment that prevents, reduces or stops retinal degeneration by providing a therapeutic protein that corrects a genetic deficiency in the patient. In certain other embodiments, this term refers to a treatment that restores the retina or restores vision using optogenetics.
[0124] A "therapeutically effective amount" as used herein means the amount of a nucleic acid, expression cassette, vector, viral particle, cell or pharmaceutical composition of the application administered to a subject which is sufficient to constitute a treatment of an eye disease as defined above. The nucleic acid, expression cassette, vector, viral particle, cell or pharmaceutical composition can be administered in unit dose or multiple doses.
[0125] In the methods of the application for treating an eye disease, the nucleic acid, expression cassette, vector, viral particle, cell or pharmaceutical composition of the application is preferably administered intraocularly, more preferably by subretinal or intravitreal or suprachoroidal administration. In one embodiment, the intraocular administration dosage form includes, but is not limited to, an ophthalmic injection, an ophthalmic sustained release formulation, an ophthalmic liposome, an ophthalmic nanoparticle and an ophthalmic gel.
[0126] The methods of the application can further comprise administering to the subject at least one additional therapeutic agent. In particular, the therapeutic agent can be selected from a corticosteroid, an antibiotic, an analgesic, an immunosuppressant or a trophic factor or any combination thereof.
[0127] The nucleic acid, expression cassette, vector, viral particle, cell or pharmaceutical composition of the present application can be administered before or after the disease becomes symptomatic, for example before or after partial or complete degeneration of the cone cells or photoreceptor cells and / or before or after partial or complete loss of vision.
[0128] The term "in vitro" as used herein refers to a method in which experiments are performed outside of a living organism, in an artificially controlled environment. Experiments are usually performed at the cellular, molecular, or biochemical level, using cell cultures, biological extracts, or artificially synthesized substances, etc. The term "ex vivo" as used herein refers to a method in which a part of a living organism (such as an organ, tissue, or cell) is removed from the body and cultured or experimented in vitro. Unlike in vitro methods, ex vivo methods usually retain some structural and functional integrity of the tissue or organ. The term "in vivo" as used herein refers to a method in which experiments are performed in a complete living organism, including animal experiments and human clinical trials. By various treatments and observations on animals or humans, the performance and mechanisms of biological processes at the whole-body level are studied.
[0129] The method for treating eye diseases of the present application can be an in vitro, in vivo or ex vivo method. Therefore, the present application provides a method for expressing a target polypeptide or nucleic acid in a cell, which can be performed in vitro, in vivo or ex vivo. The method comprises introducing the promoter, expression cassette, vector or viral particle of the present application into a cell in vitro, ex vivo or in vivo. The method further comprises introducing the cell into a patient, especially into the eye.
[0130] Retinal neurodegenerative diseases such as retinitis pigmentosa and age-related macular degeneration ultimately end with the degeneration and apoptosis of retinal photoreceptor cells, causing irreversible damage to vision. In the study and treatment of retinal neurodegenerative diseases, cone cell-specific promoters play an important role. These promoters have the ability to specifically initiate gene expression in cone cells and can be used to precisely regulate the expression of therapeutic genes. By utilizing these specific promoters, it is expected to play an important role in the treatment of retinal neurodegenerative diseases. Optogenetic gene therapy is a treatment strategy that has attracted widespread attention in recent years, especially showing great potential in the study of retinal neurodegenerative diseases. This method uses light-sensitive proteins, such as light-sensitive ion channels or receptors, to introduce the genes they encode into cone cells and regulate the activity of these proteins through light stimulation. This strategy can achieve precise manipulation of cone cells in vivo and is expected to make breakthrough progress in restoring visual function.
[0131] AAV is highly regarded for its safety, but it is difficult to carry larger functional proteins such as Cas9 protein due to its very small vector capacity, which can cause a significant decrease in virus titer due to length exceeding capacity. Therefore, obtaining a relatively small length but retaining the ability to express downstream genes in specific tissues or cell types can solve this problem to some extent, which can ensure the specific expression of target genes and make the vector length not exceed the capacity limit of AAV genome. The inventors designed a promoter with a length of less than 500 bp through library screening method, and verified the activity of the screened promoter through experiments.
[0132] The following example section provides further detailed information about various specific embodiments. Those skilled in the art will understand that the techniques disclosed in the following examples represent the inventors' best attempts at at least performing well. However, those skilled in the art will understand, in light of the present disclosure, that numerous modifications to the disclosed specific embodiments can be made without departing from the spirit and scope of the present disclosure, and that such modifications will still achieve similar or analogous results. These examples are merely for illustrative purposes and are not intended to limit the scope of the present disclosure.
[0133] Example 1: Expression vector construction and promoter activity verification (mouse)
[0134] An A7 promoter sequence of artificial recombinant origin (SEQ ID NO: 1) was obtained by library screening method. Based on the VB220218-1080bsm vector (internally constructed, see https: / / en.vectorbuilder.com / vector / VB220218-1080bsm.html, as shown), the CAG promoter was replaced with the A7 promoter by conventional enzyme digestion and ligation method, and an expression vector with A7 promoter upstream and NLS-mCherry gene downstream was constructed. Figure 1
[0135] According to the conventional virus packaging method, the above expression vector containing A7 promoter was mixed with the remaining two auxiliary vector plasmids (carrying Rep\Capsid gene and E2\E4\VA gene, respectively) for AAV packaging, and then transfected into 293T cells for virus packaging. After harvesting the virus, cesium chloride purification was performed, and finally the virus particles (AAV8 type) for animal in vivo verification experiment were obtained.
[0136] The mice (C57BL / 6J, 6-8 weeks old, purchased from Guangdong Medical Experimental Animal Center) were injected with a virus injection dose of 1E+10 GC / eye in the subretinal space, and the samples were taken for sectioning and immunofluorescence staining two weeks after injection: the primary antibody used in the immunofluorescence process was rabbit anti-mouse polyclonal anti-Arrestin C antibody (purchased from Sigma-Aldrich, catalog number
[0137] AB15282) which can specifically bind to the surface protein of the cone cells in the photoreceptor (PR) layer, thereby effectively distinguishing the cone cells and the rod cells. The secondary antibody used was a green fluorescent goat anti-rabbit IgG (purchased from Thermofisher, catalog number A-11008). At the same time, DAPI was used to stain the nuclei of the cells in each layer, and the imaging was blue.
[0138] As can be seen from
[0139] The section was photographed, and the expression section diagram of the A7 promoter was finally obtained, as shown in Figure 2 .
[0140] As can be seen from Figure 2 , red fluorescence mainly appeared in the cone cells of the photoreceptor layer, and there was a small amount of expression in the retinal pigment epithelial cells (RPE), which proved that the A7 promoter showed cone cell specificity in the mouse body and had a small amount of activity in the RPE layer.
[0141]
[0142] Example 2: Verification of promoter activity (cynomolgus monkey)
[0143] The same batch of purified AAV virus produced in the mouse in vivo experiment was used for subretinal injection of a cynomolgus monkey (from Guangdong Blue Island Biology, ordinary level, 2 years old), and the injection dose was 8E+11 GC / eye. The samples were taken for sectioning and fluorescence observation one month later: the red channel was used to observe the promoter transcription expression signal, the blue channel was used to observe the DAPI nuclear staining, and the green channel was used to observe whether there was spontaneous fluorescence.
[0144] The section was photographed, and the expression section diagram of the A7 promoter was finally obtained, as shown in Figure 3 .
[0145] As can be seen from Figure 3 , the A7 promoter basically only drives expression in the cone cells, showing the specificity of the promoter.
[0146] Example 3: Verification of promoter activity (large gene)
[0147] Because the expression frame of fluorescent protein is relatively short, there is a certain difference with the expression of large genes. Therefore, lacZ gene is used as a substitute gene for large genes to verify the experiment. Based on the VB231203-1125phu vector (internal construction, see https: / / en.vectorbuilder.com / vector / VB231203-1125phu.html, as shown in Figure 4 The CBh promoter is replaced with the A7 promoter by conventional enzyme digestion and ligation method to construct an expression vector with A7 promoter upstream and lacZ gene with HA tag protein downstream.
[0148] According to the conventional virus packaging method, the expression vector containing the A7 promoter is mixed with the remaining two auxiliary vector plasmids (carrying Rep\Capsid gene and E2\E4\VA gene respectively) of AAV packaging, and then transfected into 293T cells for virus packaging. After harvesting the virus, cesium chloride purification is performed to finally obtain the virus particles (AAV8) used for animal in vivo verification experiment.
[0149] The mice (C57BL / 6J, 6-8 weeks old, purchased from Guangdong Medical Laboratory Animal Center) are injected with a virus injection dose of 8E+9 GC / eye in the subretinal space, and the samples are taken for sectioning and immunofluorescence staining after 1 month of injection: The primary antibody used in the immunofluorescence process is anti-HA tag antibody (purchased from thermofisher, catalog number 14-6756-81), which can specifically bind to HA tag protein and can side verify whether lacZ gene is normally transcribed and translated. The secondary antibody used is green fluorescent goat anti-rabbit IgG (purchased from Thermofisher, catalog number A-11008). DAPI is also used to stain the cell nuclei of each layer of cells, and the imaging is blue.
[0150] The slices are photographed to finally obtain the expression slice diagram of lacZ gene driven by A7 promoter, as shown in Figure 5
[0151] From Figure 5 It can be seen that A7 promoter can normally drive the expression of lacZ and HA tag protein in cone cells, indicating that A7 promoter has the ability to express large genes, so it has more credibility in the scene of using the promoter to express functional therapeutic proteins.
[0152] Example 4: Functional variants of A7 promoter
[0153] After confirming the expression specificity of A7 promoter, random mutation and deletion substitution were performed on A7 promoter to construct A7 promoter variant sequences A7V1, A7V2, A7V3, A7V4, A7V5, A7V6, A7V7 and A7V8 for experiments. The sequence identity of the variant sequences and A7 sequence and the sequence identity between the variants are shown in the following table:
[0154] A7 A7V1 A7V2 A7V3 A7V4 A7V5 A7V6 A7V7 A7V8 A7 100% - - - - - - - - A7V1 94.98% 100% - - - - - - - A7V2 92.70% 88.61% 100% - - - - - - A7V3 89.96% 88.20% 87.32% 100% - - - - - A7V4 83.40% 79.03% 77.49% 75.50% 100% - - - - A7V5 54.15% 54.08% 53.04% 53.54% 41.78% 100% - - - A7V6 70.98% 71.97% 67.21% 68.92% 81.22% 43.43% 100% - - A7V7 55.74% 56.90% 55.28% 55.30% 65.28% 52.12% 80.38% 100% - A7V8 50.00% 50.64% 46.01% 31.55% 58.73% 41.10% 72.31% 78.46% 100%
[0155] According to the method described in Example 1, expression vectors with the upstream being variant promoters A7V1, A7V2, A7V3, A7V4, A7V5, A7V6, A7V7 and A7V8 and the downstream being the nuclear red fluorescent protein (NLS-mCherry) gene were constructed, virus packaging and purification were performed, and promoter activity was verified in mice. The expression profile of the promoters is shown in Figure 6 .
[0156] As can be seen from Figure 6 , A7V1 to A7V4, A7V6 to A7V8 variants obtained by random mutation of A7 sequence can maintain high expression driven in cone cells, and fluorescence expression can be observed in some variants in RPE cells. A7V5 is a truncated version of A7 sequence, and its expression intensity is lower, but it still maintains specific expression in cone cells and RPE cells.
[0157] Sequence information:
[0158] A7 promoter sequence (457bp): SEQ ID NO: 1
[0159] GATTCCCTAGATCTGGTCTACTTCCTCGAGAGGACAAGAAACCATTTGGCCATTTGCCTTTGACACTTTAAAAAGATCGTGGTAAAATACCTTGTCCAGGATTACGCTACTTCCCTGGGCATCCAAGGCCACCATAACTCCTAATCGGCTCTCCCCGCGTGGAGTCAGGAGTGGGGTGTCTGGGGGAAGCCCCCAGCCTTGCCTGAGCCCCGGAGCTGGCCAGGGGCTTCCCAGTGGTCCCCAGGAACCCTCGACAGGGGGCTGCTGTCATCTGCCTACCTTGCCTTGAGACTCCTTACCCGAGCTGGAGAGCTCCTTCCTAATCCGGGGATTGTCCCCTTTATGTCTAGCGGAATGACAGATCAAGCCAATTAAAAGCTTTGCAGGCAGATAAAGGACGTTCACAGGGCAAAAGTGAGGGATCCTTGGAGGCAGGCCGAAGCCTGGTGAA
[0160] A7 variant A7V1 sequence (451 bp): SEQ ID NO: 2
[0161] GATTCCCTAGATCTGGTCTACTTCCTCGAGAGGACAAGAAACCATTTGGCCATTTGCCTTTGACACTTTAAAAAGATCGTGGTAAAATACCTTGTCCAGGATTACGCTACTTCCCTGGGCATCCAAGGCCACCATAACTCCTAATCGGCTCTCCCCGCGTGGAGTCAGGAGTGGGGTGTCTGGGGGAAGCCCCCAGCCTTGCCTGAGCCCCGGAGCTGGCCAGGGGCTTCCCAGTGGTCCCCAGGAACCCTCGACAGGGGGCTGCTGTCATCTGCCTACCTTGCCTTGAGACTCCTTACCCGAGCTGGAGAGCTCCTTCCTAATCCGGGGATTGTCCCCTTTATGTCTAGCGGAATGACAGATCAAGCCAATTAAAAGCTTTGCAGGCAGATAAAGGACGTTCACAGGGCAAAAGTGAGGGATCCTTGGAGGCAGGCCGAAGCCTGGTGAA
[0162] A7 variant A7V2 sequence (459 bp): SEQ ID NO: 3
[0163] GGATGCCCTAGCTCTGGGAGCCTACCTCCTGTATGTAGAACCATTTGTCCGTTTGGCCTTTGAGACTTTGAAATAAGATCTTGGTAGAATACCTTGTGCAGGATTACGCTACTTCCCTGGGCATCCAAGGCCACCATAACTCCTAATCGGCTCTCCCCGCGTGGAGTCAGGAGTGGGGTGTCTGGGGGAAGCCCCCAGCCTTGCCTGAGCCCCGGAGCTGGCCAGGGGCTTCCCAGTGGTCCCCAGGAACCCTCGACAGGGGGCTGCTGTCATCTGCCTACCTTGCCTTGAGACTCCTTACCCGAGCTGGAGAGCTCCTTCCTAATCCGGGGATTGTCCCCTTTATGTCTAGCGGAATGACAGATCAAGCCAATTAAAAGCTTTGCCAGGCAGATAAAGGGCGTTTACATGTGATAAGTGAAGGCGGCCCATTGGAGCAAGACCCAGAACCCTGGCGGT
[0164] A7 variant A7V3 sequence (452 bp): SEQ ID NO: 4
[0165] GAATCCCCTAGCTCTGGCCTACCTCCTCTATAGGACAAGGAACCATTTGGCCATTTGCCTTTGACACTTTAAAAAGATCGTGGTAAAATACCTTGTCCAGGATTACGCTACTTCCCTGGGCATCCAAGGCCACCATAACTCCTAATCGGCTCTCCCCGCGTGGAGTCAGGAGTGGGGTGTCTGGGGGAAGCCCCCAGCCTTGCCTGAGCCCCGGAGCTGGCCAGGGGCTTCCCAGTGGTCCCCAGGAACCCTCGACAGGGGGCTGCTGTCATCGCCCTTTATCTGCCTGGCAAAGCTTTTAATTGGCTTGATCTGTCATTCCGCTAGACATAAAGGGGACAATCCCCGGATTAGGAAGGAGCTCTCCAGCTCGGGTAAGGAGTCTCAAGGCAAGGTAGGCACTTCTCATGGGAAAAGTGAGGGCGGCCCCTTGGAGGAAGGCCCAGAAGCCTGGTGGT
[0166] A7 variant A7V4 sequence (458 bp): SEQ ID NO: 5
[0167] GAATCCCCTAGCTCTGGCCTACCTCCTCTATAGGACAAGGAACCATTTGGCCATTTGCCTTTGACACTTTAAAAAGATCGTGGTAAAATACCTTGTCCAGGATTACGCTACTTCCCTGGGCATCCAAGGCCACCATAACTCCTAATCGGCTCTCCCCGCGTGGAGTCAGGAGTGGGGTGTCTGGGGGAAGCCCCCAGCCTTGCCTGAGCCCCGGAGCTGGCCAGGGGCTTCCCAGTGGTCCCCAGGAACCCTCGACAGGGGGCTGCTGTCATCGCCCTTTATCTGCCTGGCAAAGCTTTTAATTGGCTTGATCTGTCATTCCGCTAGACATAAAGGGGACAATCCCCGGATTAGGAAGGAGCTCTCCAGCTCGGGTAAGGAGTCTCAAGGCAAGGTAGGCACTTCTCATGGGAAAAGTGAGGGCGGCCCCTTGGAGGAAGGCCCAGAAGCCTGGTGGT
[0168] A7 variant A7V5 sequence (250bp): SEQ ID NO: 6
[0169] GGGGAAGCCCCCAGCCTTGCCTGAGCCCCGGAGCTGGCCAGGGGCTTCCCAGTGGTCCCCAGGAACCCTCGACAGGGGGCTGCTGTCATCTGCCTACCTTGCCTTGAGACTCCTTACCCGAGCTGGAGAGCTCCTTCCTAATCCGGGGATTGTCCCCTTTATGTCTAGCGGAATGACAGATCAAGCCAATTAAAAGCTTTGCCAGGCAGATAAAGGGCCTTCTCATGGGAAAAGTGAGGGCGGCCCCTTG
[0170] A7 variant A7V6 sequence (372bp): SEQ ID NO: 7
[0171] TATAGGACAAGGAACCATTTGGCCATTTGCCTTTGACACTTTAAAAAGATCGTGGTAAAATACCTTGTCCAGGATTACGCTACTTCCCTGGGCATCCAAGGCCACCATAACTCCTAATCGGCTCTCCCCGCGTGGAGTCAGGAGTGGGGTGTCTGGGGGAAGCCCCCAGCCTTGCCTGAGCCCCGGAGCTGGCCAGGGGCTTCCCAGTGGTCCCCAGGAACCCTCGACAGGGGGCTGCTGTCATCGCCCTTTATCTGCCTGGCAAAGCTTTTAATTGGCTTGATCTGTCATTCCGCTAGACATAAAGGGGACAATCCCCGGATTAGGAAGGAGCTCTCCAGCTCGGGTAAGGAGTCTCAAGGCAAGGTAGGC
[0172] A7 variant A7V7 sequence (299bp): SEQ ID NO: 8
[0173] ATGAGGACAAGGAACCATTTGGCCATTTGCCTTTGACACTTTAAAAAGATCGTGGTAAAAT ACTGGGGGAAGCCCCCAGCCTTGCCTGAGCCCCGGAGCTGGCCAGGGGCTTCCCAGTGGT CCCCAGGAACCCTCGACAGGGGCCCTTTATCTGCCTGGCAAAGCTTTTAATTGGCTTGAT CTGTCATTCCGCTAGACATAAAGGGGACAATCCCCGGATTAGGAAGGAGCTCTCCAGCT CGGGTAAGGAGTCTCAAGGCAAGGTAGG
[0174] A7 variant A7V8 sequence (269 bp): SEQ ID NO: 9
[0175] ATGAGGACAAGGAACCATTTGGCCATTTGCCTTTGACACTTTAAAAAGATCGTGGTAAAAT ACTGGGGGAAGCCCCCAGCCTTGCCTGAGCCCCGGAGCTGGCCAGGGGCTTCCCAGTGGT CCCCAGGAACCCTCGACAGGGGCCCTTTATCTGCCTGGCAAAGCTTTTAATTGGCTTGAT CTGTCATTCCGCTAGACATAAAGGGGACAATCCCCGGATTAGGAAGGAGCTCTCCAGCT CGGGTAAGGAGTCTCAAGGCAAGGTAGG
Claims
1. An isolated nucleic acid that has promoter activity in cone cells, characterized in that: The isolated nucleic acid comprises a nucleotide sequence that has at least about 50% identity with a nucleotide sequence selected from any one of SEQ ID NO:1-9.
2. The isolated nucleic acid according to claim 1, characterized in that: The isolated nucleic acid comprises a nucleotide sequence having at least about 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identity with a nucleotide sequence selected from any one of SEQ ID NO:1-9.
3. The isolated nucleic acid according to claim 1 or 2, characterized in that: The isolated nucleic acid has cone cell-specific promoter activity.
4. The isolated nucleic acid according to any one of claims 1-3, characterized in that: The isolated nucleic acid contains a nucleotide sequence selected from any one of SEQ ID NO:1-9.
5. The isolated nucleic acid according to any one of claims 1-4, characterized in that: The isolated nucleic acid consists of a nucleotide sequence selected from any one of SEQ ID NO:1-9.
6. An expression box, characterized in that: The expression cassette contains the isolated nucleic acid according to any one of claims 1-5.
7. The expression box according to claim 6, characterized in that: The expression cassette further comprises a target nucleic acid operatively linked to the isolated nucleic acid according to any one of claims 1-5.
8. The expression box according to claim 7, characterized in that: The target nucleic acid is a nucleic acid that encodes the target polypeptide.
9. The expression box according to claim 8, characterized in that: The target polypeptide is a therapeutic protein, an optogenetic kinetic protein, or a reporter protein.
10. The expression box according to claim 8, characterized in that: The target peptides are selected from MT-ND4, MT-ND1, MT-ND6, MT-CYB, MT-CO3, MT-ND5, MT-ND2, MT-COI, MT-ATP6, MT-ND4L, OPA1, OPA3, OPA7, GUCA1A, PDE6C, GNAT2, ABCA4, RPGR, CRX, CNGA3, CNGB3, ACO2, GDNF, VEGF, CNTF, FGF2, BDNF, EPO, BCL2, BCL2L1, endostatin, angiostatin, sFlt, IL10, IL1R1, TGFBI, IL4, and RdCVF.
11. The expression box according to claim 8, characterized in that: The target polypeptide is the Cas9 protein.
12. The expression box according to claim 8, characterized in that: The target polypeptide is an optogenetic activator.
13. The expression box according to claim 12, characterized in that: The optogenetic activator is selected from rhodopsin, photoopsin, melanopsin, pineal opsin, pineal paraopsin, VA opsin, periopsin, neuroopsin, brain opsin, retinal pigment, RGR opsin, microbial opsins with redshifted spectral properties (e.g., ReaChR, Chrimson, or ChrimsonR), vertebrate opsins that recruit Gi / o signal transduction (e.g., short-wavelength or long-wavelength vertebrate opsins), channel rhodopsin from Chlamydomonas microalgae (e.g., channel rhodopsin-1 and channel rhodopsin-2), and variants of the above proteins.
14. The expression box according to claim 8, characterized in that: The target polypeptide is an optogenetic inhibitor.
15. The expression box according to claim 14, characterized in that: The optogenetic inhibitors are selected from halophilic rhodopsin (e.g., NpHR, eNpHR2.0, eNpHR3.0, and Halo57), archaeal rhodopsin (e.g., Arch and AR-3), bacterial rhodopsin (e.g., eBR, Proteobacterial rhodopsin, and Xanthomonas rhodopsin), spotted coccidioidomycete fungal opsin (Mac), great white shark cross-halophilic rhodopsin, and variants of the above proteins.
16. The expression box according to claim 8, characterized in that: The target polypeptide is selected from fluorescent proteins, calcium indicators, alkaline phosphatase, β-galactosidase, β-lactamase, horseradish peroxidase, and variants of the above proteins.
17. The expression box according to claim 7, characterized in that: The target nucleic acid encodes a nucleic acid selected from siRNA, shRNA, RNAi, miRNA, antisense RNA, ribozymes, and deoxyribozymes.
18. A carrier, characterized in that: The vector comprises the isolated nucleic acid according to any one of claims 1-5 or the expression cassette according to any one of claims 6-17.
19. The carrier according to claim 18, characterized in that: The vector is a viral vector.
20. The carrier according to claim 18 or 19, characterized in that: The vector is a retroviral vector or a parvovirus vector.
21. The carrier according to any one of claims 18-20, characterized in that: The vector is MoMLV vector, MSCV vector, SFFV vector, MPSV vector, SNV vector, lentiviral vector, adenovirus vector, adeno-associated virus (AAV) vector, simian virus 40 vector, bovine papillomavirus vector, Epstein-Barr virus vector, herpesvirus vector, vaccinia virus vector, Harvey mouse sarcoma virus vector, mouse mammary tumor virus vector, or Lauer's sarcoma virus vector.
22. A viral particle characterized by: The viral particles comprise a vector according to any one of claims 18-21.
23. The virus particle according to claim 22, characterized in that: The carrier is an AAV carrier.
24. The virus particle according to claim 23, characterized in that: The serotypes of the AAV vector are selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, and AAVdj.
25. The virus particle according to claim 23, characterized in that: The serotype of the AAV vector is selected from AAV-2, AAV-5, AAV2-7m8, AAV-9 and AAV-8.
26. The virus particle according to claim 23, characterized in that: The serotype of the AAV vector is AAV-2, AAV-8, or AAV2-7m8.
27. A type of cell characterized by: The cell comprises isolated nucleic acid according to any one of claims 1-5, expression cassette according to any one of claims 6-17, vector according to any one of claims 18-21, or viral particles according to any one of claims 22-25.
28. The cell according to claim 26, characterized in that: The cells in question are cone cells.
29. The cell according to claim 26, characterized in that: The cells in question are retinal pigment epithelial cells (RPE).
30. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises isolated nucleic acid according to any one of claims 1-5, expression cassette according to any one of claims 6-17, vector according to any one of claims 18-21, viral particles according to any one of claims 22-25 or cells according to any one of claims 26-28, and pharmaceutically acceptable excipients.
31. A method for treating an eye disease, characterized in that: The method comprises administering to a patient in need a therapeutically effective amount of the isolated nucleic acid according to any one of claims 1-5, the expression cassette according to any one of claims 6-17, the vector according to any one of claims 18-21, the viral particles according to any one of claims 22-25, the cells according to any one of claims 26-28, or the pharmaceutical composition according to claim 29.
32. The method according to claim 30, characterized in that: The nucleic acid, expression cassette, vector, viral particle, cell, or drug composition is administered via intraocular delivery.
33. The method according to claim 30 or 31, characterized in that: The nucleic acid, expression cassette, vector, viral particle, cell, or drug composition is administered via subretinal, intravitreal, or choroidal administration.
34. The method according to any one of claims 30-32, characterized in that: The eye disease in question is a hereditary retinal disease (IRD).
35. The method according to any one of claims 30-33, characterized in that: The eye diseases mentioned are selected from retinitis pigmentosa (RP), age-related macular degeneration, Sturges disease, Lieber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Lieber's congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best's disease, choroidal agenesis, blanket retinal degeneration, and achromatopsia (rod monochromaticity).
36. The method according to any one of claims 30-34, characterized in that: The method further includes administering at least one additional therapeutic agent to the patient.
37. The method according to claim 35, characterized in that: The therapeutic agent is selected from corticosteroids, antibiotics, analgesics, immunosuppressants, nutritional factors, and any combination thereof.
38. Use of the isolated nucleic acid according to any one of claims 1-5, the expression cassette according to any one of claims 6-17, the vector according to any one of claims 18-21, the viral particle according to any one of claims 22-25, the cell according to any one of claims 26-28, or the pharmaceutical composition according to claim 29 in the preparation of a medicament for treating eye diseases.
39. The use according to claim 37, characterized in that: The drug is administered via intraocular delivery.
40. The use according to claim 37 or 38, characterized in that: The drug is administered via subretinal, intravitreal, or choroidal administration.
41. The use according to any one of claims 37-39, characterized in that: The eye disease in question is a hereditary retinal disease (IRD).
42. The use according to any one of claims 37-40, characterized in that: The eye diseases mentioned are selected from retinitis pigmentosa (RP), age-related macular degeneration, Sturges disease, Lieber's hereditary optic neuropathy, cone / rod dystrophy (CD / CRD), Lieber's congenital amaurosis (LCA), diabetic retinopathy, retinal detachment, Best's disease, choroidal agenesis, blanket retinal degeneration, and achromatopsia (rod monochromaticity).
43. The use according to any one of claims 37-41, characterized in that: The drug further comprises at least one additional therapeutic agent.
44. The use according to claim 42, characterized in that: The therapeutic agent is selected from corticosteroids, antibiotics, analgesics, immunosuppressants, nutritional factors, and any combination thereof.
45. A method for expressing a target polypeptide or nucleic acid in cells, characterized in that: The method includes introducing the isolated nucleic acid according to any one of claims 1-5, the expression cassette according to any one of claims 6-17, the vector according to any one of claims 18-21, or the viral particle according to any one of claims 22-25 into a cell.
46. The method according to claim 44, characterized in that: The cells in question are cone cells.
47. The method according to claim 44 or 45, characterized in that: The expression is specific to cone cells.
48. The method according to claim 44, characterized in that: The cells in question are retinal pigment epithelial cells (RPE).
49. The method according to any one of claims 44-47, characterized in that: The method described is an in vitro method.
50. The method according to any one of claims 44-47, characterized in that: The method described is an in vivo method.
51. The method according to any one of claims 44-47, characterized in that: The method described is an in vitro method.