Inducible constructs

Abstract

The present disclosure provides inducible constructs comprising a transcription initiator and / or a transcription regulator. These constructs can be used to drive gene expression in response to a particular cellular state, such as in the context of antigen stimulation. In some embodiments, these constructs are integrated as part of a regulatory circuit, useful for controlling expression and regulation of cells expressing engineered receptors.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 479,176, filed January 9, 2023; U.S. Provisional Patent Application No. 63 / 479,178, filed January 9, 2023; and U.S. Provisional Patent Application No. 63 / 479,177, filed January 9, 2023, the contents of which are incorporated herein by reference in their entirety.

[0003] Reference to Sequence Listing

[0004] The contents of the electronic sequence list (OTPC_034_01WO_SeqList_ST26.xml; size: 8,670,645 bytes; creation date: January 3, 2024) are incorporated herein by reference in their entirety. Background Technology

[0005] Endogenous or unmodified exhausted immune cells (e.g., T cells) may lose their high proliferative capacity and cytotoxicity, ultimately leading to cell death. Multiple factors can contribute to immune cell exhaustion, such as persistent antigen exposure (e.g., during infection) and the long-term presence of allogeneic antigens after organ transplantation. Furthermore, certain tumor and cancer-associated cells can actively induce cell exhaustion at the tumor site, thereby protecting the tumor from attack by the activity of endogenous or unmodified T cells. Immune cell exhaustion also exists in the context of engineered T-cell therapy. Engineered immune cells expressing chimeric antigen receptors (CARs) or T-cell receptors (TCRs) may exhaust in the same manner as endogenous or unmodified T cells, thereby diminishing their therapeutic efficacy.

[0006] For engineered immunocellular therapies, improving efficacy by reducing cell exhaustion and enhancing durability remains a pressing clinical need. This disclosure addresses this need by providing compositions and methods for delaying or reducing immune cell exhaustion. Summary of the Invention

[0007] The present disclosure provides one or more inducible nucleic acid constructs, wherein each construct comprises a transcriptional initiator, or a transcriptional initiator and a transcriptional regulator. In some embodiments, the construct can be non-naturally occurring, and the transcriptional regulator and the transcriptional initiator each comprise a concatemer of transcription factor binding motifs that are used to bind more than one unique transcription factor, or to bind the same transcription factor at more than one site. In some embodiments, the one or more nucleic acid constructs comprising a transcriptional initiator or a transcriptional regulator can sense a cell state, and its sequence can be selected from any one or more of SEQ ID NOs: 175-9790. In another aspect, provided herein is the use of the one or more nucleic acid constructs, including for selecting one or more sequences that are responsive to one or more cell states, wherein the cell states include antigen receptor activation, cell stimulation, cell exhaustion, cell rest, and epigenetic regulation.

[0008] Disclosed herein are nucleic acid constructs comprising a transcriptional initiator or a transcriptional initiator and a transcriptional regulator. In some embodiments, the transcriptional regulator and the transcriptional initiator each comprise a concatemer of transcription factor binding motifs that are used to bind more than one unique transcription factor, or to bind the same transcription factor at more than one site, and wherein the construct is non-naturally occurring.

[0009] In some embodiments, the nucleic acid construct comprises a transcriptional regulator and a transcriptional initiator. In some embodiments, the transcriptional regulator is located 5’ to the transcriptional initiator, or the transcriptional regulator is located 3’ to the transcriptional initiator.

[0010] In some embodiments, the construct does not comprise a combination of: a transcriptional regulator comprising a NFAT sequence, an IRF4 sequence, an AICE sequence, an ISRE sequence; and a transcriptional initiator comprising a human beta globin sequence. In some embodiments, the construct does not comprise the sequence GGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGAATTCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC (SEQ ID NO: 9786).

[0011] In some embodiments, the construct does not comprise a combination of: a transcriptional modulator comprising a NFAT sequence; and a transcriptional initiator comprising a YB-TATA sequence.

[0012] In some embodiments, the construct does not comprise the sequence GGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGAATTCCTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9787).

[0013] In some embodiments, the tandem of transcriptional modulators comprises two or more repeat sequences, wherein the two or more repeat sequences comprise identical sequences, or do not comprise identical sequences.

[0014] In some embodiments, the tandem of transcriptional modulators binds more than one unique transcription factor, and / or binds the same transcription factor at more than one site.

[0015] In some embodiments, the tandem comprises a linker sequence between the repeat sequences, and the linker sequence can comprise one or more of the following sequences: TACGCT, TGATCT, TGCTTT, and TGCCCGT.

[0016] In some embodiments, the transcriptional modulator comprises a sequence of one or more of the following untranscribed genomic sequences isolated or derived from: BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORa, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

[0017] In some embodiments, the transcriptional modulator comprises a sequence of one or more of the non-translated genomic sequences isolated from or derived from NFAT, NFkB, REL, RELA, IRF2, GATA3, and ATF3.

[0018] In some embodiments, the transcriptional modulator comprises a sequence derived from a non-translated genomic sequence of NFAT, optionally comprising a sequence that is any one or more of SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

[0019] In some embodiments, the transcriptional modulator comprises a sequence derived from a non-translated genomic sequence of NFkB, optionally comprising a sequence that is any one or more of SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

[0020] In some embodiments, the transcriptional modulator comprises a sequence derived from a non-translated genomic sequence of RELA, optionally comprising a sequence that is any one or more of SEQ ID NOs: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

[0021] In some embodiments, the transcriptional modulator comprises a sequence derived from a non-translated genomic sequence of IRF2, optionally comprising a sequence that is any one or more of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

[0022] In some embodiments, the transcriptional modulator comprises a sequence derived from a non-translated genomic sequence of GATA3, optionally comprising a sequence that is any one or more of SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855.

[0023] In some embodiments, the transcriptional modulator comprises a sequence derived from an untranslated genomic sequence of ATF3, optionally comprising a sequence that is any one or more of SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

[0024] In some embodiments, the transcriptional modulator is inducible, or the construct is inducible.

[0025] In some embodiments, the transcriptional initiator comprises a classical promoter, which comprises a minimal promoter.

[0026] In some embodiments, the minimal promoter comprises a sequence isolated from or derived from one or more of minimal promoter-1 (“minPl”), YB-TATA, and human beta globin.

[0027] In some embodiments, the minimal promoter comprises one or more of the following elements: MinPl having the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788); MinP2 = having the sequence

[0028] TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789); and MinP3 = having the sequence CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

[0029] In some embodiments, the transcriptional initiator comprises a transcription factor binding motif.

[0030] In some embodiments, the transcriptional initiator comprises a motif isolated from or derived from an untranslated genomic sequence of a transcription factor, or comprises a mammalian promoter sequence.

[0031] In some embodiments, the motif comprises a sequence isolated from or derived from one or more of the following: BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORa, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

[0032] In some embodiments, the transcription initiator comprises a sequence isolated from or derived from one or more of the following: NFAT, NFkB, REL, RELA, IRF2, GATA3, and ATF3.

[0033] In some embodiments, the transcription initiator comprises a sequence derived from an untranscribed genomic sequence of NFAT, optionally comprising a sequence that is any one or more of SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

[0034] In some embodiments, the transcription initiator comprises a sequence derived from an untranslated genomic sequence of NFkB, optionally comprising a sequence that is any one or more of SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

[0035] In some embodiments, the transcription initiator comprises a sequence derived from an untranslated genomic sequence of REL, optionally comprising a sequence that is any one or more of SEQ ID NOs: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

[0036] In some embodiments, the transcription initiator comprises a sequence derived from an untranslated genomic sequence of RELA, optionally comprising a sequence that is any one or more of SEQ ID NOs: 4484-4499, 4994-5009, and 9630-9645.

[0037] In some embodiments, the transcription initiator comprises a sequence derived from an untranslated genomic sequence of IRF2, optionally comprising a sequence that is any one or more of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

[0038] In some embodiments, the transcription initiator comprises a sequence derived from an untranslated genomic sequence of GATA3, optionally comprising a sequence that is any one or more of SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855.

[0039] In some embodiments, the transcription initiator comprises a sequence derived from an untranslated genomic sequence of ATF3, optionally comprising a sequence that is any one or more of SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

[0040] In some embodiments, the transcription initiator comprises any one or more of SEQ ID NOs: 175-9781, or a concatemer thereof.

[0041] In some embodiments, the construct further comprises an integration sequence that is capable of inducing or increasing insertion of the construct into a target site.

[0042] In some embodiments, the vector or chromosome comprises the target site.

[0043] In some embodiments, the integration sequence comprises a first or 5’ integration sequence and a second or 3’ integration sequence.

[0044] In some embodiments, the integration sequence comprises a homologous sequence corresponding to the insertion site to facilitate homologous recombination.

[0045] In some embodiments, the integration sequence comprises a transposable element to facilitate transposition, and in some embodiments, the transposable element comprises an insertion sequence and / or a transposon sequence.

[0046] In some embodiments, the integration sequence comprises a first 5' end repeat sequence or a second 3' end repeat sequence.

[0047] In some embodiments, the integration sequence comprises a first 5' end repeat sequence and a second 3' end repeat sequence.

[0048] In some embodiments, the first 5' end repeat sequence or the second 3' end repeat sequence comprises a long terminal repeat sequence (LTR).

[0049] In some embodiments, the first 5' end repeat sequence or the second 3' end repeat sequence comprises an inverted terminal repeat sequence (ITR).

[0050] In some embodiments, the construct further comprises a reporter sequence.

[0051] In some embodiments, the reporter sequence comprises a fluorescent protein, including a green fluorescent protein (GFP).

[0052] Also disclosed herein is a vector that can comprise a construct as described above. The vector can comprise a mammalian expression vector capable of expressing the construct in a mammalian cell. The vector can also comprise an expression vector capable of expressing the construct in a human cell. In some embodiments, the vector can comprise a delivery vector capable of delivering the construct to a mammalian cell or a human cell.

[0053] Also disclosed herein is a library that can comprise a construct as described above or a vector as described above.

[0054] In some embodiments, the library can comprise a plurality of constructs as described above or a plurality of vectors as described above.

[0055] Also disclosed herein is a cell comprising a construct as described above, a vector as described above, or a library as described above. In some embodiments, the cell is an immune cell, a stem cell, a progenitor cell, a precursor cell, a naive cell, a differentiated cell, a T cell, a B cell, a macrophage, an NK cell, an in vitro or ex vivo cell, a primary cell, or a cultured cell.

[0056] Also disclosed herein is the use of a construct as described above, a vector as described above, a library as described above, or a cell as described above, including for selecting a sequence responsive to one or more of the following factors: antigen receptor activation, cell stimulation, cell exhaustion, cell rest, and epigenetic regulation. In some embodiments, the cell stimulation can be early stimulation or late stimulation.

[0057] In some embodiments, the antigen receptor is a chimeric antigen receptor.

[0058] In some embodiments, the cell is a T cell, and wherein the antigen receptor is an endogenous or exogenous T cell receptor (TCR).

[0059] Also disclosed herein are uses of a construct as described above, a vector as described above, a library as described above, or a cell as described above, including for modulating transcription of an exogenous protein in response to one or more of: antigen receptor activation, cell stimulation, cell exhaustion, cell rest, and epigenetic regulation.

[0060] In some embodiments, the exogenous protein is one or more of: an engineered receptor, a cytokine, or a degrader. BRIEF DESCRIPTION OF DRAWINGS

[0061] Various objects and advantages of the application will become apparent from the following detailed description taken in conjunction with the accompanying drawings, which illustrate, by way of example, the principles of the application.

[0062] Figure 1A A schematic diagram depicting an exemplary CAR degradation feedback loop initiated by CAR signaling.

[0063] Figures 1B-1D A plot depicting the predicted expression levels of a CAR and a degrader in an immune cell over time in the presence of antigen stimulation, wherein the expression of the degrader is driven by a cell state at or near an exhausted state.

[0064] Figure 2To illustrate, an example pattern of activity induced by the constructs of the application in response to either (1) a pulsed T cell stimulation (left panel), or (2) a persistent T cell stimulation sufficient to cause the appearance of T cell exhaustion (right panel) is depicted. Both pulsed and persistent stimulation (with or without concomitant exhaustion) can be used for the transcriptional dynamics of the inducible constructs of the disclosure. As shown in the left panel, under example pulsed stimulation conditions, the "stimulation on" promoter activity is low prior to T cell stimulation by antigen, and transiently increases when stimulation occurs. Under example pulsed stimulation conditions, as the antigen available to the T cell is cleared, the "stimulation on" activity of the promoter decreases, but this activity again increases upon repeated antigen stimulation. As shown in the left panel, under example pulsed stimulation conditions, the "stimulation off" promoter activity is high prior to T cell stimulation by antigen, and transiently decreases when stimulation occurs. Under example pulsed stimulation conditions, as the antigen available to the T cell is cleared, the "stimulation off" activity of the promoter increases, but this activity again decreases upon repeated antigen stimulation. As shown in the right panel, under persistent stimulation conditions, the "stimulation on" promoter activity is low prior to T cell stimulation by antigen, and increases when stimulation occurs. As shown in the right panel, under persistent stimulation conditions, the "stimulation off" promoter activity is high prior to T cell stimulation by antigen, and decreases when stimulation occurs. As shown in the right panel, under persistent stimulation conditions, the T cell can undergo exhaustion after a period of stimulation. In some embodiments of the disclosure, the activity of the stimulation on promoter can be induced at or prior to the onset of T cell exhaustion, in order to prevent or delay the occurrence of exhaustion. In some embodiments of the disclosure, the activity of the stimulation off promoter can be decreased at or prior to the onset of T cell exhaustion, in order to prevent or delay the occurrence of exhaustion.

[0065] Figure 3The diagram illustrates a series of exemplary constructs used in a massively parallel reporter gene analysis (MPRA) (top figure), along with the experimental design for RNA and DNA collection and sequencing at each time point for the tested unstimulated, stimulated, and resting conditions. Transcriptional levels were measured using RNA-seq, and copy number normalization correction for enhancer-promoter (EP) pairs was performed using DNA-seq. In the construct structures depicted in this figure, approximately one million combinations of 50,000 different enhancer sequences were used to form unique combinations with 9,000 promoter sequences. Libraries containing over one million constructs were functionally tested to identify constructs exhibiting inducible activity patterns under specific conditions or induced cell states (such as stimulated, unstimulated, pulsatile stimulation, sustained stimulation, resting, and exhaustion). In summary, the MPRA consisted of: resuscitating T cells on day 0, transducing the resuscitated cells with a “tool-like” CAR on day 1, and enriching CD19+ cells on day 4 (see detailed protocol in Example 1). Both stimulated and unstimulated conditions began on day 7 (relative to day 0 recovery). Resting conditions began on day 14 (relative to day 0 recovery). Abbreviations: Long terminal repeat (LTR), barcode (BC), 5' untranslated region (UTR), green fluorescent protein (GFP).

[0066] Figure 4 A series of graphs depict four exemplary activity patterns of four EP pairs selected from a library containing hundreds of thousands of EP pairs. In each graph, the activity of the exemplary constructs is shown as a function of transcription rate (left) or log transcription rate (right) over time (in days).

[0067] Figure 5 A series of graphs depict exemplary activity patterns of EP pairs selected for in-depth characterization. From over one million constructs, approximately 174 were selected for further analysis. In each graph, the activity of the exemplary constructs is shown as a function of transcription rate (left) or log transcription rate (right) over time (in days).

[0068] Figures 6A-6B The diagram illustrates the functional characterization process of the EP pair. Figure 6A Depicting Figure 6B The experimental timeline of the described procedure is provided in Example 1. This initial screening experiment was designed to: (1) identify EP pairs that can drive protein expression, and (2) classify EP pairings into three categories based on qualitative behavioral patterns: stimulus-initiated, stimulus-off, and oscillatory.

[0069] Figure 7A series of graphs depicting the activity of control constructs or constructs of the present disclosure comprising EP pairs under both stimulated and unstimulated conditions. For each graph, normalized fluorescence intensity (expressed in arbitrary fluorescence units) is plotted as a function of cell confluency (expressed in percent) over time (in days). For control constructs, the MND is known to have constitutive activity, while the present disclosure shows that the activity of the concatemerized NFkB (10xNFkB) can be induced in the presence of antigen, thus its activity follows a stimulus-onset pattern. For EP pair constructs, the low cell confluency in this experiment makes it difficult to identify constructs that are still active under unstimulated conditions. However, several EP pair constructs are observed to have inducible activity under stimulated conditions.

[0070] Figures 8A-8C A series of graphs showing the dynamic range of EP pairings characterized according to the protocol described in Figures 6A-6B Figure 8A The maximum expression level of each construct in this study is shown, with data for the MND and 10xNFkB control constructs labeled. Figure 8B The minimum expression level of each construct in this study is shown, with data for the MND and 10xNFkB control constructs labeled. Figure 8C The expression range of each construct in this study is shown, with data for the MND and 10xNFkB control constructs labeled. In some embodiments, constructs with a larger dynamic range, including the minimum expression level under unstimulated conditions, are ideal constructs for stimulus-onset circuits.

[0071] Figure 9 A series of graphs depicting the RNA and protein produced by exemplary constructs of the present disclosure comprising EP pairs. As shown in the right panel, not all RNA and protein data show agreement at the qualitative level. However, each construct of the present disclosure can be functionally characterized for its transcriptional activity according to cell activity (e.g., exposure to antigen) or cell state (e.g., stimulation and / or exhaustion). In some embodiments, the presence or absence of a 5’ UTR sequence, or the composition of a 5’ UTR sequence, can influence the translational behavior of transcripts produced under the control of a construct of the present disclosure.

[0072] Figure 10 is a repeat of the study performed in Figure 9 Notably, this study provides data under unstimulated conditions at a higher cell confluency compared to the study in Figure 9

[0073] Figure 11 ​​A pair of schematics depicting the hybrid screening process of the disclosure containing EP pair (see SEQ ID Nos: 1-174) constructs, a schematic of the driving of “tool” CAR expression in T cells (top) and a schematic of the experimental design of the screening (bottom), respectively. Control constructs contain the MND constitutive promoter and the 10xNFkB inducible promoter.

[0074] Figure 12 A pair of graphs depicting the process of candidate construct enrichment selection based in part on the results of negative selection of exhausted T cells, identified in this embodiment as CD39+TIGIT+.

[0075] Figure 13 A schematic depicting the experimental design of a confirmatory three-donor assay employing the best performing EP pairs identified in the preliminary screening using only a single donor. In the preliminary screening, these test constructs included 26 constructs driven by EP pair driving tool CAR constructs, and four control constructs (constructs driving tool CAR expression by the MND promoter and the 10xNFkB promoter, each control promoter with and without a barcode, respectively). The preliminary screening was designed to identify those constructs demonstrating the most significant effect on target cancer cell killing in vitro by comparison to the activity of each control construct. In this confirmatory screening, nine constructs driven by selected EP pairs driving tool CAR constructs were used (see Figure 14 and Figure 15 ), and two control constructs (the same as used in the preliminary screening).

[0076] Figure 14 A series of graphs depicting the target cell killing data from each round of experiments in the confirmatory study described in Figure 13 In each round of experiments, each construct drove tool CAR expression and the ability of each construct to kill target cancer cells (H1975 mKate cells) is represented as a function of the change in target cell count normalized to time = 0 over time (in hours). The data show that the “OTP-CSF2” EP pair demonstrates comparable killing to the construct containing the control 10xNFkB promoter (the construct used to drive expression of the same CAR). The data further suggest that the “RPS6KA1-RSRP1” EP pair can be used as a regulated alternative to replace the constitutive control promoter MND.

[0077] Figure 15 A series of graphs depicting the target cell killing data from each of the three donors expressing Figure 13T cell secretion of cytokines (IL-2 and interferon-gamma) for each test construct. Data show that both the “OTP-CSF2” and “RPS6KA1-RSRP1” EP pairings exhibit functional activity at least comparable to the control constructs with the MND promoter and 10x NFkB promoter, respectively. Furthermore, when the “OTP-CSF2” EP pairing drives CAR expression, T cells exhibit higher levels of IL-2 expression than when the MND control promoter drives expression of the same CAR. The “RPS6KA1-RSRP1” EP pairing exhibits higher overall cytokine expression levels than the other seven test constructs, a result that is consistent with Figure 14 The presented target cell killing data are consistent with the above.

[0078] Figures 16A-16B A series of graphs depicting CAR expression levels for each control construct (containing the MND promoter and 10x NFkB promoter, respectively) and the two test constructs (containing the “OTP-CSF2” and “RPS6KA1-RSRP1” EP pairings, respectively) following one round of antigen stimulation. Figure 16A A series of cell sorting plots showing unstimulated (top panel) and stimulated (H1975-mKate target cells added, bottom panel) groups, with CD19 marker levels presented on the Y-axis and CAR expression levels presented on the X-axis. See Figure 11 for a schematic of the constructs and markers used. Shown in this figure are representative data from donor 2. Figure 16B A graph showing summary and quantitative data from all three donors in this study. Data are presented as the mean ± SEM of the % tCD19+CAR+ for each condition and each construct across the three donors. The above data collectively indicate that: (1) the “OTP-CSF2” construct shows stimulatory on / off activity following one round of passaged stimulation, and (2) the “RPS6KA1-RSRP1” exhibits a different expression dynamic compared to the MND control construct, but a similar functional readout.

[0079] Figure 17A table summarizing exemplary activities of exemplary constructs of the disclosure is provided. For example, NFkB, whether single NFkB or concatenated as 10xNFkB, as well as “OTP-CSF2” all exhibit stimulatory promoter activity, meaning that these promoters drive expression in response to stimulation of T cells or in response to T cells being in a stimulated cell state. More specifically, NFkB and “OTP-CSF2” both exhibit early stimulatory promoter activity, meaning that they rapidly respond to stimulation of T cells, or rapidly respond upon T cells entering a stimulated cell state. Early stimulatory promoters and late stimulatory promoters are two subcategories of stimulatory promoter behavior, the main difference being that late stimulatory promoters have a time delay in the onset of activity compared to early stimulatory promoters. Notably, the data provided in the disclosure identify at least one stimulatory off construct, which comprises an IRF2 promoter sequence.

[0080] Figure 18 A pair of schematic diagrams and corresponding graphs depict exemplary uses of constructs of the disclosure in a cellular circuit. The data show that under in vitro long-term stimulation conditions, an MSLN CAR regulated by NFkB shows improved killing capacity and cytokine production capacity compared to the same MSLN CAR under control of a MND constitutively expressed. DETAILED DESCRIPTION

[0081] Immune cells play a role in immune responses. For example, as one type of lymphocyte, T cells play a central role in adaptive immune responses. One of the functions of T cells is to effect immune-mediated cell death. CD8+ T cells, also known as killer T cells, are themselves cytotoxic and also recruit other cell types to collectively kill cancer cells and virus-infected host cells. CD4+ T cells, also known as helper T cells, then further activate memory B cells and killer T cells by secreting cytokines, thereby enhancing the immune response. Regulatory T cells, also known as suppressor T cells, allow immune cells to distinguish between invading cells and “self” cells, thereby preventing the occurrence of autoimmune responses.

[0082] Over time, T cells undergo a physiological change known as exhaustion, characterized by progressive loss of function and changes in the transcriptional profile. T cell exhaustion is mediated by a cascade of signaling molecules that ultimately form transcription factors that regulate gene expression, which in turn have a regulatory effect on T cell exhaustion. Exhausted T cells lose their high proliferative capacity and cytotoxicity, ultimately leading to cell death. A variety of factors can lead to T cell exhaustion, such as persistent antigen exposure during infection, and long-term presence of alloantigens after organ transplantation. In addition, certain tumors and cancer-associated cells are able to actively induce T cell exhaustion at the tumor site, rendering the tumor resistant to T cell activity. T cell exhaustion also occurs in the context of engineered T cell therapies. Engineered T cells expressing chimeric antigen receptors (CARs) or T cell receptors (TCRs) can undergo exhaustion in the same way as endogenous T cells, leading to reduced persistence.

[0083] Likewise, other engineered immune cells, such as engineered NK cells, engineered B cells, and engineered macrophages, can also undergo exhaustion and face similar issues.

[0084] Cell State

[0085] Provided herein are constructs that sense (e.g., respond to) cell states. These constructs can be used in any scenario where sensing of cell state is desired; in some embodiments, these constructs are particularly useful for modulating expression of exogenous engineered receptors in therapeutic immune cells, in order to reduce exhaustion and enhance persistence of immune cell therapies.

[0086] Immune cells (e.g., T cells) can exhibit a variety of cell states, including: an unstimulated state (e.g., prior to encountering an antigen), a stimulated state (e.g., during and after encountering an antigen), an exhausted state (e.g., after long-term persistent stimulation), and a resting state (e.g., after ceasing stimulation for a period of time). In some embodiments, other cell states can include, but are not limited to: a steady-state or healthy cell state, a mitotic cell state, a migratory cell state, an apoptotic cell state, a necrotic cell state, a stem or stem-like cell state, a senescent cell state, and the like. In some embodiments, cell states can be divided into different categories, including but not limited to: a functional state, an activity state, a nutritional state, a developmental / maturation state, a differentiation state, and the like. In some embodiments, cells can be defined as having characteristics of multiple cell states.

[0087] For example, engineered T cells expressing chimeric antigen receptors (CAR T cells) can be in an exhausted cell state after undergoing long-term persistent antigen stimulation. In such embodiments, one or more constructs of the present disclosure, if included in the engineered T cell along with the CAR, can sense the exhausted cell state of the CAR T cell, wherein the CAR T cell has undergone long-term persistent antigen stimulation. In some embodiments, one or more constructs of the present disclosure can sense the exhausted cell state of the CAR T cell and initiate transcription of one or more genes via one or more transcriptional initiators of the one or more constructs, thereby managing the exhausted state and enhancing cell persistence, as will be described in greater detail herein. In some embodiments, the one or more genes whose transcription is regulated can comprise a degrader, the transcription of which can result in a decrease in the level of the activated CAR in the cell, prompting a change in the cell state by allowing entry into a resting phase, which can cause the cell to enter a “resting” state from an exhausted state.

[0088] Figure 1A A schematic of an immune cell expressing a chimeric antigen receptor (CAR) is depicted. The CAR is stimulated in the presence of an antigen, resulting in activation of the immune cell. In some embodiments, the activation response includes upregulation of one or more transcription factors, elevating the transcriptional level of a cascade of transcription factor-dependent genes. Under long-term persistent antigen stimulation, the activated state of the CAR immune cell can gradually transition to an exhausted state. However, it can be desirable to introduce a feedback loop to regulate the response to activation. In some embodiments, the feedback loop can comprise a CAR degrader feedback loop. The CAR degrader feedback loop can include upregulation of a polypeptide capable of degrading the activated CAR (e.g., a “degrader” polypeptide), thereby attenuating the activation response. In some embodiments, the CAR degrader feedback loop can comprise a construct, wherein transcription of one or more genes of the construct can be initiated by signaling through the CAR, as Figure 1A depicted. In some embodiments, the construct can comprise one or more transcription initiators, or both one or more transcription initiators and one or more transcription regulators, which elements drive transcription of one or more genes within the construct in response to the cell state, thereby attenuating the activation response of the cell, as will be described in greater detail herein.

[0089] In some embodiments, the CAR degrader feedback loop can comprise a degrader, i.e., a peptide configured to degrade the activated CAR. Figures 1C-1D A plot of predicted expression levels of the CAR and the degrader in response to antigen stimulation is depicted when employing a cell state-sensing construct of the present disclosure. Without being bound by theory or mechanism, antigen stimulation can result in high expression of the CAR and initiation of an activation response within the immune cell. In the presence of persistent antigen stimulation, the immune cell can enter an exhausted cell state, asFigure 1C The exhausted cell state can result in decreased efficiency and cell survival of T cells, as well as decreased expression levels of CARs. The activation response within immune cells can result in increased expression levels of degraders. However, if the exhausted state of CAR immune cells occurs prior to the increased expression levels of degraders, the CAR immune cells can be exhausted, at which point the presence of degraders can not be functional. However, if the exhausted state of CAR immune cells can be sensed prior to the exhaustion of CAR immune cells, resulting in increased transcription of degraders, the CARs can be completed degraded prior to the exhaustion of CAR immune cells, resulting in the induction of a cell resting state (e.g., a period of time in which the CAR immune cells are not activated), extending the cell survival capacity. The period of time (e.g., resting period) in which the CAR immune cells are in a resting cell state can allow the CAR immune cells to recover from over-antigen stimulation prior to the antigen stimulation triggering an activation response again after the resting period. Ultimately, the decreased level of activation will result in decreased levels of degraders and promote increased expression levels of CARs. Figure 1D The CARs can be completed degraded prior to the exhaustion of CAR immune cells, resulting in the induction of a cell resting state (e.g., a period of time in which the CAR immune cells are not activated), extending the cell survival capacity. The period of time (e.g., resting period) in which the CAR immune cells are in a resting cell state can allow the CAR immune cells to recover from over-antigen stimulation prior to the antigen stimulation triggering an activation response again after the resting period. Ultimately, the decreased level of activation will result in decreased levels of degraders and promote increased expression levels of CARs.

[0090] More broadly, the transcriptional control of engineered receptor (e.g., CAR or TCR) degradation feedback loops can be engineered to respond to cell state. In some embodiments, one or more constructs can be engineered or generated to provide transcriptional control of one or more genes (e.g., degraders, CARs, or cytokines) in response to cell state. In some embodiments, one or more constructs can provide transcriptional control of one or more genes in response to cell state within a CAR T cell.

[0091] Dynamic transcriptional control can be achieved through timing of expression, dynamic of expression, level of expression, or responsiveness to cell state. The dynamic transcriptional control can be achieved through the interaction between a transcriptional initiator promoter sequence and a transcriptional regulator enhancer sequence. Figure 1D A schematic diagram depicting a construct comprising a transcriptional initiator promoter sequence operably linked to a gene, and one or more transcriptional regulators. In some embodiments, the transcriptional regulators can include regulatory elements (“CREs”), including enhancers, insulators, silencers, suppressors, and the like. For example, when the transcriptional initiator includes a promoter and the transcriptional regulator includes an enhancer, the enhancer can enhance transcription of the gene through the promoter operably linked to the gene.

[0092] Cell State-Sensing Constructs

[0093] The nucleic acid constructs of the present disclosure comprise a transcription initiator, or comprise a transcription initiator and a transcription regulator, wherein the transcription regulator and the transcription initiator each comprise a concatemer of transcription factor binding motifs, and wherein the construct is non-naturally occurring. The concatemer comprises sequences that can be derived from known promoter sequences. The concatemer of transcription factor binding motifs, referred to in the examples as concatemerized sequences, binds more than one unique transcription factor, or binds the same transcription factor at more than one site. It will be appreciated that non-naturally occurring sequences can include naturally occurring sequences assembled in a non-naturally occurring manner (including those isolated or derived from naturally occurring sequences). For example, in some embodiments, one or more naturally occurring sequences that are not adjacent within the genome can be arranged adjacent in the construct, thereby assembled in a non-naturally occurring manner.

[0094] As used herein, the transcription initiator of the present disclosure functions in a promoter-like manner and supports transcription factor binding to initiate transcription of a downstream gene under its control. As used herein, the transcription regulator of the present disclosure further modulates transcription of a downstream gene. In some embodiments, the transcription regulator is located 5’ of the transcription initiator. In some embodiments, the transcription regulator is located 3’ of the transcription initiator.

[0095] The transcription binding motifs can be derived from the non-exhaustive list of proteins: BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORa, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

[0096] In some embodiments, when the transcription initiator comprises one or more sequences from non-transcribed genomic sequences of NFAT; in some embodiments, the transcription regulator can comprise a sequence that is a sequence of any one or more of SEQ ID NOS: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

[0097] In some embodiments, the transcription initiator comprises one or more sequences from non-translated genomic sequences of NFkB; in some embodiments, the transcription regulator can comprise a sequence that is any one or more of SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

[0098] In some embodiments, when the transcription initiator comprises one or more sequences from non-translated genomic sequences of REL (including RELA or RELB); in some embodiments, the transcription regulator can comprise a sequence that is any one or more of SEQ ID NOs: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

[0099] In some embodiments, when the transcription initiator comprises one or more sequences from non-translated genomic sequences of IRF2; in some embodiments, the transcription regulator can comprise a sequence that is any one or more of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

[0100] In some embodiments, when the transcription initiator comprises one or more sequences from non-translated genomic sequences of GATA3; in some embodiments, the transcription regulator can comprise a sequence that is any one or more of SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855.

[0101] In some embodiments, when the transcription initiator comprises one or more sequences from non-translated genomic sequences of ATF3; in some embodiments, the transcription regulator can comprise a sequence that is any one or more of SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

[0102] In some embodiments, the construct comprises a transcription initiator. In other embodiments, one or more exemplary constructs can comprise a transcription initiator and a transcription regulator, as will be described in greater detail herein. In some embodiments, one or more constructs can also comprise an integration sequence that is capable of inducing or increasing insertion of the construct into a target site (e.g., of a vector or chromosome). The insertion sequence can comprise multiple insertion sequences. For example, in some embodiments, the insertion sequence can comprise a first integration sequence and a second integration sequence. In some embodiments, the first integration sequence can be a 5’ integration sequence and the second integration sequence can be a 3’ integration sequence. In some embodiments, the insertion sequence can comprise a homologous sequence corresponding to the insertion site in order to facilitate homologous recombination. In some embodiments, the integration sequence can comprise one or more transposable elements, which can help facilitate transposition. In some embodiments, the transposable element can comprise an insertion sequence and / or a transposon sequence. In some embodiments, the integration sequence can comprise a first 5’ end repeat sequence or a second 3’ end repeat sequence. In some embodiments, the construct can be inducible.

[0103] In some embodiments, the construct does not comprise either of: a transcription initiator comprising a human beta globin sequence, and a transcription regulator comprising either of: a nuclear factor of activated T cells (NFAT) sequence, an interferon regulatory factor 4 (IRF4) sequence, an activator protein 1 (AP-1)-IRF complex element (AICE) sequence, or an interferon-stimulated response element (ISRE) sequence. In some embodiments, the AICE sequence can comprise or encompass a sequence of IRF4 or IRF8, or a sequence derived from IRF4 or IRF8, wherein each sequence has BATF. In some embodiments, the AICE sequence can be derived from an untranslated region of IRF4, IRF8, and / or BATF. In some embodiments, the IRSE sequence can comprise the consensus sequence YAGTTTC(A / T)YTTTYCC, wherein “Y” is C or T. In some embodiments, the construct does not comprise a sequence having SEQ ID NO: 9786.

[0104] In some embodiments, the construct does not comprise either of: a transcription initiator comprising a YB-TATA sequence, and a transcription regulator comprising a NFAT sequence. In some embodiments, the construct does not comprise a sequence having SEQ ID NO: 9787.

[0105] Various constructs can exhibit dynamic behavior over time in response to antigenic stimulation. In some embodiments, constructs that exhibit similar dynamic behavior can be categorized into similar behavior patterns. For example, a construct can exhibit constitutive behavior, in which antigenic stimulation elicits transcription driven by a transcription initiator, in which the level of transcription remains relatively constant and is independent of continued antigenic stimulation. In some embodiments, a construct can exhibit "stimulus-on" behavior, in which antigenic stimulation elicits a significant increase in transcription driven by a transcription initiator. In some embodiments, this "stimulus-on" behavior can result in a level of transcription that remains high after an initial antigenic stimulation elicits transcription driven by a transcription initiator. In some embodiments, "stimulus-on" behavior can include where an initial antigenic stimulation elicits a significant increase in transcription driven by a transcription initiator (referred to herein as "early stimulus-on" behavior), or where long-term persistence of an initial antigenic stimulation elicits a significant increase in transcription driven by a transcription initiator (referred to herein as "late stimulus-on" behavior). In some embodiments, "stimulus-on" behavior can also include where antigenic stimulation elicits a single increase in transcription driven by a transcription initiator. In some embodiments, a single increase in transcription driven by a transcription initiator can be due to epigenetic regulation (e.g., DNA methylation / demethylation, histone modifications including acetylation, methylation, phosphorylation, and ubiquitination, etc.), other epigenetic-like transcriptional changes, or cellular regulation or transcriptional pathways. In other embodiments, "stimulus-on" behavior can also include where antigenic stimulation elicits multiple increases in transcription driven by a transcription initiator. In some embodiments, a transcription initiator can exhibit "stimulus-off" behavior, in which an initial antigenic stimulation elicits a decrease in transcription driven by a transcription initiator. In some embodiments, this "stimulus-off" behavior can result in a level of transcription that remains low after an initial antigenic stimulation, including a level of transcription that approaches zero or is about zero.

[0106] In some embodiments, one or more nucleic acid constructs can be inducible. In some embodiments, one or more inducible nucleic acid constructs can comprise one or more sequences that can regulate and initiate transcription of a gene, wherein the construct comprises one or more non-naturally occurring sequences. In some embodiments, a non-naturally occurring sequence can include a sequence isolated from or derived from a naturally occurring sequence or a non-naturally occurring sequence. It can be appreciated that a non-naturally occurring sequence includes naturally occurring sequences that are assembled in a non-naturally occurring manner (including those isolated from or derived from naturally occurring sequences). For example, in some embodiments, one or more naturally occurring sequences that are not adjacent within a genome can be arranged adjacent in a construct, thereby assembled in a non-naturally occurring manner.

[0107] In some embodiments, the construct can comprise a transcriptional initiator and a transcriptional regulator, and in some embodiments, the transcriptional initiator and the transcriptional regulator can be engineered to be responsive to a cell state or a change in cell state, as will be described in greater detail herein. For example, one construct can comprise an MND transcriptional initiator (e.g., a promoter) operably linked to a CAR. The MND transcriptional initiator can be constitutively active, wherein antigen stimulation triggers expression of the CAR. A second construct can comprise a transcriptional regulator adjacent to a transcriptional initiator operably linked to a reporter tag with a degrader. Antigen stimulation of the CAR triggers an activation response, wherein an endogenous signaling network can lead to transcriptional activation of the second construct comprising the degrader. The second construct can“sense” a cell state (e.g., by antigen stimulation activation) or a change in cell state, thereby triggering degrader transcription.

[0108] Exemplary Transcriptional Initiators

[0109] In some embodiments, the transcriptional initiator of the construct can comprise a nucleotide sequence that initiates transcription of a gene. In some embodiments, it is envisioned that the transcriptional initiator of the present disclosure construct can comprise a sequence similar to a previously characterized prototypical or canonical promoter. However, in other embodiments, it is envisioned that the transcriptional initiator can comprise a sequence that is not similar to a prototypical or canonical promoter, but still supports transcription initiation, and can exhibit promoter-like function. In some embodiments, the transcriptional initiator can comprise one or more transcription factor binding motifs. In some embodiments, the transcription factor binding motifs can be isolated from or derived from the untranslated region of a transcription factor, or another mammalian promoter sequence. The transcriptional initiator can be engineered, i.e., have its sequence optimized to drive gene transcription. In some embodiments, the transcriptional initiator can be inducible.

[0110] In some embodiments, the transcriptional initiator can comprise a minimal promoter sequence. A minimal promoter sequence can comprise the minimum number of base pairs within a canonical or non-canonical promoter that still enables driving gene transcription from the promoter. In some embodiments, the minimal promoter can comprise a sequence isolated from or derived from one or more of minimal promoter-1 (“minPl”), YB-TATA, and human beta globin. minPl can comprise the sequence: AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788). In some embodiments, the minimal promoter can comprise a sequence isolated from or derived from minimal promoter 2 (“minP2”) or minimal promoter 3 (“minP3”). In some embodiments, minP2 can comprise the sequence:

[0111] TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO:9789). In some embodiments, minP3 can comprise the sequence: CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTG GTACCGAGCTCGGATCCAGCCACC (SEQ ID NO:9790).

[0112] In some embodiments, the transcriptional initiator of the construct can be engineered to comprise a concatemer of one or more nucleic acid sequences. In some embodiments, the transcriptional initiator can comprise a concatemer of any sequence, including any of SEQ ID NOS: 175-509, 9793-9800. In some embodiments, the concatemer (e.g., the transcriptional initiator of the construct) can advantageously drive transcription at a higher rate compared to a non-concatemerized transcriptional initiator. In some embodiments, the concatemer can comprise two or more repeat sequences. The concatemer can be composed of multiple repeat sequences (e.g., multiple repeat units). In some embodiments, the concatemer can comprise at least about 3 repeat units, at least about 4 repeat units, at least about 5 repeat units, at least about 6 repeat units, at least about 7 repeat units, at least about 8 repeat units, at least about 9 repeat units, at least about 10 repeat units, at least about 11 repeat units, at least about 12 repeat units, at least about 13 repeat units, at least about 14 repeat units, or at least about 15 repeat units. In some embodiments, the total length of the concatemer can comprise a length of about 20 base pairs to about 200 base pairs. In some embodiments, the total length of the concatemer can comprise a length of no more than 150 base pairs. For example, the total length of the concatemer can be about 125 base pairs, about 130 base pairs, about 133 base pairs, about 134 base pairs, about 135 base pairs, about 136 base pairs, about 139 base pairs, about 140 base pairs, about 142 base pairs, about 145 base pairs, about 146 base pairs, about 147 base pairs, about 149 base pairs, or about 150 base pairs. The concatemer can comprise a linker sequence located between each repeat sequence. In some embodiments, the linker sequence can comprise one or more of the following sequences: TACGCT, TGATCT, TGCTTT, or TGCCCGT. In some embodiments, the linker sequence between each repeat sequence can be the same linker sequence, or can be a different linker sequence.

[0113] In some embodiments, two or more repeat sequences of the construct can comprise a transcription factor binding motif, or a motif derived from or isolated from an untranscribed genomic sequence of one or more transcription factors or one or more mammalian promoter sequences. In some embodiments, a sequence comprising a transcription factor binding motif can comprise a transcription factor binding motif that binds more than one type of transcription factor, or can bind the same type or same transcription factor at more than one site along the sequence. For example, in a transcriptional initiator comprising four repeat sequences separated by three linker sequences, each of the four repeat sequences can comprise the same transcription factor binding motif, such that one type of transcription factor can bind to multiple repeat sequences; or each or a portion of the repeat sequences can comprise different transcription factor binding motifs, such that different types of transcription factors can bind at the repeat sequences.

[0114] In some embodiments, a transcriptional initiator of the present disclosure can be composed of a concatemer of transcription factor consensus binding motifs. The concatemer can be homogenous (i.e., a concatemer of identical motifs); or can be heterogeneous (i.e., a concatemer of multiple different motifs). Table 1 provides exemplary transcription factor consensus binding motifs, which can be used in one or more concatemers of the present disclosure. In some embodiments, a cell sensing construct of the present disclosure can comprise a transcriptional initiator comprising any one or more transcription factor consensus binding motifs of Table 1; and can have any one or more sequences of SEQ ID NOs: 175-509, 9793-9088.

[0115] Transcriptional Modulators

[0116] In some embodiments, the construct can comprise a transcriptional regulator, or a transcriptional initiator and a transcriptional regulator. In some embodiments, a transcriptional regulator can directly or indirectly modulate transcription of one or more genes, and a transcriptional regulator can comprise one or more response elements. For example, in some embodiments, a transcriptional regulator can include an enhancer, a suppressor, and the like. In some embodiments, an enhancer can comprise or have a sequence similar to a previously characterized prototypical or canonical enhancer. However, in other embodiments, it is envisioned that the transcriptional regulator, including an enhancer, can comprise a sequence that is not similar to a prototypical or canonical enhancer, but still supports promoter-mediated transcriptional enhancement, and can exhibit enhancer function. In some embodiments, a transcriptional regulator can be inducible.

[0117] In some embodiments, the suppressor can be similar to a previously characterized prototype or canonical suppressor. However, in other embodiments, it is envisioned that the transcriptional regulator, including the suppressor, can comprise a sequence that is not similar to a prototype or canonical suppressor, but still supports promoter-mediated transcriptional repression and can exhibit suppressor function.

[0118] In some embodiments, the transcriptional regulator can comprise one or more repeat sequences. In some embodiments, each repeat sequence can be the same, or each repeat sequence or some of the repeat sequences can be different sequences. In some embodiments, the transcriptional regulator can comprise one or more sequences from the untranslated genomic sequence of one or more of the following genes: BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORa, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D. In some embodiments, the transcriptional regulator can comprise one or more sequences from the untranslated genomic sequence of one or more of the following genes: NFAT, NFkB, REL, RELA, IRF2, GATA3, and ATF.

[0119] In some embodiments, the transcriptional regulator comprises one or more sequences from the untranslated genomic sequence of NFAT. In some embodiments, the NFAT transcriptional regulator can comprise a sequence that is any one or more of SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

[0120] In some embodiments, the transcriptional regulator comprises one or more sequences from the untranslated genomic sequence of NFkB. In some embodiments, the NFkB transcriptional regulator can comprise a sequence that is any one or more of SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

[0121] In some embodiments, when the transcriptional modulator comprises one or more sequences from a non-translated genomic sequence of REL, including RELA or RELB. In some embodiments, a REL transcriptional modulator can comprise a sequence that is any one or more of SEQ ID NOs: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645. In some embodiments, a RELA transcriptional modulator can comprise a sequence that is any one or more of SEQ ID NOs: 4484-4499, 4994-5009, and 9630-9645. In some embodiments, a REL, RELA, or RELB transcriptional modulator can be used in conjunction with a minimal promoter. In some embodiments, a minimal promoter can comprise a sequence isolated from or derived from one or more of minimal promoter-1 (“minPl”), YB-TATA, and human beta globin. In some embodiments, a minimal promoter can comprise a sequence isolated from or derived from minimal promoter 2 (“minP2”) or minimal promoter 3 (“minP3”). MinPl can have the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788). MinP2 can have the sequence TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789). MinP3 can have the sequence

[0122]

[0123] TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

[0124] ​In some embodiments, the transcriptional regulator comprises one or more sequences from non-translated genomic sequences of IRF2. In some embodiments, the IRF2 transcriptional regulator can comprise a sequence that is any one or more of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607. In some embodiments, the IRF2 transcriptional regulator can be used in conjunction with a minimal promoter. In some embodiments, the minimal promoter can comprise a sequence isolated from or derived from one or more of minimal promoter-1 (“minPl”), YB-TATA, and human beta globin. In some embodiments, the minimal promoter can comprise a sequence isolated from or derived from minimal promoter 2 (“minP2”) or minimal promoter 3 (“minP3”). In some embodiments, minPl can comprise the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788). In some embodiments, minP2 can comprise the sequence:

[0125] TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789). In some embodiments, minP3 can comprise the sequence:

[0126] CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

[0127] In some embodiments, the transcriptional regulator can comprise one or more sequences from non-translated genomic sequences of GATA3. In some embodiments, the GATA3 transcriptional regulator can comprise a sequence that is any one or more of SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855. In some embodiments, the GATA3 transcriptional regulator can be used in conjunction with a minimal promoter. In some embodiments, the minimal promoter can comprise a sequence isolated from or derived from one or more of minimal promoter-1 (“minPl”), YB-TATA, and human beta globin. In some embodiments, the minimal promoter can comprise a sequence isolated from or derived from minimal promoter 2 (“minP2”) or minimal promoter 3 (“minP3”). In some embodiments, minPl can comprise the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788). In some embodiments, minP2 can comprise the sequence:

[0128] ("minP3"). In some embodiments, MinP1 can comprise the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788). In some embodiments, MinP2 can comprise the sequence:

[0129] TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789). In some embodiments, MinP3 can comprise the sequence:

[0130] CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

[0131] In some embodiments, the transcriptional regulator comprises one or more sequences from an untranslated genomic sequence of ATF3. In some embodiments, the ATF3 transcriptional regulator can comprise a sequence that is any one or more of SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

[0132] Exemplary Engineered Enhancer- Promoter Combinations

[0133] Also provided herein are engineered (e.g., non-naturally occurring) enhancer-promoter ("EP") combinations or pairings ("EP pairs") of one or more of the cell-sensing constructs disclosed herein. In some embodiments, a particular promoter and a particular enhancer can be paired together to drive the promoter-mediated transcription process, demonstrating predictable and consistent behavior, as will be described in greater detail herein. In some embodiments, the engineered enhancer-promoter combinations can include sequences isolated from or derived from transcription factor untranslated regions, promoters, and enhancers. In some embodiments, the enhancer-promoter pair can consist of an enhancer sequence and a promoter sequence. The sequences of the enhancer-promoter pair can be referred to herein as "EP pairing sequences" or "enhancer-promoter pair sequences."

[0134] In some embodiments, the transcriptional initiation promoter sequence can be adjacent to the transcriptional regulatory enhancer sequence. For example, the enhancer sequence can be located 5' of the promoter sequence, or the enhancer sequence can be located 3' of the promoter sequence. In some embodiments, in exemplary constructs, the enhancer sequence can be adjacent to the promoter sequence. For example, in some embodiments, the enhancer sequence can be located 5' of the promoter sequence, but in some embodiments, the enhancer sequence can be located 3' of the promoter sequence. In some embodiments, the promoter sequence can be located 3' of the enhancer sequence, or in some embodiments, the promoter sequence can be located 5' of the enhancer sequence.

[0135] In some embodiments, the enhancer-promoter pair can be bound together in an EP pairing sequence. In some embodiments, the enhancer-promoter pairing sequence can comprise between about 25 to about 5000 base pairs, including about 100 base pairs to about 1500 base pairs, about 200 base pairs to about 1400 base pairs, about 300 base pairs to about 1300 base pairs, about 400 base pairs to about 1300 base pairs, about 500 base pairs to about 1250 base pairs, about 600 base pairs to about 1250 base pairs, about 700 base pairs to about 1250 base pairs, about 800 base pairs to about 1200 base pairs, about 900 base pairs to about 1100 base pairs, and the like. In some embodiments, the EP pairing sequence can comprise at least about 25 base pairs, including about 50 base pairs, about 100 base pairs, about 150 base pairs, about 200 base pairs, about 300 base pairs, about 350 base pairs, about 400 base pairs, about 450 base pairs, about 500 base pairs, about 500 base pairs, about 600 base pairs, about 700 base pairs, about 800 base pairs, about 900 base pairs, about 1000 base pairs, or about any number of base pairs between about 25 base pairs to about 1000 base pairs. In some embodiments, the enhancer sequence and the promoter sequence can be linked together by a linker. In some embodiments, the linker can comprise one or more of the following sequences: TACGCT, TGATCT, TGCTTT, or TGCCCGT. In some embodiments, one or more of the constructs can further comprise an adaptor sequence located 5' and / or 3' of the enhancer-promoter pairing sequence. In some embodiments, the adaptor sequence can comprise the following sequences:

[0136] AAAGCACTCTTAGGCCTCTGCGTCTCATTCTGAAGACTCACGA (SEQ ID NO: 9801), or

[0137] AACGGAGTCTTCAACGTGAGACGGCTCGATGCCATAGTTCCTT (SEQ ID NO: 9801), although other linkers known in the art are contemplated.

[0138] In some embodiments, the one or more nucleic acid constructs can further comprise a barcode sequence operably linked to each EP-pairing sequence. In some embodiments, the operable linkage can include that the barcode sequence can be located at the 3’ end of the EP-pairing sequence, while in other embodiments, the barcode sequence can be located at the 5’ end of the EP-pairing sequence. In some embodiments, the barcode sequence can be located at the 3’ end of the promoter sequence, while in other embodiments, the barcode sequence can be located at the 5’ end of the promoter sequence. Likewise, in some embodiments, the barcode sequence can be located at the 3’ end of the enhancer sequence, while in other embodiments, the barcode sequence can be located at the 5’ end of the enhancer sequence.

[0139] In some embodiments, the nucleic acid construct can further comprise a 5’ untranslated region (UTR) located at the 3’ end of the EP-pairing sequence or the barcode sequence. In some embodiments, the 5’ UTR can be located at the 3’ end of the enhancer sequence, the 3’ end of the promoter sequence, or the 3’ end of the barcode sequence. In some embodiments, the 5’ UTR can be located at the 5’ end of the enhancer sequence, the 5’ end of the promoter sequence, or the 5’ end of the barcode sequence. In some embodiments, the promoter sequence, the enhancer sequence, or a combination thereof can comprise a sequence that can be isolated from or derived from a sequence of one or more human chromosomes comprising at least chromosome 1, chromosome 2, chromosome 3, chromosome 4, chromosome 5, chromosome 6, chromosome 7, chromosome 8, chromosome 9, chromosome 10, chromosome 11, chromosome 12, chromosome 13, chromosome 14, chromosome 15, chromosome 16, chromosome 17, chromosome 18, chromosome 19, chromosome 20, chromosome 21, chromosome 22, or chromosome 23. In some embodiments, the enhancer sequence can include a minimal sequence that exhibits enhancer activity function. In some embodiments, the promoter sequence can include a minimal promoter sequence, wherein the minimal promoter sequence exhibits promoter function or activity. In some embodiments, the minimal promoter sequence can include any one or more of the following sequences:

[0140] MinP1 having the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788); MinP2 having the sequence

[0141] TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789); or MinP3, having the sequence

[0142] TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789); or MinP3, having the sequence

[0143] In some embodiments, the enhancer sequence and the promoter sequence, each or in combination, can comprise a sequence of at least about 25 base pairs, at least about 50 base pairs, at least about 100 base pairs, at least about 150 base pairs, at least about 200 base pairs, at least about 250 base pairs, at least about 300 base pairs, at least about 350 base pairs, at least about 400 base pairs, at least about 450 base pairs, at least about 500 base pairs, at least about 600 base pairs, at least about 700 base pairs, at least about 800 base pairs, at least about 900 base pairs, at least about 1000 base pairs, or any number of base pairs in between the aforementioned values.

[0144] In some embodiments, the enhancer-promoter pair sequence can include any of the sequences in Table 1, including specifically any one of SEQ ID NOs: 1-174, or a sequence having at least about 90% sequence identity thereto. For example, the EP pair sequence can include a sequence having at least about 90% sequence identity, at least 91% sequence identity, at least about 92% sequence identity, at least about 93% sequence identity, at least about 94% sequence identity, at least about 95% sequence identity, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, or at least 99.9% sequence identity to any of SEQ ID NOs: 1-174.

[0145] As noted herein, each of SEQ ID NOS: 1-174 is composed of a promoter sequence and an enhancer sequence. Accordingly, in some embodiments, sequences having at least about 70% sequence identity to each promoter sequence or enhancer sequence independently are also provided herein. For example, the EP-paired sequences of the present disclosure can include sequences having at least about 70% identity, at least about 75% sequence identity, at least about 80% sequence identity, at least about 85% sequence identity, at least about 90% sequence identity, at least 95% sequence identity, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, or at least 99.9% sequence identity to any of the promoter sequences in SEQ ID NOS: 1-174. Likewise, the EP-paired sequences of the present disclosure can include sequences having at least about 70% identity, at least about 75% sequence identity, at least about 80% sequence identity, at least about 85% sequence identity, at least about 90% sequence identity, at least 95% sequence identity, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, or at least 99.9% sequence identity to any of the enhancer sequences in SEQ ID NOS: 1-174.

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

[0193]

[0194]

[0195]

[0196]

[0197]

[0198]

[0199]

[0200]

[0201]

[0202]

[0203] In some embodiments, the nucleic acid construct can comprise a reporter gene having a reporter sequence operably linked to the EP pairing sequence. For example, when the nucleic acid construct is used in a screening assay, the reporter gene can be used as a readout for transcription by the EP pairing sequence, where the reporter gene can be tracked and measured. In some embodiments, the reporter sequence can comprise a fluorescent protein, including a green fluorescent protein (GFP), a red fluorescent protein (RFP), or can comprise a blue, orange, far-red, cyan, or yellow fluorescent protein.

[0204] Observable Behaviors of Nucleic Acid Constructs

[0205] Various nucleic acid constructs of the present disclosure can exhibit dynamic behavior over time in response to antigenic stimulation. In some embodiments, nucleic acid constructs that display similar dynamic behavior can be categorized into similar dynamic behavior patterns. For example, some nucleic acid constructs can exhibit a constitutive behavior, in which antigenic stimulation elicits transcription driven by EP pairing, and in which the level of transcription remains relatively constant and is independent of continued antigenic stimulation. In some embodiments, some nucleic acid constructs can exhibit a “stimulus-onset” behavior, in which antigenic stimulation elicits a significant increase in transcription driven by EP pairing. In some embodiments, this “stimulus-onset” behavior can result in a level of transcription that remains high even after initial antigenic stimulation elicits transcription driven by a transcriptional initiator. In some embodiments, a “stimulus-onset” behavior can include where initial antigenic stimulation elicits a significant increase in transcription driven by EP pairing (referred to herein as an “early stimulus-onset” behavior), or where long-term persistence of initial antigenic stimulation elicits a significant increase in transcription driven by EP pairing (referred to herein as a “late stimulus-onset” behavior). In some embodiments, a “stimulus-onset” behavior can also include where antigenic stimulation elicits a single increase in transcription driven by EP pairing over time. In some embodiments, a single increase in transcription driven by EP pairing can be due to epigenetic regulation (e.g., DNA methylation / demethylation, histone modifications including acetylation, methylation, phosphorylation, and ubiquitination, etc.), other epigenetic-like transcriptional changes, or cellular regulation or transcriptional pathways. In other embodiments, a “stimulus-onset” behavior can also include where antigenic stimulation elicits multiple increases in transcription driven by EP pairing over time. In some embodiments, a transcriptional initiator can exhibit a “stimulus- shutdown” behavior, in which initial antigenic stimulation elicits a decrease in transcription driven by EP pairing. In some embodiments, a “stimulus-shutdown” behavior can result in a level of transcription that approaches zero or is about zero after initial antigenic stimulation.

[0206] In some embodiments, one or more nucleic acid constructs can facilitate a cell to enter a resting state, in which antigenic stimulation is removed for a period of time. Transcription can still occur through EP pairing by these constructs. In some embodiments, in the resting cell state, transcription occurring through EP pairing can still persist, but its transcription rate can be decreased or increased compared to the transcription rate occurring during a non-resting cell state.

[0207] In some embodiments, cells containing one or more nucleic acid constructs can exhibit an exhausted cell state under long-term or constant antigen stimulation. In some embodiments, one or more constructs can sense the exhausted cell state and increase or decrease transcription through EP pairing. It can be appreciated that each unique EP pair in these constructs can exhibit multiple types of behavior (e.g., behavior patterns) depending on the specific EP pair, and each type of behavior produced by the EP pairs disclosed herein is within the contemplation of the present application. Advantageously, these behavior patterns of different EP pairs can each respond to the cell state to dynamically transcriptionally regulate a reporter gene or gene operably linked to the EP pair of the construct.

[0208] Construct Libraries

[0209] In some embodiments, a library comprising a plurality of nucleic acid constructs can be generated, wherein each construct comprises a different enhancer-promoter (EP) pair, and a unique barcode sequence specific to the EP pair. Each enhancer-promoter pair can be operably linked to a unique barcode sequence and a reporter gene. In some embodiments, the library can be used to screen or test EP pairs that exhibit a particular behavior or behavior pattern, as will be described in greater detail herein. For example, the library can be used to screen for EP pairs that cause a large increase in reporter gene transcription over time through the promoter in the EP pair. In some embodiments, the library can be used to screen for EP pairs that cause a sharp decrease in reporter gene transcription over time through the promoter in the EP pair. In some embodiments, the library can be used to screen for EP pairs that cause a gradual increase in transcription over time through the promoter in the EP pair. In some embodiments, the library can be used to screen for EP pairs that cause a gradual decrease in transcription over time through the promoter in the EP pair. In some embodiments, the library can be used to screen for EP pairs that cause an increase in transcription over time through the promoter in the EP pair. In some embodiments, the library can be used to screen for EP pairs that cause multiple increases in transcription over time through the promoter in the EP pair, and the like. In some embodiments, the library comprises nucleic acid constructs comprising EP pairing sequences that are any of SEQ ID NOs: 1-174. In some embodiments, the library comprises a plurality of vectors, wherein each vector comprises a nucleic acid construct having a different enhancer-promoter pair and a unique barcode.

[0210] Cell State-Sensing Constructs and Engineered Receptor Expression

[0211] As described above, one or more nucleic acid constructs of the present disclosure can induce the transcription process through one or more promoters of the present disclosure in response to a cell state and / or a change in cell state. In some embodiments, the transcriptional regulatory enhancer sequence and / or the transcriptional initiator promoter sequence of one or more nucleic acid constructs can be operably linked to a sequence encoding one or more elements of: a CAR, an exogenous T cell receptor (TCR), a cytokine, a degrader, and the like. For example, the transcriptional regulatory enhancer sequence (“enhancer”) and the transcriptional initiator promoter sequence (“promoter”) can be operably linked to a sequence encoding a degrader tagged with a reporter gene.

[0212] In some embodiments, the cell state-sensing construct can drive expression of an engineered antigen receptor, including: a T cell receptor (“TCR”), a chimeric antigen receptor (“CAR”, including all generations), a B cell receptor (“BCR”), a co-receptor of a TCR or BCR, and / or any combination or mixture thereof. In some embodiments, the engineered receptor can conduct a signal, or produce other results (e.g., a dominant negative antigen pool). In some embodiments, the antigen receptor can include one or more elements of: a DHD and / or degrader binding site, a LOCKR switch effector protein binding site, or a safety switch direct or indirect signal transduction molecule binding site. In some embodiments, the antigen receptor can comprise a fully human sequence, a humanized sequence, a sequence isolated or derived from a mammalian sequence or a non-human sequence (including a mouse sequence), a homologous sequence, a chimeric sequence, a recombinant sequence, or a sequence derived from any species.

[0213] One example of an antigen receptor can include a chimeric antigen receptor (CAR), such as Figure 1AIn some embodiments, a CAR can comprise: an extracellular domain containing a binding element that specifically and selectively binds to a target antigen, a transmembrane domain, and an intracellular domain containing at least one signaling domain. In some embodiments, one or more sequences of a CAR can be naturally occurring, or non-naturally occurring. In some embodiments, one or more sequences of a CAR can be endogenous or exogenous relative to the cell expressing the receptor. In some embodiments, one or more sequences of a CAR can be a fully human sequence, a humanized sequence, a sequence isolated from or derived from a mammalian sequence, or a non-human sequence (including a mouse sequence), and / or a homologous sequence. In some embodiments, a CAR can specifically recognize one or more target antigens. For example, some CARs can have one or more binding elements, where each binding element specifically recognizes a different epitope on the same target antigen. In some embodiments, a CAR contains a spacer to achieve optimal distance of the immunological synapse. The extracellular domain of a CAR can comprise a spacer between the T cell surface and the binding element. If there is more than one binding element, the spacer can be between the T cell surface and the first binding element. In some embodiments, a binding element can have any structure, including but not limited to: (1) an antibody or any fragment thereof; (2) an antibody mimetic or any portion thereof; and / or (3) a de novo designed protein. Exemplary binding elements can include, but are not limited to: scFv, VH, VHH, monoclonal antibodies, and any combination thereof. In some embodiments, a transmembrane domain can be isolated from or derived from any protein, including any transmembrane protein. Exemplary transmembrane domains can comprise sequences isolated from or derived from CD4 or CD8 proteins. In some embodiments, a CAR can be any CAR “generation,” including but not limited to: first generation, second generation, third generation, fourth generation, and fifth generation. In some embodiments, the intracellular domain of a CAR can comprise one or more of the following elements: an immunoreceptor tyrosine-based activation motif (ITAM) repeat sequence (e.g., a single CD3 zeta intracellular domain) (first generation), an ITAM repeat sequence and one costimulatory molecule (e.g., CD27 or CD 137 sequence) (second generation), an ITAM repeat sequence, a first costimulatory molecule, and a second costimulatory molecule (e.g., CD 134 or CD 137) (third generation), an ITAM repeat sequence, a costimulatory molecule, and a constitutively or inducibly expressed chemokine (e.g., wild-type IL-12) (fourth generation; also known as T cells redirected for universal cytokine-mediated killing (TRUCK)), and / or an ITAM repeat sequence, a costimulatory molecule, and an intracellular domain of a cytokine receptor (e.g., a wild-type IL-2R beta chain fragment) (fifth generation).

[0214] In some embodiments, the CAR can transduce a signal, or produce other results (e.g., a dominant negative antigen pool). The CAR can include a DHD and / or a degron binding site, a LOCKR switch effector protein binding site, a logic gate or logic switch, or a safety switch direct or indirect signal transduction molecule binding site. In some embodiments, the CAR can be a split CAR, where the final activity is dependent on the binding and interaction of two domains or two receptors.

[0215] To avoid CAR T cell exhaustion, it would be beneficial to employ a system comprising one or more exemplary nucleic acid constructs that can sense the state of exhaustion and turn off the stimulatory signal of the CAR. Disclosed herein is one or more exemplary engineered (non-naturally occurring) constructs and methods of use thereof that can be used to turn off the stimulatory signal of an antigen receptor, including a chimeric antigen receptor, in response to sensing a cellular state including exhaustion.

[0216] In some embodiments, the cellular state sensing construct can drive expression of a fusion protein having an engineered receptor (e.g., a CAR or TCR) and a degradation domain. For example, in some embodiments, the polypeptide can be fused to a degradation domain (DHD), such as a degron, for targeted degradation of a molecule of interest. In some embodiments, the degradation domain comprises a degron. As provided herein, a degron is the minimal element in a protein sufficient to enable cell-mediated degradation. In some embodiments, the cell-mediated degradation can be dependent on ubiquitin. In some embodiments, the cell-mediated degradation can be independent of ubiquitin.

[0217] In some embodiments, the one or more nucleic acid constructs can comprise a collection of polynucleotides comprising a polynucleotide encoding a degradation initiator that is fused to a binding element that specifically recognizes a native motif on an endogenous molecule of interest. The binding domain may, for example, recognize and bind to a particular region on a molecule of interest or a particular modification on a molecule of interest. The binding element interacts with the native motif on the molecule, recruiting the degradation initiator to the molecule to initiate the degradation process.

[0218] In some embodiments, the degradation domain comprises a ligase or ligase binding domain. In some embodiments, the polypeptide of the one or more constructs can serve as the binding element, where the polypeptide is fused to a ligase domain (or functional variant thereof). Binding of the polypeptide of the one or more nucleic acid constructs to a protein of interest brings the modified ligase in close proximity to the target protein, facilitating ubiquitination and subsequent degradation of the target protein.

[0219] In some embodiments, the ligase of one or more nucleic acid constructs can comprise an E3 ligase or a variant thereof. E3 ligases can control substrate specificity and ubiquitination topology. For example, in the cellular ubiquitin-proteasome system, E3 ligase proteins recruit E2 ubiquitin-conjugating enzymes that are already loaded with ubiquitin, recognize a protein substrate, and assist or directly catalyze the transfer of ubiquitin from the E2 to the protein substrate, thereby targeting the protein for degradation. E3 ligase domains and / or variants thereof can be selected based on the intended protein for targeted degradation. For example, E3 ligases and / or collections of E3 ligases can be selected to modulate the stability and / or half-life of a transmembrane protein of interest. In another example, E3 ligases and / or collections of E3 ligases can be selected to modulate the stability and / or half-life of a cytosolic protein (e.g., a transcription factor). In some embodiments, one or more nucleic acid constructs can comprise one or more synthetic degrons that can be used to modulate the activity of a range of target molecules (e.g., proteins) in various synthetic biology applications, such as therapeutic applications. In one embodiment, one or more synthetic degrons can be used in cellular therapy applications by programming a population of cells to perform and / or modulate a therapeutic function.

[0220] In some embodiments, one or more synthetic degrons can be used to modulate and / or degrade T cell receptors (TCRs) and / or chimeric antigen receptor (CAR) cells used in cancer therapy. More specifically, the synthetic degron system of the present disclosure can be used to degrade CARs and / or TCRs and inhibit excessive CAR / TCR signaling, thereby avoiding the adverse exhaustion phenotype that can be observed in many existing immune cell therapies.

[0221] In some embodiments, the cell state-sensing nucleic acid construct can drive the expression of one or more cytokines. For example, in some embodiments, a transcriptional initiator and / or a transcriptional regulator can be operably linked to one or more cytokines. The one or more cytokines can comprise: IL-2, IL-12, IL-15, IL-18, IL-21, IL-23, interferon alpha (a), interferon beta (b), interferon gamma (g), and interferon omega (w).

[0222] Inducible Receptor Systems

[0223] Provided herein are inducible receptor systems engineered to drive expression and degradation of cell surface receptors, including antigen receptors. In some embodiments, the inducible receptor systems disclosed herein can be used to drive expression or degradation of antigen receptors, such as CARs and TCRs. In some embodiments, the inducible receptor systems disclosed herein can be used to drive expression or degradation of engineered receptors in response to sensing a cellular state. In some embodiments, the inducible receptor systems can comprise one or more of the exemplary constructs disclosed herein. In some embodiments, the inducible receptor systems can comprise a circuit, wherein one or more of the exemplary constructs can comprise different circuit components, including a response component and an effector component, wherein the response component can be capable of changing the activity of the effector component in response to a signal from a receptor, including an antigen receptor, as will be described in greater detail herein.

[0224] Disclosed herein are one or more nucleic acid constructs that make up the inducible receptor systems of the disclosure. The nucleic acid constructs of the disclosure can be non-naturally occurring and comprise a response component comprising a transcription initiator or comprising a transcription initiator and a transcription regulator (e.g., a transcription initiator-transcription regulator pair). In the inducible receptor systems of the disclosure, the response element is operably linked to an effector element (e.g., a gene of interest).

[0225] In some embodiments, the transcription regulator and the transcription initiator can each comprise a concatamer of transcription factor binding motifs. The concatamer comprises sequences that can be derived from known promoter sequences. The concatamer of transcription factor binding motifs (referred to as a concatamerized sequence in the examples) binds more than one unique transcription factor or the same transcription factor at more than one site. It can be appreciated that non-naturally occurring sequences can include naturally occurring sequences that are assembled in a non-naturally occurring manner (including those isolated or derived from naturally occurring sequences). For example, in some embodiments, one or more naturally occurring sequences that are not adjacent within a genome can be arranged adjacent in a construct, thereby assembled in a non-naturally occurring manner.

[0226] As used herein, the transcription initiators of the disclosure function in a promoter-like manner and support transcription factor binding to initiate transcription of a downstream gene under its control. As used herein, the transcription regulators of the disclosure can further modulate transcription of a downstream gene. In some embodiments, the transcription regulator is located 5’ of the transcription initiator. In some embodiments, the transcription regulator is located 3’ of the transcription initiator.

[0227] The transcription binding motif can be derived from the non-translated genomic region of the following non-exhaustive list of proteins: BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORa, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

[0228] In some embodiments, when the transcription initiator comprises one or more sequences from non-translated genomic sequences of NFAT; in some embodiments, the transcription regulator can comprise a sequence that is any one or more of SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

[0229] In some embodiments, the transcription initiator comprises one or more sequences from non-translated genomic sequences of NFkB; in some embodiments, the transcription regulator can comprise a sequence that is any one or more of SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

[0230] In some embodiments, when the transcription initiator comprises one or more sequences from non-translated genomic sequences of REL (including RELA or RELB); in some embodiments, the transcription regulator can comprise a sequence that is any one or more of SEQ ID NOs: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

[0231] In some embodiments, the transcription initiator comprises a sequence derived from an untranslated genomic sequence of RELA, optionally comprising a sequence that is any one or more of SEQ ID NOs: 4484-4499, 4994-5009, and 9630-9645.

[0232] In some embodiments, when the transcription initiator comprises one or more sequences from an untranslated genomic sequence of IRF2; in some embodiments, the transcription regulator can comprise a sequence that is any one or more of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

[0233] In some embodiments, when the transcription initiator comprises one or more sequences from an untranslated genomic sequence of GATA3; in some embodiments, the transcription regulator can comprise a sequence that is any one or more of SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855.

[0234] In some embodiments, when the transcription initiator comprises one or more sequences from an untranslated genomic sequence of ATF3; in some embodiments, the transcription regulator can comprise a sequence that is any one or more of SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

[0235] In some embodiments, one or more constructs can further comprise an integration sequence that is capable of inducing or increasing insertion of the construct into a target site (e.g., of a vector or chromosome). The insertion sequence can comprise multiple insertion sequences. For example, in some embodiments, the insertion sequence can comprise a first integration sequence and a second integration sequence. In some embodiments, the first integration sequence can be a 5’ integration sequence and the second integration sequence can be a 3’ integration sequence. In some embodiments, the insertion sequence can comprise a homologous sequence corresponding to the insertion site in order to facilitate homologous recombination. In some embodiments, the integration sequence can comprise one or more transposable elements, which can help facilitate transposition. In some embodiments, the transposable element can comprise an insertion sequence and / or a transposon sequence. In some embodiments, the integration sequence can comprise a first 5’ end repeat sequence or a second 3’ end repeat sequence. In some embodiments, the construct can be inducible.

[0236] In some embodiments, the nucleic acid construct does not comprise either of: a transcriptional initiator comprising a human beta globin sequence, and a transcriptional regulator comprising either of: an NFAT sequence, an IRF4 sequence, an AICE sequence, or an ISRE sequence. In some embodiments, the AICE sequence can include or encompass a sequence of IRF4 or IRF8, or a sequence derived from IRF4 or IRF8, wherein each sequence has BATF. In some embodiments, the AICE sequence can be derived from the untranslated region of IRF4, IRF8, and / or BATF. In some embodiments, the IRSE sequence can include the consensus sequence YAGTTTC(A / T)YTTTYCC, wherein “Y” is C or T. In some embodiments, the construct does not comprise a sequence having SEQ ID NO: 9786.

[0237] Additionally in some embodiments, the construct does not comprise either of: a transcriptional initiator comprising a YB-TATA sequence, and a transcriptional regulator comprising an NFAT sequence. In some embodiments, the construct does not comprise a sequence having SEQ ID NO: 9787.

[0238] Methods of Identifying Nucleic Acid Constructs to Drive Gene Expression

[0239] Provided herein is a method of identifying a transcriptional initiator of a nucleic acid construct that drives gene expression in response to a cell state. In some embodiments, the method can be used to identify promoters that can exhibit particular behaviors, such as: delayed activity after antigen stimulation (e.g., ), transcriptional oscillation after antigen stimulation, decreased transcription driven by a promoter after antigen stimulation, increased transcription driven by a promoter after antigen stimulation, and the like. In some embodiments, the transcriptional oscillation can include changes in reporter gene expression levels driven by a promoter. The promoters can be identified from a library of constructs, wherein each construct comprises one or more unique promoters. In some embodiments, the library of promoters can comprise a plurality of concatemers. In some embodiments, the method of identifying a transcriptional initiator that drives gene expression in response to a cell state can be seen in the exemplary schematic. In some embodiments, a library of constructs can be generated, wherein each construct comprises one or more concatenated sequences that drive expression of a reporter gene (e.g., a fluorescent protein). In some embodiments, the library of constructs can be transduced into different types of cells, including primary T cells, and stimulated with antigen. The primary T cells can be sorted by expression levels of the reporter gene, and subsequently verified for their sequences by sequencing. It can be appreciated that the screening of the library of constructs can use high-throughput protocols known in the art. It can also be appreciated that the analysis of the screening results, along with the design of the library of constructs, can be achieved using high-throughput analysis techniques or machine learning techniques.

[0240] In designing a promoter library to generate one or more constructs, consensus motifs can be identified. In some embodiments, each consensus motif can comprise a sequence comprising one or more transcription factor binding sites, or a sequence isolated from or derived from an untranslated genomic sequence of one or more transcription factors. Once consensus motifs are identified, 5’ end nucleotides and 3’ end nucleotides can be truncated, leaving the consensus motif. At nucleotide positions within the consensus motif that have variability, an “N” can be placed in the sequence, indicating that the position can use any nucleotide. At nucleotide positions within the consensus motif that have some variability, another letter (e.g., S, R, or W) can be used to indicate that the position can only be set to a particular nucleotide. For example, the letter “S” can indicate that the position can be replaced by either an A or a T, the letter “W” can indicate that the position can be replaced by either a G or a C, the letter “R” can indicate that the position can be replaced by either an A or a G, or other similar cases. In some embodiments, the reverse complement of the consensus motif can be added to the construct. In some embodiments, multiple copies of the consensus motif can be generated and linked together by a linker sequence or spacer to form a concatemer. In some embodiments, the spacer can comprise at least 2 base pairs, at least 3 base pairs, at least 4 base pairs, at least 5 base pairs, at least 6 base pairs, at least 7 base pairs, at least 8 base pairs, at least 9 base pairs, at least 10 base pairs, etc. In some embodiments, the spacer can comprise a 6 base pair spacer. Exemplary spacers can comprise the sequence TACGCT, TGATCT, TGCTTT, or TGCCCG. In some embodiments, the same spacer can separate each copy of the consensus motif in the concatemer, or different spacers can separate each copy of the consensus motif in the concatemer.

[0241] In some embodiments, the construct can comprise an adaptor sequence located 5’ and / or 3’ to the transcriptional initiator and / or transcriptional regulator. In some embodiments, the adaptor sequence can comprise the sequence:

[0242] AAAGCACTCTTAGGCCTCTGCGTCTCATTCTGAAGACTCACGA (SEQ ID NO: 9801), or

[0243] AACGGAGTCTTCAACGTGAGACGGCTCGATGCCATAGTTCCTT (SEQ ID NO: 9801).

[0244] In some embodiments, a consensus motif can be identified after isolating or deriving from non-translated genomic sequences of one or more transcription factors. In some embodiments, a consensus motif can be identified after isolating or deriving from non-translated genomic sequences of one or more sequences to which a transcription factor binds. For example, a consensus motif can include any one or more of the sequences in Table 1, specifically including any one or more of SEQ ID NOs: 175-509, 9793-9800. A transcription initiator can include any one or more of the sequences in Table 1, specifically including any one or more of SEQ ID NOs: 175-509, 9793-9800.

[0245] Table 1: Exemplary Consensus Motifs

[0246]

[0247]

[0248]

[0249]

[0250]

[0251]

[0252]

[0253]

[0254] The identified consensus motifs in Table 1 include variability within the identified sequence. In some embodiments, the identified consensus motifs in Table 1 can allow for one or more nucleotide substitutions within the identified consensus motif. For example, within the consensus motifs of Table 1, "N" can indicate that the position allows substitution to any nucleotide, including A, G, C, T; "S" can indicate that the position only allows substitution to G or C; "R" can indicate that the position only allows substitution to A or G; and "W" can indicate that the position only allows substitution to A or T.

[0255] Within each identified consensus motif, specific motifs have been identified that reduce the variability of the consensus motif. Table 2 lists exemplary specific motifs that are present within the identified consensus motifs in Table 1. The transcription initiators and transcription regulators of the present disclosure can include any one or more of the specific exemplary motifs in Table 2.

[0256] Table 2: Exemplary Motifs of Consensus Motifs

[0257]

[0258]

[0259]

[0260]

[0261]

[0262]

[0263]

[0264]

[0265]

[0266]

[0267]

[0268]

[0269]

[0270]

[0271]

[0272]

[0273]

[0274]

[0275]

[0276] In some embodiments, the transcription initiator or transcription regulator can comprise a sequence comprising any of the sequences of SEQ ID NOs: 175-9800, or a sequence having at least about 70% sequence identity thereto. For example, the transcription initiator or transcription regulator can comprise a sequence having at least about 75% sequence identity, at least about 80% sequence identity, at least about 85% sequence identity, at least about 90% sequence identity, at least 95% sequence identity, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, or at least 100% sequence identity to any of the sequences of SEQ ID NOs: 175-9800.

[0277] Cell State-Sensing Constructs and Engineered Receptor Expression

[0278] In some embodiments, the cell state sensing construct can drive expression of an engineered antigen receptor, including: a T cell receptor (“TCR”), a chimeric antigen receptor (“CAR”, including all generations), a B cell receptor (“BCR”), a co-receptor of a TCR or BCR, and / or any combination or mixture thereof. In some embodiments, the engineered receptor can conduct a signal or produce other results (including a dominant negative antigen pool). In some embodiments, the antigen receptor can include one or more of the following elements: a DHD and / or degrader binding site, a LOCKR switch effector protein binding site, or a safety switch direct or indirect signal transduction molecule binding site. In some embodiments, the antigen receptor can comprise a fully human sequence, a humanized sequence, a sequence isolated or derived from a mammalian sequence or a non-human sequence (including a mouse sequence), a homologous sequence, a chimeric sequence, a recombinant sequence, or a sequence derived from any species.

[0279] One example of an antigen receptor can include a chimeric antigen receptor (CAR), such as Figure 1AIn some embodiments, a CAR can comprise at least an extracellular domain (containing a binding element that specifically and selectively binds to a target antigen), a transmembrane domain, and an intracellular domain (containing at least one signaling domain). In some embodiments, one or more sequences of a CAR can be naturally occurring, or non-naturally occurring. In some embodiments, one or more sequences of a CAR can be endogenous or exogenous relative to the cell expressing the receptor. In some embodiments, one or more sequences of a CAR can be a fully human sequence, a humanized sequence, a sequence isolated from or derived from a mammalian sequence, or a non-human sequence (including a mouse sequence), and / or a homologous sequence. In some embodiments, a CAR can specifically recognize one or more target antigens. For example, some CARs can have one or more binding elements, where each binding element specifically recognizes a different epitope on the same target antigen. In some embodiments, a CAR contains a spacer to achieve optimal distance of the immunological synapse. The extracellular domain of a CAR can comprise a spacer between the T cell surface and the binding element. If there is more than one binding element, the spacer can be between the T cell surface and the first binding element. In some embodiments, a binding element can have any structure, including but not limited to: (1) an antibody or any fragment thereof; (2) an antibody mimetic or any portion thereof; and / or (3) a de novo designed protein. Exemplary binding elements can include, but are not limited to: scFv, VH, VHH, monoclonal antibodies, and any combination thereof. In some embodiments, a transmembrane domain can be isolated from or derived from any protein, including any transmembrane protein. Exemplary transmembrane domains can comprise sequences isolated from or derived from CD4 or CD8 proteins. In some embodiments, a CAR can be any CAR “generation,” including but not limited to, a first generation, a second generation, a third generation, a fourth generation, and a fifth generation. In some embodiments, the intracellular domain of a CAR can comprise one or more of the following elements: an immunoreceptor tyrosine-based activation motif (ITAM) repeat sequence (e.g., a single CD3 zeta intracellular domain) (first generation), an ITAM repeat sequence and one costimulatory molecule (e.g., CD27 or CD 137 sequence) (second generation), an ITAM repeat sequence, a first costimulatory molecule, and a second costimulatory molecule (e.g., CD 134 or CD 137) (third generation), an ITAM repeat sequence, a costimulatory molecule, and a constitutively or inducibly expressed chemokine (e.g., wild-type IL-12) (fourth generation; also known as T cells redirected for universal cytokine-mediated killing (TRUCK)), and / or an ITAM repeat sequence, a costimulatory molecule, and an intracellular domain of a cytokine receptor (e.g., a wild-type IL-2R beta chain fragment) (fifth generation).

[0280] In some embodiments, the CAR can conduct a signal or produce other results (pool of dominant negative antigens). The CAR can include a DHD and / or a degrader binding site, a LOCKR switch effector protein binding site, a logic gate or logic switch, or a safety switch direct or indirect signal transduction molecule binding site. In some embodiments, the CAR can be a split CAR, where the final activity is dependent on the binding and interaction of two domains or two receptors.

[0281] To avoid CAR T cell exhaustion, it would be beneficial to employ a system comprising one or more exemplary constructs that can sense the state of exhaustion and turn off the stimulatory signal of the CAR. Disclosed herein is one or more exemplary engineered (non-naturally occurring) constructs and methods of use thereof that can be used to turn off the stimulatory signal of an antigen receptor, including a chimeric antigen receptor, in response to sensing a cellular state including exhaustion.

[0282] Cell State-Sensing Constructs and Fusion Protein Expression

[0283] In some embodiments, the cellular state sensing construct can drive expression of a fusion protein having an engineered receptor (e.g., a CAR or TCR) and a degradation domain. For example, in some embodiments, the polypeptide can be fused to a degradation domain for targeted degradation of a molecule of interest. In some embodiments, the degradation domain comprises a degron. As provided herein, a degron is the minimal element in a protein sufficient to enable cell-mediated degradation. In some embodiments, the cell-mediated degradation is dependent on ubiquitin. In some embodiments, the cell-mediated degradation is not dependent on ubiquitin.

[0284] In some embodiments, one or more constructs can comprise a collection of polynucleotides comprising a polynucleotide encoding a degradation initiator that is fused to a binding element that specifically recognizes a native motif on an endogenous molecule of interest. The binding domain may, for example, recognize and bind to a particular region on a molecule of interest or a particular modification on a molecule of interest. The binding element interacts with the native motif on the molecule, recruiting the degradation initiator to the molecule to initiate the degradation process.

[0285] In some embodiments, the degradation domain comprises a ligase or ligase binding domain. In some embodiments, the polypeptide of one or more constructs can be used as the binding element, where the polypeptide is fused to a ligase domain (or functional variant thereof). Binding of the polypeptide of one or more constructs to a protein of interest brings the modified ligase in close proximity to the target protein, facilitating ubiquitination and subsequent degradation of the target protein.

[0286] In some embodiments, the ligase of one or more constructs can comprise an E3 ligase. E3 ligases control substrate specificity and ubiquitination topology. For example, in the cellular ubiquitin-proteasome system, E3 ligase proteins recruit E2 ubiquitin-conjugating enzymes that are already loaded with ubiquitin, recognize a protein substrate, and assist or directly catalyze the transfer of ubiquitin from the E2 to the protein substrate, thereby targeting the protein for degradation. E3 ligase domains and / or variants thereof can be selected based on the intended protein for targeted degradation. For example, E3 ligases and / or collections of E3 ligases can be selected to modulate the stability and / or half-life of a transmembrane protein of interest. In another example, E3 ligases and / or collections of E3 ligases can be selected to modulate the stability and / or half-life of a cytosolic protein (e.g., a transcription factor). In some embodiments, one or more constructs can comprise one or more synthetic degraders that can be used to modulate the activity of a range of target molecules (e.g., proteins) in various synthetic biology applications, such as therapeutic applications. In one embodiment, one or more synthetic degraders can be used in cellular therapy applications by programming a population of cells to perform and / or modulate a therapeutic function.

[0287] In some embodiments, one or more synthetic degraders can be used to modulate (degrade) T cell receptors (TCRs) and / or chimeric antigen receptor (CAR) cells used in cancer therapy. More specifically, the synthetic degrader system of the present disclosure can be used to degrade CARs and / or TCRs and inhibit excessive CAR / TCR signaling, thereby avoiding the adverse exhaustion phenotype that can be observed in many existing immune cell therapies.

[0288] Cell State-Sensing Constructs and Cytokine Expression

[0289] In some embodiments, the cell state-sensing construct can drive the expression of one or more cytokines. For example, in some embodiments, a transcriptional initiator and / or a transcriptional regulator can be operably linked to one or more cytokines. The one or more cytokines can comprise: IL-2, IL-12, IL-15, IL-18, IL-21, IL-23, interferon alpha (a), interferon beta (b), interferon gamma (g), and interferon omega (w).

[0290] Exemplary Constructs Including Loop Components

[0291] The constructs of the present disclosure are non-naturally occurring and comprise one or more circuits that co-regulate expression of a selected protein of interest (hereinafter referred to as an effector module). In some embodiments, the circuits can comprise a response module (e.g., any of the transcription initiators / transcription regulators / EP pairs / promoters / enhancers provided above) and an effector module. The response module is capable of altering the activity of the effector module. The response module is capable of altering the activity of the effector module in response to a signal from a receptor (including an antigen receptor), an epigenetic alteration, transcriptional induction or transcriptional repression, or a change in cell state. In some embodiments, the activity of the response module is capable of inducing a change in the activity of the effector module. For example, the response module can comprise a transcription initiator comprising a concatemer of one or more sequences from a transcription factor untranslated region operably linked to a CAR; while the effector module can comprise the CAR. The transcription initiator as the response module is capable of altering the activity of the CAR as the effector module, and the activity of the transcription initiator is capable of inducing a change in the activity of the CAR by increasing the transcriptional level of the CAR. In another example, the response module can comprise a constitutively active transcription initiator operably linked to a CAR, while the effector module can comprise an inducible transcription initiator operably linked to a degrader. Antigen stimulation can elicit an activation response through the CAR as the response module, where the endogenous signaling network can induce the expression of the degrader as the effector module, thereby decreasing the expression level of the CAR. It will be appreciated that any of the constructs in the present disclosure can be configured to encode circuit components, and should be considered within the scope of contemplation. For example, the response module can comprise one or more of the following elements: a sequence of a transcription factor untranslated region, a sequence comprising a transcription factor binding site, a promoter, an enhancer, and a suppressor. In some embodiments, the response element can include an epigenetic modifier, a promoter (including a minimal promoter). In some embodiments, the minimal promoter can comprise a sequence that is any one or more of SEQ ID NOs: 9788, 9789, or 9790. In some embodiments, the response module can comprise a transcription initiator comprising a concatemerized promoter comprising a sequence that is any one or more of SEQ ID NOs: 175-9781. In some embodiments, the response module can comprise a transcription initiator and a transcription regulator, including an enhancer-promoter pair. In some embodiments, the response module can comprise a sequence that is any one or more of SEQ ID NOs: 1-174. In some embodiments, the effector module can comprise a degrader. In some embodiments, the effector module can comprise a degrader operably linked to a transcription initiator comprising a sequence that is any one or more of SEQ ID NOs: 1-9781. In some embodiments, the signal from a receptor includes a signal from a CAR.In some embodiments, the cell state or change in cell state can include any cell state, including an unstimulated state, a stimulation-on state, a stimulation-off state, an exhausted state, or a resting state.

[0292] Inducible CAR Systems

[0293] In some embodiments, the circuit is an inducible receptor system, such as an inducible CAR system. In one or more constructs of the inducible CAR system, components of the response element are combined to regulate the transcription process of one or more genes (e.g., CAR and degrader). For example, the response element can be operably linked to one or more genes in the construct, where the one or more genes can include a CAR and / or a degrader, and the response element regulates transcription of the CAR or degrader alone, or both.

[0294] Table 4 lists four different constructs of the inducible CAR system, and the expression behavior produced by the four different CAR constructs.

[0295] Table 4: CAR Constructs of Inducible CAR Systems

[0296] CAR Constructs Behaviors Degradation Agents CAR-1 Constitutive No CAR-1D Constitutive Yes CAR-2 Stimulus Initiation No CAR-2D Stimulus Initiation Yes

[0297] For example, a first CAR (“CAR-1”) can have a transcriptional initiator that exhibits a “constitutively sustained activation behavior,” where the transcriptional initiator drives CAR expression upon antigen stimulation. In the absence of any dynamic regulation of the CAR, the CAR expression level can remain constant over time. However, in the presence of constant antigen stimulation, the constant CAR expression level can lead to an exhausted cell state. A degrader can be added to the CAR-1 construct (“CAR-1D”), where expression of the degrader reduces or pulses the CAR expression level, such that the cell transitions to a resting cell state. Upon the cell entering the resting state, reactivation of the CAR by antigen stimulation can cause the CAR expression level to rise. The CAR-1D construct can exhibit periodic pulsed fluctuations in the CAR expression level over time.

[0298] The presence of the degrader can enable the CAR expression level to be reduced to a variety of extents, including near complete elimination, return to a baseline level, a slight decrease from the peak CAR expression level, or any level in between.

[0299] A second CAR construct ("CAR-2") can have a promoter that exhibits "stimulus- initiated behavior," in which the stimulatory signal to the CAR drives an increase in CAR expression level via a regulated promoter. The promoter of CAR-2 can drive higher levels of transcription than the CAR-1 promoter, resulting in a significant boost in overall CAR transcription levels. In the absence of any regulation of the CAR, the CAR expression level can also remain constant over time, without dropping to baseline levels. The introduction of a degrader to the inducible receptor system construct ("CAR-2D") can cause the CAR expression level to exhibit a pulsed fluctuation over time. The addition of a degrader to CAR-2 can cause the CAR expression level to drop to about baseline levels.

[0300] The pulse level (e.g., the range of CAR expression levels from the maximum CAR expression value to the minimum CAR expression value) and the pulse rate (e.g., the frequency of CAR expression level changes) can be varied. In some embodiments, the pulse level and the pulse rate can be varied by using different transcription initiators, different transcription regulators, or different enhancer-promoter pairs.

[0301] Inducible Constructs Containing Transcriptional Initiators and Transcriptional Modulators or EP Pairs and Fusion Protein Expression

[0302] In some embodiments, these circuits can drive expression of engineered antigen receptors, including: T cell receptors ("TCRs"), chimeric antigen receptors ("CARs," including all generations), B cell receptors ("BCRs"), co-receptors of TCRs or BCRs, and / or any combination or mixture thereof. In some embodiments, the engineered receptors can transduce signals or produce other outcomes (including dominant negative antigen pools). In some embodiments, the antigen receptors can include one or more of the following elements: a DHD and / or degrader binding site, a LOCKR switch effector protein binding site, or a safety switch direct or indirect signal transduction molecule binding site. In some embodiments, the antigen receptors can comprise fully human sequences, humanized sequences, sequences isolated or derived from mammalian sequences or non-human sequences (including mouse sequences), homologous sequences, chimeric sequences, recombinant sequences, or sequences derived from any species.

[0303] One example of an antigen receptor can include a chimeric antigen receptor (CAR). In some embodiments, a CAR can comprise at least an extracellular domain (containing a binding element that specifically and selectively binds to a target antigen), a transmembrane domain, and an intracellular domain (containing at least one signaling domain). In some embodiments, one or more sequences of a CAR can be naturally occurring, or non-naturally occurring. In some embodiments, one or more sequences of a CAR can be endogenous or exogenous relative to the cell expressing the receptor. In some embodiments, one or more sequences of a CAR can be a fully human sequence, a humanized sequence, a sequence isolated from or derived from a mammalian sequence, or a non-human sequence (including a mouse sequence), and / or a homologous sequence. In some embodiments, a CAR can specifically recognize one or more target antigens. For example, some CARs can have one or more binding elements, where each binding element specifically recognizes a different epitope on the same target antigen. In some embodiments, a CAR contains a spacer to achieve optimal distance of the immunological synapse. The extracellular domain of a CAR can comprise a spacer between the T cell surface and the binding element. If there is more than one binding element, the spacer can be between the T cell surface and the first binding element. In some embodiments, a binding element can have any structure, including but not limited to: (1) an antibody or any fragment thereof; (2) an antibody mimetic or any portion thereof; and / or (3) a de novo designed protein. Exemplary binding elements can include, but are not limited to: scFv, VH, VHH, monoclonal antibodies, and any combination thereof. In some embodiments, a transmembrane domain can be isolated from or derived from any protein, including any transmembrane protein. Exemplary transmembrane domains can comprise sequences isolated from or derived from CD4 or CD8 proteins. In some embodiments, a CAR can be any CAR“generation,” including but not limited to, a first generation, a second generation, a third generation, a fourth generation, and a fifth generation. In some embodiments, the intracellular domain of a CAR can comprise one or more of the following elements: an immunoreceptor tyrosine-based activation motif (ITAM) repeat sequence (e.g., a single CD3 zeta intracellular domain) (first generation), an ITAM repeat sequence and one costimulatory molecule (e.g., CD27 or CD 137 sequence) (second generation), an ITAM repeat sequence, a first costimulatory molecule, and a second costimulatory molecule (e.g., CD 134 or CD 137) (third generation), an ITAM repeat sequence, a costimulatory molecule, and a constitutively or inducibly expressed chemokine (e.g., wild-type IL-12) (fourth generation; also known as T cells redirected for universal cytokine-mediated killing (TRUCK)), and / or an ITAM repeat sequence, a costimulatory molecule, and an intracellular domain of a cytokine receptor (e.g., a wild-type IL-2R beta chain fragment) (fifth generation).

[0304] In some embodiments, the CAR can conduct a signal or produce other results (pool of dominant negative antigens). The CAR can include a DHD and / or a degrader binding site, a LOCKR switch effector protein binding site, a logic gate or logic switch, or a safety switch direct or indirect signal transduction molecule binding site. In some embodiments, the CAR can be a split CAR, where the final activity is dependent on the binding and interaction of two domains or two receptors.

[0305] To avoid CAR T cell exhaustion, it would be beneficial to employ a system comprising one or more exemplary constructs that can sense the state of cell exhaustion and shut off the stimulatory signal of the CAR. Disclosed herein is one or more exemplary engineered (non-naturally occurring) constructs and methods of use thereof that can be used to shut off the stimulatory signal of an antigen receptor, including a chimeric antigen receptor, in response to sensing a state of the cell including exhaustion.

[0306] Inducible Constructs and Fusion Protein Expression

[0307] In some embodiments, the inducible construct can drive expression of a fusion protein having an engineered receptor (e.g., a CAR or a TCR) and a degradation domain. For example, in some embodiments, the polypeptide can be fused to a degradation domain for targeted degradation of a molecule of interest. In some embodiments, the degradation domain comprises a degron. As provided herein, a degron is the minimal element in a protein sufficient to enable cell-mediated degradation. In some embodiments, the cell-mediated degradation is dependent on ubiquitin. In some embodiments, the cell-mediated degradation is not dependent on ubiquitin.

[0308] In some embodiments, one or more constructs can comprise a collection of polynucleotides comprising a polynucleotide encoding a degradation initiator that is fused to a binding element that specifically recognizes a native motif on an endogenous molecule of interest. The binding domain may, for example, recognize and bind to a particular region on a molecule of interest or a particular modification on a molecule of interest. The binding element interacts with the native motif on the molecule, recruiting the degradation initiator to the molecule to initiate the degradation process.

[0309] In some embodiments, the degradation domain comprises a ligase or a ligase binding domain. In some embodiments, the polypeptide of one or more constructs can be used as the binding element, where the polypeptide is fused to a ligase domain (or a functional variant thereof). Binding of the polypeptide of one or more constructs to a protein of interest brings the modified ligase in close proximity to the target protein, facilitating ubiquitination and subsequent degradation of the target protein.

[0310] In some embodiments, the ligase of one or more constructs can comprise an E3 ligase. E3 ligases control substrate specificity and ubiquitination topology. For example, in the cellular ubiquitin-proteasome system, E3 ligase proteins recruit E2 ubiquitin-conjugating enzymes that are loaded with ubiquitin, recognize a protein substrate, and assist or directly catalyze the transfer of ubiquitin from the E2 to the protein substrate, thereby targeting the protein for degradation. E3 ligase domains and / or variants thereof can be selected based on the intended protein targeted for degradation. For example, an E3 ligase and / or a collection of E3 ligases can be selected to modulate the stability and / or half-life of a transmembrane protein of interest. In another example, an E3 ligase and / or a collection of E3 ligases can be selected to modulate the stability and / or half-life of a cytosolic protein (e.g., a transcription factor). In some embodiments, one or more constructs can comprise one or more synthetic degrons that can be used to modulate the activity of a range of molecules of interest (e.g., proteins) in various synthetic biology applications, such as therapeutic applications. In one embodiment, one or more synthetic degrons can be used in cell therapy applications by programming a population of cells to perform and / or modulate a therapeutic function.

[0311] In some embodiments, one or more synthetic degrons can be used to modulate (degrade) T cell receptors (TCRs) and / or chimeric antigen receptor (CAR) cells used in cancer therapy. More specifically, the synthetic degron system of the present disclosure can be used to degrade CARs and / or TCRs and inhibit excessive CAR / TCR signaling, thereby avoiding the adverse exhaustion phenotype that can be observed in many existing immune cell therapies.

[0312] It can be appreciated that within a construct, the regulated promoter or EP pair can drive transcription of any reporter gene or gene. In a construct comprising an inducible receptor system, the regulated promoter or EP pair can drive transcription of a CAR or a degron. For example, in some embodiments, the regulated promoter or EP pair can drive expression of a CAR or a polypeptide (including a fusion protein) having a degrading domain. In some embodiments, the polypeptide can be fused to a degrading domain for targeted degradation of a molecule of interest. In some embodiments, the degrading domain comprises a degron. As provided herein, a degron is the minimal element in a protein sufficient to enable cell-mediated degradation. In some embodiments, cell-mediated degradation can or can not be dependent on ubiquitin.

[0313] In some embodiments, the inducible receptor systems of the present disclosure can be used to modulate the activity of a range of target molecules (e.g., proteins) in various synthetic biology applications, such as therapeutic applications. For example, in one embodiment, the inducible receptor systems of the present disclosure can be used in cell therapy applications by programming a population of cells to perform and / or modulate a therapeutic function. In one aspect, the inducible receptor systems of the present disclosure can be used to modulate T cell receptors (TCRs) and / or chimeric antigen receptor (CAR) cells used in cancer therapy. More specifically, the inducible receptor systems of the present disclosure can be used to degrade CARs and / or TCRs and inhibit excessive CAR / TCR signaling, thereby avoiding the adverse exhaustion phenotype that can be observed in many existing T cell therapies.

[0314] Vectors

[0315] The present disclosure provides vectors comprising one or more nucleic acid sequence constructs of the present disclosure. In some embodiments, the vector is an expression vector, e.g., a plasmid. In some embodiments, the expression vectors of the present disclosure can be expressed in a host cell. The host cell may, for example, be a prokaryotic cell, such as a bacterial cell; or a eukaryotic cell, such as a yeast cell, a plant cell, or a mammalian cell. Examples of mammalian cells suitable for use in the present disclosure include human primate cells and non-human primate cells. Other mammalian cells include mouse cells, rat cells, pig cells, rabbit cells, sheep cells, and goat cells. In some cases, these cells are synthetic cells. The host cell may, for example, be selected from the group consisting of an immune cell, a heart cell, a lung cell, a muscle cell, an epithelial cell, a pancreatic cell, a skin cell, a CNS cell, a neuron, a muscle cell, a skeletal muscle cell, a smooth muscle cell, a liver cell, a kidney cell, and a glial cell.

[0316] In some embodiments, the host cell is an immune cell. The immune cell can include stem cells, progenitor cells, and / or differentiated cells. The immune cell can be a cell isolated from and / or derived from the innate system and / or the adaptive immune system. The immune cell can be isolated from and / or derived from bone marrow cells or immune cell-containing organs (e.g., thymus, liver, tonsils, lymph nodes, spleen, and / or blood). In some embodiments, cells of the innate immune system include, but are not limited to, granulocytes (including basophils, eosinophils, and neutrophils), monocytes (which become macrophages), macrophages, mast cells, antigen-presenting cells (“APCs”) (including dendritic cells), and natural killer cells (“NK” cells), which also play a role in adaptive immunity. In some embodiments, cells of the adaptive immune system include, but are not limited to, hematopoietic stem cells (“HSCs”), T lymphocytes (e.g., T cells), B lymphocytes (e.g., B cells), and NK cells.

[0317] In some embodiments, the host cell is a leukocyte. In some embodiments, the host cell is a lymphocyte. In some embodiments, the host cell is a T cell. In some embodiments, the host cell is a CD8+ T cell. In some embodiments, the host cell is a CD4+ T cell. In some embodiments, the host cell is a regulatory T cell. In some embodiments, the host cell is a gamma / delta T cell. In some embodiments, the host cell is an alpha / beta T cell. In some embodiments, the host cell is an ex vivo human cell. In some embodiments, the host cell is an in vivo human cell.

[0318] In some embodiments, the host cell is modified to express an exogenous receptor. In some embodiments, the host cell is modified to express a chimeric antigen receptor (CAR). In some embodiments, the host cell is modified to express an engineered T cell receptor (TCR). In some embodiments, the host cell is an ex vivo human cell. In some embodiments, the host cell is an in vivo human cell.

[0319] In some embodiments, the host cell is modified to express an exogenous receptor. In some embodiments, the host cell is modified to express a chimeric antigen receptor (CAR). In some embodiments, the host cell is modified to express an engineered T cell receptor (TCR).

[0320] In some embodiments, the vector is used to deliver a construct of the disclosure and comprises a non-viral vector comprising one or more constructs described herein. Non-limiting examples of non-viral vectors of the disclosure include organic particles, inorganic particles (e.g., gold particles), nanoparticles, lipid-based vectors, micelles, endosomes, exosomes, liposomes, polymer-based vectors, polymersomes, peptide-based vectors, and cell-penetrating peptides.

[0321] Pharmaceutical Compositions

[0322] Also provided herein are pharmaceutical compositions. In some embodiments, a pharmaceutical composition of the disclosure comprises any one or more of the sequences, nucleotides, constructs, vectors, and cells of the disclosure in combination with a pharmaceutically acceptable excipient thereof.

[0323] Methods of Use

[0324] In some embodiments, provided herein is a method comprising using the constructs of the present disclosure to respond to a cell state and drive expression. For example, in some embodiments, the constructs are used to reduce exhaustion of immune cells, including using the constructs to drive expression of desired downstream genes during stimulation of a TCR or CAR expressed by the immune cell. The constructs provided herein respond to cell exhaustion, cell rest, antigen receptor activation, cell stimulation, and epigenetic regulation. In some embodiments, the constructs disclosed herein can be used to treat cancer (including solid and hematological cancers) or autoimmune diseases.

[0325] Also provided herein are uses of such constructs, vectors comprising the constructs described herein, and cells comprising the vectors described herein.

[0326] While embodiments of the present application have been shown and described herein, it will be understood by those skilled in the art that such embodiments are presented by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the application. It should be understood that in the development of the present application various alternatives to the embodiments described herein can be employed. The following claims are intended to define the scope of the application and are to be accorded the full scope of equivalents thereof.

[0327] Enumerated Embodiments

[0328] Embodiment I-1 A nucleic acid construct comprising a transcriptional initiator or the transcriptional initiator and a transcriptional regulator, wherein the transcriptional regulator and the transcriptional initiator each comprise a concatemer of transcription factor binding motifs that are used to bind more than one unique transcription factor or to bind the same transcription factor at more than one site, and wherein the construct is not naturally occurring.

[0329] Embodiment I-2 The construct of embodiment I-1 comprising the transcriptional regulator and the transcriptional initiator.

[0330] Embodiment I-3 The construct of embodiment I-1 wherein the transcriptional regulator is located 5’ of the transcriptional initiator.

[0331] Embodiment I-4 The construct of embodiment I-1 wherein the transcriptional regulator is located 3’ of the transcriptional initiator.

[0332] Embodiment I-5 The construct of embodiment I-1 wherein the construct does not comprise a combination of:

[0333] a transcriptional regulator comprising a NFAT sequence, an IRF4 sequence, an AICE sequence, an ISRE sequence; and

[0334] a transcriptional initiator comprising a human beta globin sequence.

[0335] Embodiment I-6 the construct according to Embodiment I-1, wherein the construct does not comprise the sequence

[0336] GGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGAATTCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC (SEQ ID NO: 9786).

[0337] Embodiment I-7 the construct according to Embodiment I-1, wherein the construct does not comprise a combination of:

[0338] a transcriptional regulator comprising a NFAT sequence, an IRF4 sequence, an AICE sequence, an ISRE sequence; and

[0339] a transcriptional initiator comprising a YB-TATA sequence.

[0340] Embodiment I-8 the construct according to Embodiment I-1, wherein the construct does not comprise the sequence

[0341] GGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGAATTCCTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9787).

[0342] Embodiment I-9 the construct according to any one of Embodiments I-1 to I-8, wherein the concatemer of the transcriptional regulator comprises two or more repeat sequences.

[0343] Embodiment I-10 The construct according to Embodiment I-9, wherein the tandem of transcription factor binding motifs binds more than one unique transcription factor.

[0344] Embodiment I-11 The construct according to Embodiment I-9, wherein the tandem of transcription factor binding motifs binds the same transcription factor at more than one site.

[0345] Embodiment I-12 The construct according to Embodiment I-9, wherein the two or more repeat sequences comprise identical sequences.

[0346] Embodiment I-13 The construct according to Embodiment I-9, wherein the two or more repeat sequences do not comprise identical sequences.

[0347] Embodiment I-14 The construct according to any one of Embodiments I-9 to I-13, wherein the tandem comprises a linker sequence located between the repeat sequences.

[0348] Embodiment I-15 The construct according to Embodiment I-14, wherein the linker sequence comprises one or more of the following sequences: TACGCT, TGATCT, TGCTTT, and TGCCCGT.

[0349] Embodiment I-16 The construct according to any one of Embodiments I-1 to I-15, wherein the transcriptional regulator comprises a sequence of one or more of the following untranscribed genomic sequences isolated from or derived from: BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORa, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

[0350] Embodiment I-17 The construct according to any one of Embodiments I-1 to I-16, wherein the transcriptional regulator comprises a sequence of one or more of the following untranscribed genomic sequences isolated from or derived from: NFAT, NFkB, REL, RELA, IRF2, GATA3, and ATF3.

[0351] Embodiment I-18 The construct according to any one of embodiments I-1 to I-16, wherein the transcriptional modulator comprises a sequence derived from an untranslated genomic sequence of NFAT, optionally comprising a sequence that is any one or more of SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

[0352] Embodiment I-19 The construct according to any one of embodiments I-1 to I-16, wherein the transcriptional modulator comprises a sequence derived from an untranslated genomic sequence of NFkB, optionally comprising a sequence that is any one or more of SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

[0353] Embodiment I-20 The construct according to any one of embodiments I-1 to I-16, wherein the transcriptional modulator comprises a sequence derived from an untranslated genomic sequence of RELA, optionally comprising a sequence that is any one or more of SEQ ID NOs: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

[0354] Embodiment I-21 The construct according to any one of embodiments 1-I to I-16, wherein the transcriptional modulator comprises a sequence derived from an untranslated genomic sequence of IRF2, optionally comprising a sequence that is any one or more of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

[0355] Embodiment I-22 The construct according to any one of embodiments I-1 to I-16, wherein the transcriptional modulator comprises a sequence derived from an untranslated genomic sequence of GATA3, optionally comprising a sequence that is any one or more of SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855.

[0356] Embodiment I-23 The construct according to any one of embodiments I-1 to I-16, wherein the transcriptional modulator comprises a sequence derived from an untranslated genomic sequence of ATF3, optionally comprising a sequence that is any one or more of SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

[0357] Embodiment I-24 The construct according to any one of embodiments I-1 to I-23, wherein (a) the transcriptional modulator is inducible, or (b) the construct is inducible.

[0358] Embodiment I-25 The construct according to any one of embodiments I-1 to I-24, wherein the transcriptional initiator comprises a classical promoter.

[0359] Embodiment I-26 The construct according to embodiment I-25, wherein the promoter comprises a minimal promoter.

[0360] Embodiment I-27 The construct according to embodiment I-26, wherein the minimal promoter comprises a sequence isolated from or derived from one or more of the following sources: minimal promoter-1 (“minPl”), YB-TATA, and human beta globin.

[0361] Embodiment I-28 The construct according to embodiment I-27, wherein the minimal promoter comprises one or more of the following elements:

[0362] MinPl having the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788);

[0363] MinP2 = having the sequence TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789); and

[0364] MinP3 = having the sequence CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

[0365] Embodiment I-29 The construct according to any one of embodiments I-1 to I-28, wherein the transcriptional initiator comprises a transcription factor binding motif.

[0366] Embodiment I-30 The construct of embodiment I-29, wherein the transcription initiator comprises a motif isolated from or derived from an untranslated genomic sequence of a transcription factor, or comprises a mammalian promoter sequence.

[0367] Embodiment I-31 The construct of embodiment I-29, wherein the motif comprises a sequence isolated from or derived from one or more of the following: BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORa, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

[0368] Embodiment I-32 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiator comprises a sequence isolated from or derived from one or more of the following: NFAT, NFkB, REL, RELA, IRF2, GATA3, and ATF3.

[0369] Embodiment I-33 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiator comprises a sequence derived from an untranslated genomic sequence of NFAT, optionally comprising a sequence that is any one or more of SEQ ID NOs: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

[0370] Embodiment I-34 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiator comprises a sequence derived from an untranslated genomic sequence of NFkB, optionally comprising a sequence that is any one or more of SEQ ID NOs: 550-553, 1060-1063, and 5696-5699.

[0371] Embodiment I-35 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiator comprises a sequence derived from an untranslated genomic sequence of REL, optionally comprising a sequence that is any one or more of SEQ ID NOs: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

[0372] Embodiment I-36 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiator comprises a sequence derived from an untranslated genomic sequence of RELA, optionally comprising a sequence that is any one or more of SEQ ID NOs: 4484-4499, 4994-5009, and 9630-9645.

[0373] Embodiment I-37 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiator comprises a sequence derived from an untranslated genomic sequence of IRF2, optionally comprising a sequence that is any one or more of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

[0374] Embodiment I-38 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiator comprises a sequence derived from an untranslated genomic sequence of GATA3, optionally comprising a sequence that is any one or more of SEQ ID NOs: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225, and 8712-8855.

[0375] Embodiment I-39 The construct of any one of embodiments I-1 to I-31, wherein the transcription initiator comprises a sequence derived from an untranslated genomic sequence of ATF3, optionally comprising a sequence that is any one or more of SEQ ID NOs: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214, and 8286-8293.

[0376] Embodiment I-40 The construct of any one of embodiments I-1 to I-39, wherein the transcription initiator comprises any one or more of SEQ ID NOs: 175-9781, or a concatemer thereof.

[0377] Embodiment I-41 The construct of any one of embodiments I-1 to I-40, wherein the construct further comprises an integration sequence that is capable of inducing or increasing insertion of the construct into a target site.

[0378] Embodiment I-42 The construct of embodiment I-41, wherein the vector comprises the target site.

[0379] Embodiment I-43 The construct of embodiment I-41, wherein the chromosome comprises the target site.

[0380] Embodiment I-44 The construct of any one of embodiments I-41 to I-43, wherein the integration sequence comprises a first or 5’ integration sequence and a second or 3’ integration sequence.

[0381] Embodiment I-45 The construct of any one of embodiments I-41 to I-44, wherein the integration sequence comprises a homologous sequence corresponding to the insertion site to facilitate homologous recombination.

[0382] Embodiment I-46 The construct of any one of embodiments I-41 to I-44, wherein the integration sequence comprises a transposable element to facilitate transposition.

[0383] Embodiment I-47 The construct of embodiment I-46, wherein the transposable element comprises an insertion sequence and / or a transposon sequence.

[0384] Embodiment I-48 The construct of any one of embodiments I-41 to I-44, wherein the integration sequence comprises a first 5’ terminal repeat sequence or a second 3’ terminal repeat sequence.

[0385] Embodiment I-49 The construct of embodiment I-48, wherein the integration sequence comprises a first 5’ terminal repeat sequence and a second 3’ terminal repeat sequence.

[0386] Embodiment I-50 The construct of embodiment I-48 or I-49, wherein the first 5’ terminal repeat sequence or the second 3’ terminal repeat sequence comprises a long terminal repeat sequence (LTR).

[0387] Embodiment I-51 The construct of embodiment I-48 or I-49, wherein the first 5’ terminal repeat sequence or the second 3’ terminal repeat sequence comprises an inverted terminal repeat sequence (ITR).

[0388] Embodiment I-52 The construct of any one of embodiments I-1 to I-51, further comprising a reporter sequence.

[0389] Embodiment I-53 The construct of embodiment I-52, wherein the reporter sequence comprises a fluorescent protein.

[0390] Embodiment I-54 The construct of embodiment I-53, wherein the reporter sequence comprises a green fluorescent protein (GFP).

[0391] Embodiment I-55 A vector comprising the construct of any one of embodiments I-1 to I-54.

[0392] Embodiment I-56 The vector of embodiment I-55, wherein the vector is a mammalian expression vector capable of expressing the construct in a mammalian cell.

[0393] Embodiment I-57 The vector of embodiment I-55 or I-56, wherein the vector is an expression vector capable of expressing the construct in a human cell.

[0394] Embodiment I-58 The vector of embodiment I-57, wherein the vector is a delivery vector capable of delivering the construct to a mammalian cell.

[0395] Embodiment I-59 The vector of embodiment I-55 or I-58, wherein the vector is a delivery vector capable of delivering the construct to a human cell.

[0396] Embodiment I-60 A library comprising the construct of any one of embodiments I-11 to I-54, or the vector of any one of embodiments I-55 to I-59.

[0397] Embodiment I-61 The library of embodiment I-60, comprising a plurality of the construct of any one of embodiments I-1 to I-54, or a plurality of the vector of any one of embodiments I-55 to I-59.

[0398] Embodiment I-62 The library of embodiment I-60 or I-61, comprising a plurality of constructs, each sequence according to any one of embodiments I-1 to I-54.

[0399] Embodiment I-63 The library of embodiment I-60 or I-61, comprising a plurality of vectors, each vector according to any one of embodiments I-55 to I-59.

[0400] Embodiment I-64 A cell, comprising

[0401] the construct according to any one of embodiments I-1 to I-54;

[0402] the vector according to any one of embodiments I-55 to I-59; or

[0403] the library according to any one of embodiments I-60 to I-63.

[0404] Embodiment I-65 The cell of embodiment I-64, wherein the cell is an immune cell.

[0405] Embodiment I-66 The cell of embodiment I-64 or I-65, wherein the cell is a stem cell, progenitor cell, precursor cell, or initial cell.

[0406] Embodiment I-67 The cell of embodiment I-64 or I-65, wherein the cell is a differentiated cell.

[0407] Embodiment I-68 The cell of any one of embodiments I-64 to I-67, wherein the cell is a T cell, B cell, macrophage, or NK cell.

[0408] Embodiment I-69 The cell of any one of embodiments I-64 to I-67, wherein the cell is a T cell.

[0409] Embodiment I-70 The cell of any one of embodiments I-64 to I-67, wherein the cell is a NK cell.

[0410] Embodiment I-71 The cell of any one of embodiments I-64 to I-67, wherein the cell is in vitro or ex vivo.

[0411] Embodiment I-72 The cell of any one of embodiments I-64 to I-67, wherein the cell is a primary cell.

[0412] Embodiment I-73 The cell of any one of embodiments I-64 to I-67, wherein the cell is a cultured cell.

[0413] Embodiment I-74 Use of a construct according to any one of embodiments I-1 to I-54, a vector according to any one of embodiments I-55 to I-59, a library according to any one of embodiments I-60 to I-63, or a cell according to any one of embodiments I-64 to I-73 for selecting a sequence responsive to one or more of: antigen receptor activation, cell stimulation, cell exhaustion, cell rest, and epigenetic regulation.

[0414] Embodiment I-75 The use according to embodiment I-74, wherein cell stimulation is early stage stimulation.

[0415] Embodiment I-76 The use according to embodiment I-74, wherein cell stimulation is late stage stimulation.

[0416] Embodiment I-77 The use according to embodiment I-74, wherein the antigen receptor is a chimeric antigen receptor.

[0417] Embodiment I-78 The use according to embodiment I-74, wherein the cell is a T cell, and wherein the antigen receptor is an endogenous or exogenous T cell receptor (TCR).

[0418] Embodiment I-79 Use of a construct according to any one of embodiments I-1 to I-54, a vector according to any one of embodiments I-55 to I-59, a library according to any one of embodiments I-60 to I-63, or a cell according to any one of embodiments I-64 to I-73 for regulating transcription of an exogenous protein responsive to one or more of: antigen receptor activation, cell stimulation, cell exhaustion, cell rest, and epigenetic regulation.

[0419] Embodiment I-80 The use according to embodiment I-79, wherein the exogenous protein is one or more of: an engineered receptor, a cytokine, or a degrader.

[0420] Embodiment II-1 An inducible nucleic acid construct comprising a transcriptional regulatory enhancer sequence and a transcriptional initiation promoter sequence (EP pair), wherein the construct is non-naturally occurring.

[0421] Embodiment II-2 The construct according to embodiment II-1, wherein the EP pair comprises an EP pair sequence that is any one or more of SEQ ID NOs: 1-174, or a sequence with 90% sequence identity thereto.

[0422] Embodiment II-3 The construct of embodiment II-1, wherein the EP pair comprises an enhancer sequence having at least 70% sequence identity to any one or more of the enhancer sequences of SEQ ID NOs: 1-174.

[0423] Embodiment II-4 The construct of embodiment II-1, wherein the EP pair comprises a promoter sequence having at least 70% sequence identity to any one or more of the promoter sequences of SEQ ID NOs: 1-174.

[0424] Embodiment II-5 The construct of embodiment II-1, wherein the enhancer sequence is located 5’ of the promoter sequence.

[0425] Embodiment II-6 The construct of embodiment II-1, wherein the enhancer sequence is located 3’ of the promoter sequence.

[0426] Embodiment II-7 The construct of embodiment II-1, wherein the EP pair comprises about 100 base pairs to about 1500 base pairs.

[0427] Embodiment II-8 The construct of embodiment II-1, wherein the EP pair comprises about 500 base pairs to about 1250 base pairs.

[0428] Embodiment II-9 The construct of embodiment II-1, wherein the EP pair comprises about 900 base pairs to about 1100 base pairs.

[0429] Embodiment II-10 The construct of any one of embodiments II-1 to II-9, wherein the construct further comprises a barcode sequence.

[0430] Embodiment II-11 The construct of embodiment II-10, wherein the barcode sequence is located 5’ of the EP pair.

[0431] Embodiment II-12 The construct of embodiment II-10, wherein the barcode sequence is located 3’ of the EP pair.

[0432] Embodiment II-13 The construct of any one of embodiments II-1 to II-12, wherein the construct further comprises a 5’ untranslated region (UTR) located 3’ of the EP pair.

[0433] Embodiment II-14 The construct of any one of embodiments II-1 to II-12, wherein the construct further comprises a 5’ untranslated region (UTR) located 3’ to the barcode sequence.

[0434] Embodiment II-15 The construct of any one of embodiments II-1 to II-14, wherein the construct further comprises an integration sequence capable of inducing or increasing insertion of the construct into a target site.

[0435] Embodiment II-16 The construct of embodiment II-15, wherein the target site is a target site in a vector.

[0436] Embodiment II-17 The construct of embodiment II-15, wherein the target site is a target site in a chromosome.

[0437] Embodiment II-18 The construct of any one of embodiments II-15 to II-17, wherein the integration sequence comprises a first or 5’ integration sequence and a second or 3’ integration sequence.

[0438] Embodiment II-19 The construct of any one of embodiments II-15 to II-18, wherein the integration sequence comprises a homologous sequence corresponding to the insertion site to facilitate homologous recombination.

[0439] Embodiment II-20 The construct of any one of embodiments II-15 to II-18, wherein the integration sequence comprises a transposable element to facilitate transposition.

[0440] Embodiment II-21 The construct of embodiment II-20, wherein the transposable element comprises an insertion sequence and / or a transposon sequence.

[0441] Embodiment II-22 The construct of any one of embodiments II-15 to II-18, wherein the integration sequence comprises a first 5’ terminal repeat sequence or a second 3’ terminal repeat sequence.

[0442] Embodiment II-23 The construct of embodiment II-21 or II-22, wherein the first 5’ terminal repeat sequence or the second 3’ terminal repeat sequence comprises a long terminal repeat sequence (LTR).

[0443] Embodiment II-24 The construct of embodiment II-21 or II-22, wherein the first 5’ terminal repeat sequence or the second 3’ terminal repeat sequence comprises an inverted terminal repeat sequence (ITR).

[0444] Embodiment II-25 The construct of any one of embodiments II-1 to II-24, further comprising a reporter sequence.

[0445] Embodiment II-26 The construct of embodiment II-25, wherein the reporter sequence comprises a fluorescent protein.

[0446] Embodiment II-27 The construct of embodiment II-26, wherein the reporter sequence comprises a green fluorescent protein (GFP).

[0447] Embodiment II-28 The construct of any one of embodiments II-1 to II-27, wherein the enhancer sequence is isolated from or derived from a sequence of one or more of human chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23.

[0448] Embodiment II-29 The construct of any one of embodiments II-1 to II-28, wherein the enhancer sequence is a minimal sequence that exhibits enhancer function or activity.

[0449] Embodiment II-30 The construct of embodiment II-28 or II-29, wherein the enhancer sequence comprises at least about 50 base pairs (bp), at least about 100 bp, at least about 150 bp, at least about 200 bp, at least about 250 bp, at least about 300 bp, at least about 350 bp, at least about 400 bp, at least about 450 bp, at least about 500 bp, or any number of base pairs between the recited values.

[0450] Embodiment II-31 The construct of any one of embodiments II-1 to II-30, wherein the promoter sequence is isolated from or derived from a sequence of one or more of human chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23.

[0451] Embodiment II-32 The construct of any one of embodiments II-1 to II-31, wherein the promoter sequence is a minimal sequence that exhibits promoter function or activity.

[0452] Embodiment II-33 The construct of embodiment II-31 or II-32, wherein the promoter sequence comprises at least about 50 base pairs (bp), at least about 100 bp, at least about 150 bp, at least about 200 bp, at least about 250 bp, at least about 300 bp, at least about 350 bp, at least about 400 bp, at least about 450 bp, at least about 500 bp, or any quantity of base pairs between the recited values.

[0453] Embodiment II-34 A vector comprising the construct of any one of embodiments II-1 to II-33.

[0454] Embodiment II-35 The vector of embodiment II-34, wherein the transcriptional regulatory enhancer sequence and / or the transcriptional initiation promoter sequence is operably linked to a nucleic acid sequence encoding any one or more of the following elements: a chimeric antigen receptor (CAR), an exogenous T cell receptor (TCR), a cytokine, or a degrader.

[0455] Embodiment II-36 The vector of any one of embodiments II-34 to II-35, wherein the vector is a mammalian expression vector capable of expressing the construct in a mammalian cell.

[0456] Embodiment II-37 The vector of any one of embodiments II-34 to II-36, wherein the vector is an expression vector capable of expressing the construct in a human cell.

[0457] Embodiment II-38 The vector of any one of embodiments II-34 to II-35, wherein the vector is a delivery vector capable of delivering the construct to a mammalian cell.

[0458] Embodiment II-39 The vector of any one of embodiments II-34 to II-35, wherein the vector is a delivery vector capable of delivering the construct to a human cell.

[0459] Embodiment II-40 A library comprising the construct of any one of embodiments II-1 to II-33, or the vector of any one of embodiments II-34 to II-39.

[0460] Embodiment II-41 The library of embodiment II-40, comprising a plurality of the construct of any one of embodiments II-1 to II-33, or a plurality of the vector of any one of embodiments II-34 to II-39.

[0461] Embodiment II-42 The library of embodiment II-40 or II-41, comprising a plurality of constructs, each sequence according to any one of embodiments II-1 to II-33.

[0462] Embodiment II-43 The library of embodiment II-42, wherein each construct comprises a unique barcode sequence.

[0463] Embodiment II-44 The library of embodiment II-40 or II-41, comprising a plurality of vectors, each vector according to any one of embodiments II-34 to II-39.

[0464] Embodiment II-45 A cell, comprising

[0465] a construct according to any one of embodiments II-1 to II-33;

[0466] a vector according to any one of embodiments II-34 to II-39; or

[0467] a library according to any one of embodiments II-40 to II-44.

[0468] Embodiment II-46 The cell of embodiment II-45, wherein the cell is an immune cell.

[0469] Embodiment II-47 The cell of embodiment II-45, wherein the cell is a stem cell, progenitor cell, precursor cell, or initial cell.

[0470] Embodiment II-48 The cell of embodiment II-45, wherein the cell is a differentiated cell.

[0471] Embodiment II-49 The cell of any one of embodiments II-45 to II-48, wherein the cell is a T cell, B cell, macrophage, or NK cell.

[0472] Embodiment II-50 The cell of any one of embodiments II-45 to II-48, wherein the cell is a T cell.

[0473] Embodiment II-51 The cell of any one of embodiments II-45 to II-48, wherein the cell is a NK cell.

[0474] Embodiment II-52 The cell of any one of embodiments II-45 to II-48, wherein the cell is in vitro or ex vivo.

[0475] Embodiment II-53 The cell according to any one of embodiments II-45 to II-48, wherein the cell is a primary cell.

[0476] Embodiment II-54 The cell according to any one of embodiments II-45 to II-48, wherein the cell is a cultured cell.

[0477] Embodiment II-55 Use of the construct according to any one of embodiments II-1 to II-33, the vector according to any one of embodiments II-34 to II-39, the library according to any one of embodiments II-40 to II-44, or the cell according to any one of embodiments II-45 to II-54, for selecting EP pairing in response to one or more of: antigen receptor activation, cell stimulation, cell exhaustion, cell rest, epigenetic regulation.

[0478] Embodiment II-56 The use according to embodiment II-55, wherein cell stimulation is early stage stimulation.

[0479] Embodiment II-57 The use according to embodiment II-55, wherein cell stimulation is late stage stimulation.

[0480] Embodiment II-58 The use according to embodiment II-55, wherein the antigen receptor is a chimeric antigen receptor (CAR).

[0481] Embodiment II-59 The use according to embodiment II-55, wherein the cell is a T cell, and wherein the antigen receptor is an endogenous or exogenous T cell receptor (TCR).

[0482] Embodiment III-1 An inducible construct comprising a nucleic acid / nucleotide / polynucleotide sequence encoding a circuit component, wherein the circuit component comprises

[0483] a response component, wherein the response component is capable of changing an activity of the effector component in response to:

[0484] a signal from a receptor,

[0485] an epigenetic change,

[0486] transcriptional induction or transcriptional repression, or

[0487] a change in cell state, and

[0488] an effector component, wherein the activity of the response component is capable of inducing a change in the activity of the effector component; and

[0489] wherein the construct is not naturally occurring.

[0490] Embodiment III-2 The construct of Embodiment III-1, wherein the response component comprises one or more of the following elements: a sequence of a transcription factor (TF) untranslated region, a sequence comprising a TF binding site, a promoter, an enhancer, and a suppressor.

[0491] Embodiment III-3 The construct of Embodiment III-1, wherein the response component comprises an epigenetic modifier.

[0492] Embodiment III-4 The construct of Embodiment III-1, wherein the response component comprises a transcription initiator (e.g., a promoter) or a transcription initiator (e.g., a promoter) and a transcription regulator (e.g., an enhancer).

[0493] Embodiment III-5 The construct of Embodiment III-4, wherein the promoter comprises a minimal promoter.

[0494] Embodiment III-6 The construct of Embodiment III-5, wherein the minimal promoter comprises one or more of the following elements

[0495] MinPl = which has the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788);

[0496] MinP2 = which has the sequence

[0497] TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789);

[0498] MinP3 = which has the sequence

[0499] CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

[0500] Embodiment III-7 The construct of Embodiment III-4 or III-5, wherein the promoter comprises an inducible promoter.

[0501] Embodiment III-8 The construct of Embodiment III-4, wherein the transcription initiator comprises a concatamerization sequence.

[0502] Embodiment III-9 The construct of Embodiment III-8, wherein the concatamerization sequence comprises a sequence that is any one or more of SEQ ID NOs: 176-9781, or a sequence with at least about 70% sequence identity thereto.

[0503] Embodiment III-10 The construct of Embodiment III-8, wherein the transcription initiator comprises a sequence derived from an untranslated genomic sequence of IRF2, optionally comprising a sequence that is any one or more of SEQ ID NOs: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

[0504] Embodiment III-11 The construct of Embodiment III-4, wherein the response component comprises a pair of enhancer and promoter (EP pair).

[0505] Embodiment III-12 The construct of Embodiment III-11, wherein the EP pair comprises a sequence that is any one or more of SEQ ID NOs: 1-175, or a sequence with at least about 90% sequence identity thereto.

[0506] Embodiment III-13 The construct of Embodiment III-11, wherein the EP pair comprises an enhancer sequence that is any one or more of the enhancer sequences of SEQ ID NOs: 1-174, or a sequence with at least about 70% sequence identity thereto; and / or wherein the EP pair comprises a promoter sequence that is any one or more of the promoter sequences of SEQ ID NOs: 1-174, or a sequence with at least about 70% sequence identity thereto.

[0507] Embodiment III-14 The construct of any one of Embodiments III-1 to III-13, wherein the effector component comprises a degrader.

[0508] Embodiment III-15 The construct of any one of Embodiments III-1 to III-13, wherein the signal from the receptor comprises a signal from a chimeric antigen receptor (CAR).

[0509] Embodiment III-16 The construct of any one of Embodiments III-1 to III-15, wherein the cell state comprises one or more of the following states:

[0510] unstimulated;

[0511] stimulation initiation;

[0512] Stimulation off;

[0513] Failure; and

[0514] Resting.

[0515] Embodiment III-17 A cell comprising the construct according to any one of embodiments III-1 to III-16.

[0516] Embodiment III-18 The cell according to embodiment III-17, wherein the cell is an immune cell.

[0517] Embodiment III-19 The cell according to embodiment III-17 or III-18, wherein the cell is a stem cell, progenitor cell, precursor cell, or initial cell.

[0518] Embodiment III-20 The cell according to embodiment III-17 or III-18, wherein the cell is a differentiated cell.

[0519] Embodiment III-21 The cell according to any one of embodiments III-17 to III-20, wherein the cell is a T cell, B cell, macrophage, or NK cell.

[0520] Embodiment III-22 The cell according to any one of embodiments III-17 to III-21, wherein the cell is a T cell.

[0521] Embodiment III-23 The cell according to any one of embodiments III-17 to III-21, wherein the cell is a NK cell.

[0522] Embodiment III-24 The cell according to any one of embodiments III-17 to III-21, wherein the cell is in vitro or ex vivo.

[0523] Embodiment III-25 The cell according to any one of embodiments III-17 to III-21, wherein the cell is a primary cell.

[0524] Embodiment III-26 The cell according to any one of embodiments III-17 to III-21, wherein the cell is a cultured cell.

[0525] Embodiment III-27 Use of any one of the constructs, circuits, vectors, or cells according to embodiments III-1 to III-26, for inducibly regulating expression of an effector module in response to a cell state.

[0526] Examples

[0527] Example 1: General Methods

[0528] Arrayed screening method, enhancer-promoter (EP) pair-CAR circuit in vitro functional test: T cells were cultured in T cell media (TCM) composed of the following: OpTmizer basal media (Thermo) + OpTmizer cell supplement (Thermo) + Immune Cell Serum Replacement (Thermo) + 2 mM L-glutamine (Gibco) + 2 mM GlutMAX (Thermo) with 200 IU / mL recombinant IL-2 (R&D Systems), 1200 IU / mL recombinant IL-7 (R&D Systems), and 200 IU / mL recombinant IL-15 (R&D Systems). On day 0 of T cell preparation, cryopreserved T cells were thawed into TCM pre-warmed at 37°C and immediately added TransAct TM (Miltenyi) for 24 hours of activation. After 24 hours of activation, T cells were resuspended at a density of 3e6 cells / mL in TCM with 1X TransAct TM added, followed by transduction with a single lentiviral vector expressing a “tool” (i.e., ROR1) CAR and a truncated CD19 (tCD19) transduction marker driven by a unique promoter at a multiplicity of infection (MOI) of 4. Lentiviral vector copy number (VCN) was predicted by titration on Jurkat cells followed by measurement of VCN by droplet digital polymerase chain reaction (ddPCR). After 24 hours of transduction, T cells were transferred to 2 mL of cytokine-containing TCM in a 24-well plate for expansion culture, which terminated the activation state. On day 4 post-thaw, T cells were split 1:2 in volume into fresh cytokine-containing TCM.

[0529] On day 7 post-thaw, T cells were harvested, transduction efficiency was assessed by flow cytometry, and viability and cell counts were assessed by acridine orange / propidium iodide (AO / PI) staining (Nexcelom Biosciences) on a Cellometer cell counter (Nexcelom Biosciences). Given that MND CAR and 10xNFkB CAR samples had previously characterized activity on day 6 post-transduction, they were used to assess transduction efficiency. T cells were subsequently used for downstream passage stimulation assays.

[0530] The passage stimulation assay was set up in 1640-RPMI medium supplemented with 10% FBS. Exemplary target cells (i.e., epithelial-derived H1975-mKate cells isolated from the lungs of a non-smoking female non-small cell lung cancer patient) were maintained up to passage 20 and seeded at a density of 20,000 cells per well in 96-well circular grooved plates (Eppendorf) and incubated at 37°C for 2 hours to allow attachment. 3 mL of 1X PBS was added to each well of the plate to prevent evaporation. T cells were seeded at a 1:2 effector cell:target cell (E:T) ratio, based on the viable cell count obtained from AOPI. The final volume in each well was 200 μL. These co-culture plates were then placed... Images were acquired every 6 hours in the red channel using the Sx5 (Sartorius) for 3 to 4 days. 24 hours after initial co-culture establishment, 30 μL of supernatant was collected from each well and stored at -80°C. After at least 24 hours, the supernatant was diluted 1:5 in an MSD plate, and the concentrations of IFN-γ and IL-2 were determined according to the manufacturer's instructions. 3 to 4 days after initial co-culture establishment, new plates of target cells were prepared at a density of 20,000 cells per well as previously described. The original co-culture was gently resuspended, and 50% of the suspension was transferred to the newly seeded target cell culture plates. These culture plates were then placed... Images were acquired every 6 hours in the Sx5 culture plates for 3 to 4 days. The first round concluded, and the second round began. Excess cells from the first round of culture plates were harvested, stained for transduction markers and CAR expression, and analyzed by flow cytometry for surface marker expression and T cell expansion. This passage stimulation assay continued for 4 to 5 rounds.

[0531] Preparation of tumor spheroids: 1×10 4 One target cell was suspended in 100 μL of R10 medium and added to the wells of a 96-well round-bottom ultra-low adsorption culture plate (Sbio) to prepare tumor spheroids. PBS was added to the edge wells. The culture plate was centrifuged at 1,000 x g for 10 min and then transferred to a 37°C incubator for 72 h.

[0532] Globular body killing power assay: Transduced T cells (as described above) were administered at a dose of 1×10⁻⁶. 4 The samples were resuspended in R10 medium at a concentration of [number] cells / mL. Each sample was serially diluted twice to obtain 5 × 10⁶ samples. 3 cells / mL and 2.5 × 10 3 Two concentrations of cell suspension were prepared at 1 / mL. 100 μL of each sample dilution was added to three wells of each spheroid to measure the E:T ratios at 1:10, 1:20, and 1:40. The culture plate was placed in… Images were collected every 6 hours for 1 week in Sx5. The average total red fluorescence cumulative intensity (RCU x pm2) was calculated for 3 technical replicates per sample and normalized to baseline levels for visualization. At the end of the assay, plates were centrifuged and cells were resuspended in cell stain buffer (BioLegend) per well. Triplicate samples from wells with an E:T ratio of 1 : 10 were pooled and processed for surface marker staining at 4°C for 20 minutes. Cells were then resuspended in CSB and analyzed by flow cytometry after fixation with Fluorofix TM Data was acquired on a Ze5 (Biorad) and analyzed using FlowJo software.

[0533] For Imaging cell line construction (RK): Lentivirus was produced using 293T cells in suspension culture. CAR virus was concentrated 10x using LentiX, while EP-mkate2 virus was produced in an arrayed 96-well plate format without concentration. Primary T cells were co-transduced with MND-CAR at MOI = 4 and 50 pL EP-mKate2 library in a 96-well plate format. After 24 hours of transduction, cells were expanded into a 24-well plate format. After 5 days of transduction, stem cell "EasySep TM CAR positive cells were cell enriched using the "Human CD19 Positive Selection Kit II" (Cat # 17854). Cells were expanded in TCM + cytokines for 11-14 days.

[0534] Incucyte imaging experiment (RK): After 11-14 days of recovery, T cells were harvested. Cells were seeded at a density of 100,000 cells per well in Nunc Edge 96-well plates with 1 pg / mL ROR1 antigen coated plates or uncoated plates, respectively. Cells were imaged every 4 hours using the red fluorescence channel and brightfield channel using the Incucyte live imaging incubator. On days 2, 4, 7, 9, and 11 of the assay, stimulated cells were split into fresh antigen coated plates; unstimulated cells were supplemented with fresh media with cytokines. The experimental time course ended after 14 days. Normalized fluorescence intensity ) was calculated by dividing the red fluorescence integral intensity by the degree of confluence of the cells. Figures 6A-6B

[0535] Example 2: Generating Enhancer-Promoter Libraries

[0536] As Figure 3 ​As shown, over one million constructs were generated for a massively parallel reporter assay (MPRA). Transcription levels were measured using RNA-seq, and enhancer-promoter (EP) pair copy numbers were normalized using DNA-seq. In the construct architecture depicted in this figure, approximately one million combinations of fifty thousand different enhancer sequences were used to form unique combinations with nine thousand promoter sequences. The library comprising over one million constructs was functionally tested to identify constructs with inducible activity patterns under specific conditions or induced cellular states, such as stimulated, unstimulated, pulsed stimulation, sustained stimulation, resting, and exhaustion. Briefly, MPRA included: T cells were thawed on day 0, the thawed cells were transduced with a “tool” CAR on day 1, and CD19+ cell enrichment was performed on day 4 (see detailed protocol in Example 1). Both stimulated and unstimulated conditions were initiated on day 7 (relative to day 0 thaw). Resting conditions were initiated on day 14 (relative to day 0 thaw).

[0537] Example 3: EP Pairing Primary Screening

[0538] As shown in FIG. 6, each EP pair was functionally characterized for activity that is both associated with and favorable to endogenous regulatory mechanisms of exogenous constructs (e.g., chimeric receptors, cytokines, or exogenous modulators) (e.g., regulation induced by activity of endogenous circuits, modified endogenous circuits, and / or exogenous circuits, and initiation or change of cellular state). See experimental protocol in Example 1. Briefly, this screening experiment was designed to: (1) determine EP pairs that can drive protein expression, and (2) roughly categorize EP pairings into three categories of stimulation initiation, stimulation shutdown, and oscillatory based on qualitative behavior patterns.

[0539] Figure 7 A series of graphs are provided depicting activity of control constructs or EP pair containing constructs of the disclosure under both stimulated and unstimulated conditions. For each graph, normalized fluorescence intensity (expressed in fluorescence arbitrary units) is plotted as a function of time (in days) versus cell confluency (expressed in percent). For control constructs, the MND is known to have constitutive activity, while the tandem NFkB (10xNFkB) of the disclosure is shown to have inducible activity in the presence of antigen, thus its activity follows a stimulation initiation pattern. For EP pair constructs, low cell confluency in this experiment makes it difficult to identify constructs that are still active under unstimulated conditions. However, several EP pair constructs are observed to have inducible activity under stimulated conditions.

[0540] Figures 8A-8C A series of graphs are provided showing dynamic range of EP pairings characterized according to Figures 6A-6B the protocol. Figure 8AThe maximum expression level of each construct in this study is shown, with the data for MND and 10xNFkB control constructs labeled. Figure 8B The minimum expression level of each construct in this study is shown, with the data for MND and 10xNFkB control constructs labeled. Figure 8C The expression range of each construct in this study is shown, with the data for MND and 10xNFkB control constructs labeled. In some embodiments, constructs with a larger dynamic range, including the minimum expression level under unstimulated conditions, are ideal constructs for initiating a circuit of stimulation.

[0541] Figure 9 is a series of graphs depicting RNA and protein produced from exemplary constructs of the disclosure comprising EP pairs. As shown in the right panel, not all RNA and protein data present a consistent picture at the qualitative level. However, each construct of the disclosure can be functionally characterized for its transcriptional activity in terms of cellular activity (e.g., contact with antigen) or cellular state (e.g., stimulation and / or exhaustion). In some embodiments, the presence or absence of a 5’ UTR sequence, or the composition of a 5’ UTR sequence, influences the translational behavior of transcripts produced under the control of a construct of the disclosure.

[0542] Figure 10 is a repeat of the study performed in Figure 9 Notably, this study provides data under unstimulated conditions at a higher cell confluency compared to the study in Figure 9

[0543] Example 3: Functional Activity of EP Pairs

[0544] As shown in Figure 11 , a mixed screen with constructs of the disclosure comprising EP pairs (see SEQ ID Nos: 1-174) is performed, with the schematic for driving “tool-like” CAR expression in T cells (top panel) and the schematic for the screen experimental design (bottom panel), respectively. Control constructs comprise MND constitutive and 10xNFkB inducible promoters.

[0545] Figure 12 is a pair of graphs showing the process of candidate construct enrichment selection based in part on the results of negative selection of exhausted T cells, identified in this embodiment as CD39+TIGIT+.

[0546] Example 4: Target Cell Killing and Cytokine Production Assays

[0547] As shown in Figure 13 ​As shown, a confirmatory three-donor assay was performed using the best-performing EP pairs identified in the initial screening using only a single donor. In the initial screening, these test constructs included 26 constructs of tool-like CARs driven by EP pairs, and four control constructs (constructs of tool-like CAR expression driven by the MND promoter and the 10xNFkB promoter, each control promoter having and not having a barcode, respectively). The initial screening aimed to identify those constructs that demonstrated the most significant in vitro killing effect on target cancer cells by comparing their activity with that of each control construct. In this confirmatory screening, nine constructs of tool-like CARs driven by selected EP pairs were used (see [link to confirmatory screening]). Figure 14 and Figure 15 ), and two control constructs (the same ones used in the initial screening).

[0548] Figure 14 A series of charts depicting the data from... Figure 13 The confirmatory study included target cell killing data for each round of experiments. In each round, the ability of each construct to drive instrumental CAR expression and kill target cancer cells (H1975 mKate cells) was expressed as a function of the target cell count normalized to time = 0 over time (in hours). The data showed that the “OTP-CSF2” EP pair demonstrated comparable killing efficacy to constructs containing a control 10xNFkB promoter (used to drive the same CAR expression). The data further suggest that the “RPS6KA1-RSRP1” EP pair can be used as a regulated alternative to the constitutive control promoter MND.

[0549] Figure 15 A series of charts depict the expression of each of the three donors. Figure 13 The T cell secretion of cytokines (IL-2 and interferon-γ) for each test construct was assessed. Data showed that the functional activities exhibited by the “OTP-CSF2” and “RPS6KA1-RSRP1” EP pairs were at least comparable to those of the control constructs with the MND promoter and the 10xNFkB promoter, respectively. Furthermore, when the “OTP-CSF2” EP pair drove CAR expression, T cells showed higher levels of IL-2 expression than when the same CAR was driven by the MND control promoter. The “RPS6KA1-RSRP1” EP pair showed higher overall cytokine expression levels compared to the other seven test constructs, a result consistent with… Figure 14 The data on the killing of target cells presented are consistent.

[0550] Example 5: Regulated CAR Circuits

[0551] like Figures 16A-16B andFigure 18 As shown, the EPs of the present disclosure induce regulatory control of exogenous elements, including e.g. CARs, within T cells. The ability to regulate expression of various exogenous elements in response to changes in endogenous state results in better functional outcomes.

[0552] CAR expression levels for each control construct (containing MND promoter and 10x NFkB promoter, respectively) and two test constructs (containing “OTP-CSF2” and “RPS6KA1-RSRP1” EP pairings, respectively) following one round of antigen stimulation. Figure 16A A series of cell sorting plots are shown, including unstimulated (top panel) and stimulated (with addition of H1975-mKate target cells, bottom panel) groups, with CD19 marker levels presented on the Y-axis and CAR expression levels presented on the X-axis. See Figure 11 for a schematic of the constructs and markers used. Shown in this figure are representative data from donor 2. Figure 16B A graph showing summary and quantitative data from all three donors in this study. Data are presented as the % tCD19+CAR+ average value ± SEM for each condition and each construct for the three donors. Integration of the above data indicates that: (1) the “OTP-CSF2” construct shows stimulation-initiated activity following one round of passaged stimulation, and (2) the “RPS6KA1-RSRP1” has a different expression dynamic compared to the MND control construct, but its functional readout is similar to the MND control construct.

[0553] Figure 18 A pair of schematics and corresponding graphs depicting exemplary use of the constructs of the present disclosure in a cell circuit. Data show that under in vitro long-term stimulation conditions, an MSLN CAR regulated by NFkB shows improved killing capacity and cytokine production capacity compared to the same MSLN CAR under control of MND constitutive expression.

Claims

1. A nucleic acid construct comprising a transcription initiator or said transcription initiator and a transcription regulator, wherein said transcription regulator and said transcription initiator each comprise a tandem of a transcription factor binding motif, said tandem for binding more than one unique transcription factor, or for binding the same transcription factor at more than one site, and wherein said construct is non-naturally occurring.

2. The construct according to claim 1, comprising the transcription regulator and the transcription initiator.

3. The construct according to claim 1, wherein the transcription regulator is located at the 5' end of the transcription initiator.

4. The construct according to claim 1, wherein the transcription regulator is located at the 3' end of the transcription initiator.

5. The construct of claim 1, wherein the construct does not comprise a combination of the following: (a) Transcriptional regulators containing NFAT, IRF4, AICE, and ISRE sequences; and (b) Transcription initiators containing human β-globin sequences.

6. The construct of claim 1, wherein the construct does not contain a sequence. GGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGAATTCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC (SEQ ID NO: 9786).

7. The construct of claim 1, wherein the construct does not comprise a combination of the following: (a) Transcriptional regulators containing NFAT sequences; and (b) Transcription initiators containing the YB-TATA sequence.

8. The construct of claim 1, wherein the construct does not contain a sequence. GGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGAATTCCTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9787).

9. The construct according to any one of claims 1 to 8, wherein the tandem form of the transcription regulator comprises two or more repeating sequences.

10. The construct of claim 9, wherein the tandem of the transcription factor binding motif binds more than one unique transcription factor.

11. The construct according to claim 9, wherein the tandem of the transcription factor binding motif binds the same transcription factor at more than one site.

12. The construct of claim 9, wherein the two or more repeating sequences comprise the same sequence.

13. The construct of claim 9, wherein the two or more repeating sequences do not include identical sequences.

14. The construct according to any one of claims 9 to 13, wherein the tandem comprises a connecting sequence located between the repeating sequences.

15. The construct of claim 14, wherein the connection sequence comprises one or more of the following sequences: TACGCT, TGATCT, TGCTTT, and TGCCCGT.

16. The construct according to any one of claims 1 to 15, wherein the transcription regulator comprises a sequence isolated from or derived from one or more of the following non-translated genomic sequences: BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORa, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

17. The construct according to any one of claims 1 to 16, wherein the transcription regulator comprises a sequence isolated from or derived from one or more of the untranslated genomic sequences of NFAT, NFkB, REL, RELA, IRF2, GATA3, and ATF3.

18. The construct according to any one of claims 1 to 16, wherein the transcription regulator comprises a sequence of a non-translated genomic sequence derived from NFAT, optionally comprising a sequence of any one or more of the sequences SEQ ID NO: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

19. The construct according to any one of claims 1 to 16, wherein the transcription regulator comprises a sequence of an untranslated genomic sequence derived from NFkB, optionally comprising a sequence of any one or more sequences of SEQ ID NO: 550-553, 1060-1063 and 5696-5699.

20. The construct according to any one of claims 1 to 16, wherein the transcription regulator comprises a sequence derived from a non-translated genomic sequence of RELA, optionally comprising a sequence of any one or more of the sequences SEQ ID NO: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

21. The construct according to any one of claims 1 to 16, wherein the transcription regulator comprises a sequence of a non-translated genomic sequence derived from IRF2, optionally comprising a sequence of any one or more of the sequences in SEQ ID NO: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

22. The construct according to any one of claims 1 to 16, wherein the transcription regulator comprises a sequence of a non-translated genomic sequence derived from GATA3, optionally comprising a sequence of any one or more of the sequences in SEQ ID NO: 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225 and 8712-8855.

23. The construct according to any one of claims 1 to 16, wherein the transcription regulator comprises a sequence of a non-translated genomic sequence derived from ATF3, optionally comprising a sequence of any one or more of the sequences of SEQ ID NO: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214 and 8286-8293.

24. The construct according to any one of claims 1 to 23, wherein (a) the transcription regulator is inducible, or (b) the construct is inducible.

25. The construct according to any one of claims 1 to 24, wherein the transcription initiator comprises a classical promoter.

26. The construct of claim 25, wherein the promoter comprises a minimal promoter.

27. The construct of claim 26, wherein the minimal promoter comprises a sequence isolated from or derived from one or more of minimal promoter-1 ("minP1"), YB-TATA, and human β-globin.

28. The construct of claim 27, wherein the minimal promoter comprises one or more of the following elements: (a)MinP1, which has the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788); (b)MinP2 = has a sequence TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789); and (c)MinP3 = has a sequence CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

29. The construct according to any one of claims 1 to 28, wherein the transcription initiator comprises a transcription factor binding motif.

30. The construct of claim 29, wherein the transcription initiator comprises a motif isolated from or derived from a non-translated genomic sequence of a transcription factor, or comprises a mammalian promoter sequence.

31. The construct of claim 29, wherein the motif comprises a sequence isolated from or derived from one or more of the following untranslated genomic sequences: BACH2, BARX1, BATF, ELF1, ELF2, Elf4, Elk1, ERF, ETV1, Fli1, FOXP1, GABPA, GATA3, IRF1, IRF2, IRF5, IRF7, IRF9, MAF, MAFF, Maz, Mef2d, MLX, MYB, NFAT, NFATC3, NFkB, NR4A1, Nur77, PATZ1, REL, RELA, RORa, RORg, RORgt, STAT2, Tbox, TFEB, TOX, USF1, ZBTB2, ZKSCAN3, ZNF12, ZNF140, ZNF263, ZNF282, ZNF304, ZNF398, ZNF708, and ZNF75D.

32. The construct according to any one of claims 1 to 31, wherein the transcription initiator comprises a sequence isolated from or derived from one or more of the untranslated genomic sequences of NFAT, NFkB, REL, RELA, IRF2, GATA3, and ATF3.

33. The construct according to any one of claims 1 to 31, wherein the transcription initiator comprises a sequence of a non-translated genomic sequence derived from NFAT, optionally comprising a sequence of any one or more of the sequences SEQ ID NO: 3430-3437, 3802-3803, 3940-3947, 4312-4313, 4808-4815, 4874-4889, 4298-4299, 4364-4379, 8576-8583, 8948-8949, 9444-9445, and 9510-9525.

34. The construct according to any one of claims 1 to 31, wherein the transcription initiator comprises a sequence of an untranslated genomic sequence derived from NFkB, optionally comprising a sequence of any one or more sequences of SEQ ID NO: 550-553, 1060-1063 and 5696-5699.

35. The construct according to any one of claims 1 to 31, wherein the transcription initiator comprises a sequence of a non-translated genomic sequence derived from REL, optionally comprising a sequence of any one or more of the sequences SEQ ID NO: 958-959, 3486-3501, 4426-4427, 4472-4473, 4484-4499, 1468-1469, 3996-4011, 4936-4937, 4982-4983, 4994-5009, 5697-5698, 8632-8647, 9572-9573, 9618-9619, and 9630-9645.

36. The construct according to any one of claims 1 to 31, wherein the transcription initiator comprises a sequence of a non-translated genomic sequence derived from RELA, optionally comprising a sequence of any one or more sequences of SEQ ID NO: 4484-4499, 4994-5009 and 9630-9645.

37. The construct according to any one of claims 1 to 31, wherein the transcription initiator comprises a sequence of a non-translated genomic sequence derived from IRF2, optionally comprising a sequence of any one or more of the sequences in SEQ ID NO: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

38. The construct according to any one of claims 1 to 31, wherein the transcription initiator comprises a sequence of a non-translated genomic sequence derived from GATA3, optionally included as SEQ ID NO. NO: any one or more of the sequences 1048-1079, 3566-3709, 1558-1589, 4076-4219, 6194-6225 and 8712-8855.

39. The construct according to any one of claims 1 to 31, wherein the transcription initiator comprises a sequence of a non-translated genomic sequence derived from ATF3, optionally comprising a sequence of any one or more of the sequences of SEQ ID NO: 124-159, 3140-3147, 634-669, 3650-3657, 5179-5214 and 8286-8293.

40. The construct according to any one of claims 1 to 39, wherein the transcription initiator comprises any one or more sequences of SEQ ID NO: 175-9781, or a tandem thereof.

41. The construct according to any one of claims 1 to 40, wherein the construct further comprises an integration sequence capable of inducing or increasing the insertion of the construct into a target site.

42. The construct of claim 41, wherein the carrier comprises the target site.

43. The construct of claim 41, wherein the chromosome contains the target site.

44. The construct according to any one of claims 41 to 43, wherein the integration sequence comprises a first or 5' integration sequence and a second or 3' integration sequence.

45. The construct according to any one of claims 41 to 44, wherein the integrated sequence comprises a homologous sequence corresponding to the insertion site to facilitate homologous recombination.

46. ​​The construct according to any one of claims 41 to 44, wherein the integration sequence comprises a transposable element to facilitate transposable action.

47. The construct of claim 46, wherein the transposable element comprises an insertion sequence and / or a transposable subsequence.

48. The construct according to any one of claims 41 to 44, wherein the integrated sequence comprises a first 5' terminal repeat sequence or a second 3' terminal repeat sequence.

49. The construct of claim 48, wherein the integrated sequence comprises a first 5' terminal repeat sequence and a second 3' terminal repeat sequence.

50. The construct of claim 48 or 49, wherein the first 5' terminal repeat sequence or the second 3' terminal repeat sequence comprises a long terminal repeat (LTR).

51. The construct according to claim 48 or 49, wherein the first 5' terminal repeat sequence or the second 3' terminal repeat sequence comprises an inverted terminal repeat sequence (ITR).

52. The construct according to any one of claims 1 to 51 further comprises a reporting sequence.

53. The construct of claim 52, wherein the reporter sequence comprises a fluorescent protein.

54. The construct of claim 53, wherein the reporter sequence comprises green fluorescent protein (GFP).

55. A carrier comprising the construct according to any one of claims 1 to 54.

56. The vector of claim 55, wherein the vector is a mammalian expression vector capable of expressing the construct in mammalian cells.

57. The vector according to claim 55 or 56, wherein the vector is an expression vector capable of expressing the construct in human cells.

58. The vector of claim 57, wherein the vector is a delivery vector capable of delivering the construct to mammalian cells.

59. The vector according to claim 55 or 58, wherein the vector is a delivery vector capable of delivering the construct to human cells.

60. A library comprising a construct according to any one of claims 11 to 54, or a vector according to any one of claims 55 to 59.

61. The library of claim 60, comprising a plurality of constructs according to any one of claims 1 to 54, or a plurality of vectors according to any one of claims 55 to 59.

62. The library according to claim 60 or 61, comprising a plurality of constructs, each sequence being according to any one of claims 1 to 54.

63. The library according to claim 60 or 61, comprising a plurality of carriers, each of which is according to any one of claims 55 to 59.

64. A type of cell containing (a) The construct according to any one of claims 1 to 54; (b) the carrier according to any one of claims 55 to 59; or (c) The library according to any one of claims 60 to 63.

65. The cell of claim 64, wherein the cell is an immune cell.

66. The cell according to claim 64 or 65, wherein the cell is a stem cell, progenitor cell, precursor cell, or initial cell.

67. The cell according to claim 64 or 65, wherein the cell is a differentiated cell.

68. The cell according to any one of claims 64 to 67, wherein the cell is a T cell, B cell, macrophage or NK cell.

69. The cell according to any one of claims 64 to 67, wherein the cell is a T cell.

70. The cell according to any one of claims 64 to 67, wherein the cell is an NK cell.

71. The cell according to any one of claims 64 to 67, wherein the cell is in vitro or ex vivo.

72. The cell according to any one of claims 64 to 67, wherein the cell is a primary cell.

73. The cell according to any one of claims 64 to 67, wherein the cell is a cultured cell.

74. Use of the construct according to any one of claims 1 to 54, the vector according to any one of claims 55 to 59, the library according to any one of claims 60 to 63, or the cell according to any one of claims 64 to 73, for selecting sequences responsive to one or more of the following factors: antigen receptor activation, cell stimulation, cell exhaustion, cell quiescence, and epigenetic regulation.

75. The use according to claim 74, wherein the cell stimulation is an early stimulation.

76. The use according to claim 74, wherein the cell stimulation is a late stimulation.

77. The use according to claim 74, wherein the antigen receptor is a chimeric antigen receptor.

78. The use according to claim 74, wherein the cell is a T cell, and wherein the antigen receptor is an endogenous or exogenous T cell receptor (TCR).

79. Use of the construct according to any one of claims 1 to 54, the vector according to any one of claims 55 to 59, the library according to any one of claims 60 to 63, or the cell according to any one of claims 64 to 73, for use in response to one or more of the following factors regulating the transcription of exogenous proteins: antigen receptor activation, cell stimulation, cell exhaustion, cell quiescence, and epigenetic regulation.

80. The use according to claim 79, wherein the exogenous protein is one or more of the following: engineered receptors, cytokines, or degrading agents.

81. An inducible nucleic acid construct comprising a transcription regulator enhancer sequence and a transcription initiation promoter sequence (EP pairing), wherein the construct is not naturally occurring.

82. The construct of claim 81, wherein the EP pair comprises an EP pair sequence which is any one or more sequences of SEQ ID NO: 1-174, or a sequence which has 90% sequence identity with it.

83. The construct of claim 81, wherein the EP pair comprises an enhancer sequence having at least 70% sequence identity with any one or more sequences of enhancer sequences SEQ ID NO: 1-174.

84. The construct of claim 81, wherein the EP pair comprises a promoter sequence having at least 70% sequence identity with any one or more sequences of promoter sequences SEQ ID NO: 1-174.

85. The construct of claim 81, wherein the enhancer sequence is located at the 5' end of the promoter sequence.

86. The construct of claim 81, wherein the enhancer sequence is located at the 3' end of the promoter sequence.

87. The construct of claim 81, wherein the EP pair comprises about 100 base pairs to about 1500 base pairs.

88. The construct of claim 81, wherein the EP pair comprises about 500 base pairs to about 1250 base pairs.

89. The construct of claim 81, wherein the EP pair comprises about 900 base pairs to about 1100 base pairs.

90. The construct according to any one of claims 81 to 89, wherein the construct further comprises a barcode sequence.

91. The construct of claim 90, wherein the barcode sequence is located at the 5' end of the EP pair.

92. The construct of claim 90, wherein the barcode sequence is located at the 3' end of the EP pair.

93. The construct according to any one of claims 81 to 92, wherein the construct further comprises a 5' untranslated region (UTR) located at the 3' end of the EP pair.

94. The construct according to any one of claims 81 to 92, wherein the construct further comprises a 5' untranslated region (UTR) located at the 3' end of the barcode sequence.

95. The construct according to any one of claims 81 to 94, wherein the construct further comprises an integration sequence capable of inducing or increasing the insertion of the construct into a target site.

96. The construct according to claim 95, wherein the target site is a target site in the vector.

97. The construct of claim 95, wherein the target site is a target site in a chromosome.

98. The construct according to any one of claims 95 to 97, wherein the integration sequence comprises a first or 5' integration sequence and a second or 3' integration sequence.

99. The construct according to any one of claims 95 to 98, wherein the integrated sequence comprises a homologous sequence corresponding to the insertion site to facilitate homologous recombination.

100. The construct according to any one of claims 95 to 98, wherein the integration sequence comprises a transposable element to facilitate transposable action.

101. The construct of claim 100, wherein the transposable element comprises an insertion sequence and / or a transposable subsequence.

102. The construct according to any one of claims 95 to 98, wherein the integrated sequence comprises a first 5' terminal repeat sequence or a second 3' terminal repeat sequence.

103. The construct according to claim 101 or 102, wherein the first 5' terminal repeat sequence or the second 3' terminal repeat sequence comprises a long terminal repeat (LTR).

104. The construct according to claim 101 or 102, wherein the first 5' terminal repeat sequence or the second 3' terminal repeat sequence comprises an inverted terminal repeat sequence (ITR).

105. The construct according to any one of claims 81 to 104, further comprising a reporting sequence.

106. The construct of claim 105, wherein the reporter sequence comprises a fluorescent protein.

107. The construct of claim 106, wherein the reporter sequence comprises green fluorescent protein (GFP).

108. The construct according to any one of claims 81 to 107, wherein the enhancer sequence is isolated from or derived from sequences of one or more of human chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23.

109. The construct according to any one of claims 81 to 108, wherein the enhancer sequence is a minimal sequence exhibiting enhancer function or activity.

110. The construct according to claim 108 or 109, wherein the enhancer sequence comprises at least about 50 base pairs (bp), at least about 100 bp, at least about 150 bp, at least about 200 bp, at least about 250 bp, at least about 300 bp, at least about 350 bp, at least about 400 bp, at least about 450 bp, at least about 500 bp, or any number of base pairs between the above values.

111. The construct according to any one of claims 81 to 110, wherein the promoter sequence is isolated from or derived from one or more sequences of human chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23.

112. The construct according to any one of claims 81 to 111, wherein the promoter sequence is a minimal sequence exhibiting promoter function or activity.

113. The construct according to claim 111 or 112, wherein the promoter sequence comprises at least about 50 base pairs (bp), at least about 100 bp, at least about 150 bp, at least about 200 bp, at least about 250 bp, at least about 300 bp, at least about 350 bp, at least about 400 bp, at least about 450 bp, at least about 500 bp, or any number of base pairs between the above values.

114. A carrier comprising the construct according to any one of claims 81 to 113.

115. The vector of claim 114, wherein the transcriptional regulatory enhancer sequence and / or the transcription initiation promoter sequence are operatively linked to a nucleic acid sequence encoding any one or more of the following elements: chimeric antigen receptor (CAR), exogenous T cell receptor (TCR), cytokine, or degrader.

116. The vector according to any one of claims 114 to 115, wherein the vector is a mammalian expression vector capable of expressing the construct in mammalian cells.

117. The vector according to any one of claims 114 to 116, wherein the vector is an expression vector capable of expressing the construct in human cells.

118. The vector according to any one of claims 114 to 115, wherein the vector is a delivery vector capable of delivering the construct to mammalian cells.

119. The vector according to any one of claims 114 to 115, wherein the vector is a delivery vector capable of delivering the construct to human cells.

120. A library comprising a construct according to any one of claims 81 to 113, or a vector according to any one of claims 55 to 59.

121. The library of claim 120, comprising a plurality of constructs according to any one of claims 81 to 113, or a plurality of vectors according to any one of claims 114 to 119.

122. The library of claim 120 or 121, comprising a plurality of constructs, each sequence being as described in any one of claims 81 to 113.

123. The library of claim 122, wherein each construct contains a unique barcode sequence.

124. The library according to claim 120 or 121, comprising a plurality of carriers, each of which is according to any one of claims 114 to 119.

125. A type of cell containing The construct according to any one of claims 81 to 113; The carrier according to any one of claims 114 to 119; or The library according to any one of claims 120 to 124.

126. The cell of claim 125, wherein the cell is an immune cell.

127. The cell of claim 125, wherein the cell is a stem cell, progenitor cell, precursor cell, or initial cell.

128. The cell of claim 125, wherein the cell is a differentiated cell.

129. The cell according to any one of claims 125 to 128, wherein the cell is a T cell, B cell, macrophage or NK cell.

130. The cell according to any one of claims 125 to 128, wherein the cell is a T cell.

131. The cell according to any one of claims 125 to 128, wherein the cell is an NK cell.

132. The cell according to any one of claims 125 to 128, wherein the cell is in vitro or ex vivo.

133. The cell according to any one of claims 125 to 128, wherein the cell is a primary cell.

134. The cell according to any one of claims 125 to 128, wherein the cell is a cultured cell.

135. Use of the construct according to any one of claims 81 to 113, the vector according to any one of claims 114 to 119, the library according to any one of claims 120 to 124, or the cell according to any one of claims 125 to 134, for selecting EP pairings in response to one or more of the following factors: antigen receptor activation, cell stimulation, cell exhaustion, cell quiescence, epigenetic regulation.

136. The use according to claim 135, wherein the cell stimulation is an early stimulation.

137. The use according to claim 135, wherein the cell stimulation is a late stimulation.

138. The use according to claim 135, wherein the antigen receptor is a chimeric antigen receptor (CAR).

139. The use according to claim 135, wherein the cell is a T cell, and wherein the antigen receptor is an endogenous or exogenous T cell receptor (TCR).

140. An inducible construct comprising a nucleic acid / nucleotide / polynucleotide sequence encoding a circuit component, wherein the circuit component includes (a) A response component, wherein the response component is capable of altering the activity of the effector component in response to: (i) Signals from receptors, (ii) Epigenetic alterations (iii) Transcription induction or transcriptional repression, or (iv) Changes in cell state, and (b) an effector component, wherein the activity of the response component is capable of inducing a change in the activity of the effector component; and The constructs mentioned therein are not naturally occurring.

141. The construct of claim 140, wherein the response component comprises one or more of the following elements: a sequence of a transcription factor (TF) untranslated region, a sequence containing a TF binding site, a promoter, an enhancer, and a repressor.

142. The construct of claim 140, wherein the response component comprises an epigenetic modifier.

143. The construct of claim 140, wherein the response component comprises a transcription initiator (e.g., a promoter) or a transcription initiator (e.g., a promoter) and a transcription regulator (e.g., an enhancer).

144. The construct of claim 143, wherein the promoter comprises a minimal promoter.

145. The construct of claim 144, wherein the minimal promoter comprises one or more of the following elements (a) MinP 1 = has the sequence AGAGGGTATATAAAAGCTCGACTTCCAG (SEQ ID NO: 9788); (b)MinP2 = has a sequence TAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9789); (c)MinP3 = has a sequence CTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 9790).

146. The construct according to claim 143 or 144, wherein the promoter comprises an inducible promoter.

147. The construct of claim 143, wherein the transcription initiator comprises a tandemly coupled sequence.

148. The construct of claim 147, wherein the tandem sequence comprises a sequence of any one or more sequences of SEQ ID NO: 176-9781, or a sequence having at least about 70% sequence identity with it.

149. The construct of claim 147, wherein the transcription initiator comprises a sequence of a non-translated genomic sequence derived from IRF2, optionally comprising a sequence of any one or more of the sequences in SEQ ID NO: 2384-2447, 4430-4461, 2894-2957, 4940-4971, 7530-7593, and 9576-9607.

150. The construct of claim 143, wherein the response component comprises a pair of enhancers and promoters (EP pairs).

151. The construct of claim 150, wherein the EP pair comprises a sequence of any one or more sequences of SEQ ID NO: 1-175, or a sequence having at least about 90% sequence identity with it.

152. The construct of claim 150, wherein the EP pair comprises an enhancer sequence of any one or more enhancer sequences of SEQ ID NO: 1-174, or a sequence having at least about 70% sequence identity with it; and / or wherein the EP pair comprises a promoter sequence of any one or more promoter sequences of SEQ ID NO: 1-174, or a sequence having at least about 70% sequence identity with it.

153. The construct according to any one of claims 140 to 152, wherein the effector component comprises a degrading agent.

154. The construct according to any one of claims 140 to 152, wherein the signal from the receptor includes a signal from a chimeric antigen receptor (CAR).

155. The construct according to any one of claims 140 to 154, wherein the cell state includes one or more of the following states: (a) No stimulation; (b) Stimulus initiation; (c) Stimulus shutdown; (d) exhaustion; and (e) Rest.

156. A cell comprising a construct according to any one of claims 140 to 155.

157. The cell of claim 156, wherein the cell is an immune cell.

158. The cell according to claim 156 or 157, wherein the cell is a stem cell, progenitor cell, precursor cell, or initial cell.

159. The cell according to claim 156 or 157, wherein the cell is a differentiated cell.

160. The cell according to any one of claims 156 to 159, wherein the cell is a T cell, B cell, macrophage or NK cell.

161. The cell according to any one of claims 156 to 160, wherein the cell is a T cell.

162. The cell according to any one of claims 156 to 160, wherein the cell is an NK cell.

163. The cell according to any one of claims 156 to 160, wherein the cell is in vitro or ex vivo.

164. The cell according to any one of claims 156 to 160, wherein the cell is a primary cell.

165. The cell according to any one of claims 156 to 160, wherein the cell is a cultured cell.

166. Use of any of the constructs, circuits, vectors or cells according to claims 140 to 165 for inducibly regulating the expression of effector components in response to cellular states.

Images