Application of vitamin K1 as immune resistance inducer in crop disease control

Abstract

The invention provides application of vitamin K1 as an immune resistance inducer in crop disease control, belongs to the technical field of agriculture, and finds that the vitamin K1 can improve the disease resistance of crops (rice, wheat and potatoes) to bacteria, fungi, oomycetes and the like. The vitamin K1 is used for treating rice, wheat and potatoes by spraying a vitamin K1 solution with a certain concentration, the disease resistance of the crops to bacteria, fungi, oomycetes and the like can be improved, and the research proves that the vitamin K1 can be used for improving the disease-resistant quality of the crops in the agricultural field.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of agricultural technology, and particularly relates to application of vitamin K1 as an immune elicitor in crop disease prevention and treatment. BACKGROUND

[0005] In terms of drug resistance, long-term use of chemical pesticides is easy to make pathogenic microorganisms or pests resistant / drug resistant. The action mechanism of biological pesticides is complex, and can effectively delay the development of resistance / drug resistance. At present, biological pesticides have the disadvantages of slow effect, high cost, and difficult research and development, but have the advantages of significant environmental compatibility and sustainability, and meet the green development demand of modern agriculture. In the future, with the progress of biotechnology, the stability and control effect of biological pesticides will be further improved, and biological pesticides will become an important substitute for chemical pesticides.

[0006] The prior art provides the action of vitamin K3 as a plant growth regulator. Research shows that vitamin K3 has a relatively obvious promoting effect on growth and development and yield increase of vegetables in seedling and field cultivation, and the yield increase effect of 1% vitamin K3 powder is better. The prior art also discloses the application of vitamin K3 in preparing a plant pathogen inhibitor, which can inhibit the growth of various plant pathogenic bacteria such as tobacco bacterial wilt bacteria, citrus canker bacteria, bacterial leaf spot of rice, cucumber rhizoctonia, alternaria alternata, fusarium solani, fusarium oxysporum, fusarium graminearum, cucumis sativus botryosphaeria, verticillium dahliae, gloeoporus anthracis, multi-host conidiobolus, and mango pseudodiscus, and can be used for the development of biological pesticides.

[0007] At present, for the synthesis of vitamin K1 (phylloquinone) in plant chloroplasts, the synthesis starting point of the main naphthoquinone ring is shikimic acid, shikimic acid is converted into pyrogallol by shikimic acid isomerase (ICS), and then 1,4-naphthoquinone ring is formed by oxidation; the research is currently mainly in clinical application, and no related research on whether it has an effect on crops is found. SUMMARY

[0008] In order to make up for the deficiency of the prior art, the present application provides the application of vitamin K1 as an immune elicitor in crop disease prevention and treatment.

[0009] As a first aspect of the present application, it is to provide the application of vitamin K1 as an immune elicitor in crop disease prevention and treatment.

[0010] The crops include rice, wheat, and potato.

[0011] The pathogenic bacteria causing the diseases include bacteria, fungi, and oomycetes.

[0012] The application provides an application of vitamin K1 in improving the disease resistance of crops (rice, wheat, potato) to bacteria, fungi, oomycetes and the like.

[0013] The application research finds that the effect of vitamin K1 in improving the disease resistance of crops is different for different crops. Based on the above research, the application provides the following specific applications. In some embodiments of the application, vitamin K1 is provided for improving the resistance of rice to bacterial diseases.

[0014] In some embodiments of the application, vitamin K1 is provided for improving the resistance of rice to fungal diseases.

[0015] In some embodiments of the application, vitamin K1 is provided for improving the resistance of wheat to fungal diseases.

[0016] In some embodiments of the application, vitamin K1 is provided for improving the resistance of potato to oomycete diseases.

[0017] PR2 protein is an important member of the plant pathogenesis-related protein (PR protein) family, has β-1, 3-glucanase activity, and can degrade the main component β-1, 3-glucan of the cell wall of pathogenic fungi, thereby inhibiting the growth and expansion of pathogenic bacteria. PR2 is a multifunctional and key link in the potato disease resistance network. It is not only a direct antibacterial protein, but also an amplifier of immune signals and a marker of systemic resistance. Current research reveals that various strategies such as biological inducers (such as Pseudomonas), chemical inducers (such as potassium phosphite) or genetic improvement (such as overexpression of key positive regulatory genes or lncRNA) can effectively up-regulate the expression of PR2, thereby enhancing the resistance of potato to various diseases (especially fungal and oomycete diseases). WRKY40 in potato belongs to the WRKY family members, which plays a positive regulatory role in the process of potato resistance to late blight: overexpression of WRKY40 can enhance the resistance of potato to late blight, while silencing WRKY40 gene makes potato more sensitive to late blight (increased susceptibility) (invention patent application, application number: 202311534327.2). Research in tobacco shows that the homologous NbWRKY40 can positively regulate the resistance to tobacco mosaic virus (ToMV) through the salicylic acid (SA) signaling pathway, and affect PR1b and PR2isogenic expression (Jiang et al., 2021, Frontiers in Plant Science, DOI: 10.3389 / fpls.2020.603518). In the embodiments of the present application, experiments have proved that vitamin K1 treatment can improve the expression of disease resistance related genes PR2 and WRKY40 in potatoes.

[0018] In the above applications, vitamin K1 acts on the leaf surface of crops by spraying.

[0019] As a second aspect of the present application, a crop disease control method is provided, which treats plants by spraying, the plants being rice, wheat or potato plants. Further, the concentration of vitamin K1 in a 0.02% Tween 20 aqueous solution is 0.1-1 mmol / L.

[0020] Compared with the prior art, the present application has the following advantages: 1. The present application provides the application of vitamin K1 in crop (rice, wheat, potato) planting, which improves the disease resistance of crops to bacteria, fungi and oomycetes by spraying on the leaf surface of crops (rice, wheat, potato).

[0021] 2. Through experimental comparison, it is found that the disease resistance effect of vitamin K1 in crops (rice, wheat, potato) is better than that of vitamin K3 in crops in the prior art.

[0022] 3. At the same time, vitamin K1 not only improves the disease resistance of crops to bacterial and fungal diseases, but also improves the disease resistance of plants to oomycete diseases, especially the disease resistance to potato late blight caused by the pathogenic Phytophthora EC1. BRIEF DESCRIPTION OF DRAWINGS

[0023] The drawings accompanying the specification of the present application form a part thereof and serve to provide further understanding of the present application, the illustrative embodiments of the present application and its description serve to explain the present application and do not constitute an improper limitation of the present application.

[0024] Figure 1 Spraying vitamin K1 solution improves the disease resistance of rice to bacterial diseases. Among them, A is the proportion of white leaf blight lesion length to the total length of the leaf on the rice (Zhonghua 11) inoculated for 14 days under different treatments, and B is the number of bacteria of Xanthomonas oryzae PXO99 on the rice (Zhonghua 11) inoculated for 14 days under different treatments.

[0025] Figure 2: Spraying vitamin K1 solution improves the disease resistance of rice to fungal diseases. A is the disease incidence of sheath blight on rice (Zhonghua 11) under different treatments, B is the lesion length statistics of sheath blight on rice (Zhonghua 11) under different treatments, and C is the mycelial biomass statistics of Rhizoctonia solani YWK196 on rice (Zhonghua 11) under different treatments.

[0026] Figure 3 : Spraying vitamin K1 solution improves the disease resistance of wheat to fungal diseases. A is the disease incidence of scab on wheat (Jimai 22) under different treatments, and B is the disease index statistics of scab on wheat (Jimai 22) under different treatments.

[0027] Figure 4 : Spraying vitamin K1 solution improves the disease resistance of potato to oomycete diseases. A is the disease incidence of late blight on potato (Desiree) under different treatments, and B is the disease index statistics of late blight on potato (Desiree) under different treatments.

[0028] Figure 5 : Adding vitamin K1 to the medium does not inhibit the growth of oomycetes. A is the growth of Phytophthora infestans EC1 on Rye B medium under different treatments, and B is the colony diameter statistics of Phytophthora infestans EC1 on Rye B medium under different treatments.

[0029] Figure 6 : Spraying vitamin K1 solution improves the disease resistance of potato to oomycete diseases. PR2, WRKY40 The gene is expressed at different times (1, 3, 8, 12, 24 h) after treatment.

[0030] Figure 7 : Spraying vitamin K1 solution improves the superoxide level in potato. A is the leaf of the control (water) treatment, and B is the leaf treated with vitamin K1. DETAILED DESCRIPTION

[0031] It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used in the present application have the same meaning as generally understood by those skilled in the art to which the present application belongs.

[0032] The present application will be specifically described below in conjunction with the drawings and specific examples.

[0033] The present application uses the addition of vitamin K1 solution to the medium or uses the spraying treatment of wheat, rice, potato and other crops with vitamin K1 solution to explore its effect on the resistance of crops to bacterial, fungal, oomycete and other diseases.

[0034] Example 1: Vitamin K1 solution spray treatment improves the disease resistance of rice to bacterial diseases.

[0035] (1) Test site overview and test materials The test site is located at the Hybrid Rice National Key Laboratory of Wuhan University in Wuhan, Hubei Province.

[0036] Pathogenic microorganisms: Bacteria: Xanthomonas oryzae PXO99; Rice variety: Zhonghua 11; Culture medium: PSA medium purchased from Shenguo Biotech Co., Ltd. Vitamin K1, vitamin K3, Tween 20, purchased from Shanghai Aladdin Biochem Technology Co., Ltd.

[0037] (2) Strain activation: Sterile toothpicks were used to dip -80℃ stored Xanthomonas oryzae PXO99 bacterial solution on PSA plates and cultured at 28℃ for 2-3 days. Single colonies were picked and cultured in PSB liquid medium at 28℃ with 200 rpm shaking for 2-3 days. The bacterial cells were collected by centrifugation at 7000 rpm, and the OD600 was adjusted to 0.2 (1×10 8

[0038] (3) Rice treatment: Two-month-old rice plants were selected for the experiment. Vitamin K1 at a concentration of 0.5mM was sprayed on a water solution with a final concentration of 0.02% Tween 20, denoted as VK1 treatment. Vitamin K3 at a concentration of 0.5mM was sprayed on a water solution with a final concentration of 0.02% Tween 20, denoted as VK3 treatment. A water solution with a final concentration of 0.02% Tween 20 was sprayed as a control (CK).

[0039] (4) Inoculation and disease statistics: 0.02% Tween 20 water solution was added to the bacterial suspension, and the bacterial suspension was used to cut the rice leaves with scissors. After 14 days, the length of the disease spots and the number of bacteria were counted.

[0040] The results are shown in Figure 1 A and B, the length of the white leaf blight spots on the rice leaves treated with the control (water) was 4.90±0.08 cm, the length of the white leaf blight spots on the rice leaves treated with vitamin K3 was 4.64±0.07 cm, and the length of the white leaf blight spots on the rice leaves treated with vitamin K1 was significantly reduced to 4.22±0.08. The number of bacteria in the leaves was detected, and it was found that the LOG value of the number of bacteria in the leaves treated with vitamin K1 was 8.05±0.13, which was significantly lower than the LOG value of the number of bacteria in the leaves treated with the control (9.0±0.1) and the number of bacteria in the leaves treated with vitamin K3 (8.55±0.12). The above results show that vitamin K1 treatment is better than vitamin K3 treatment in improving the resistance of rice to bacterial diseases. ​

[0041] Example 2: Vitamin K1 solution spray treatment improves disease resistance of rice to fungal diseases.

[0042] (1) Test site overview and test materials Test site: The test site is located at the Hybrid Rice National Key Laboratory of Wuhan University in Wuhan, Hubei Province.

[0043] Reagents: Vitamin K1 and Tween 20 were purchased from Shanghai Aladdin Biochem Technology Co., Ltd., and PDA medium was purchased from Alershan (Guangzhou) Biotechnology Co., Ltd.

[0044] Fungus: Rhizoctonia solani YWK196.

[0045] Rice variety: Zhonghua 11.

[0046] (2) Rice treatment: Select 2-month-old rice plants for the experiment, and spray a 0.5 mM concentration of vitamin K1 solution with a sprayer, marked as VK1 treatment. Spray 0.02% Tween 20 with water as control (CK).

[0047] (3) Strain activation and inoculation: Rhizoctonia solani YWK196 colonies were picked from the preserved plate and cultured on PDA medium at 28°C for 3-5 days until the colony diameter reached 5-7 cm. The colony edge cake was taken with a sterile punch, and the cake was inoculated on rice leaves treated with vitamin K1 or control water.

[0048] Two layers of soaked water-absorbing paper were placed at the bottom of the inoculation plate, and the back of the rice leaves treated with sterile water (CK) or vitamin K1 (VK1) for 4 hours was placed neatly on the paper, and the cake was inoculated in the center of the leaves. Incubate in a 28°C light incubator, spray to keep moist during the period, and observe the disease condition of the leaves after 3-5 days. Measure the length of the lesion with a ruler.

[0049] (4) Relative mycelial biomass detection: The diseased leaves were taken and DNA was extracted by CTAB method, and the DNA was dissolved with appropriate sterile water. The rice OsACTIN gene (F: TGTATGCCAGTGGTCGTACCA (SEQ ID NO: 1); R: CCAGCAAGGTCGAGACGAA (SEQ ID NO: 2)) was used as an internal reference for DNA sample normalization. Rhizoctonia solani 18S rDNA (F: CCAGCAAGGTCGAGACGAA (SEQ ID NO: 3); R: CTTGGATGTGGTAGCCGTTT (SEQ ID NO: 4)) was used to determine the mycelial biomass of YWK196. 2 -ΔΔCTThe method is used for relative quantitative analysis of the target gene DNA level.

[0050] Quantitative RT-PCR was performed on the Archimed medical real-time PCR system (Kunpeng Gene, Beijing) using the Universal SYBR Green Fast qPCR MiX (ABclonal, China) quantitative PCR kit. In a 20 μL reaction mixture, 10 μL of Universal SYBR Green Fast qPCR Mix (2×), 5 μL of DNA, 0.4 μL of forward primer, and 0.4 μL of reverse primer were added. Reaction parameters were set as follows: 95℃ / 30 s; 95℃, 5 s, 60℃, 30 s, 40 cycles.

[0051] The results are as follows Figure 2 As shown, the control (CK) treatment resulted in water-soaked lesions and leaf yellowing caused by YWK196 on rice leaves, while the vitamin K1 treatment significantly reduced the length of water-soaked lesions and the degree of yellowing. Figure 2 (A); Measurements of the length of water-soaked lesions revealed that the lesion length on leaves treated with vitamin K1 was 4.1 ± 1.3 cm, while the lesion length on leaves treated with vitamin K1 was 3.9 ± 0.9 cm. Figure 2 (B); Further analysis of relative mycelial biomass revealed that the mycelial biomass in the control-treated leaves was 1, while the mycelial biomass of YWK196 in the vitamin K1-treated leaves decreased to 0.6 ( ). Figure 2 (C). The above results indicate that vitamin K1 treatment can improve the resistance of rice to fungal diseases.

[0052] Example 3: Spraying with vitamin K1 solution improves wheat's resistance to fungal diseases.

[0053] (1) Overview of the test site and test materials Experimental location: Farmland in Sicun Village, Tianbao Town, Daiyue District, Tai'an City, Shandong Province.

[0054] Reagents: Vitamin K1 and Tween 20 were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., and sodium carboxymethyl cellulose was purchased from Alexan (Guangzhou) Biotechnology Co., Ltd.

[0055] Fungus: Fusarium graminearum PH-1.

[0056] Common wheat variety: Jimai 22.

[0057] (2) Activation of fungal strains and induction of conidia: Fungal spores were collected from the surface of PDA plates and incubated at 28°C for 3-5 days until the colony diameter reached 3-5 cm. The mycelium was collected from the edge of the colony using a sterile punch. Two to three pieces of mycelium were inoculated into 50 mL CMC medium in a 250 mL flask and incubated at 28°C with shaking at 150 rpm for 10-15 days. The culture solution was filtered through four layers of sterile gauze to remove the mycelium. The spore concentration was adjusted to 1 x 105 5 - 5 x 105 5 spores / mL using a hemocytometer.

[0058] (3) Vitamin Kl-treated wheat: The vitamin Kl stock solution was dissolved in deionized water using Tween 20 as a solubilizer, and the concentration was adjusted to 0.5 mM. The wheat at the early flowering stage (1-3 days after flowering) was sprayed with a spray bottle, 10 mL of the vitamin Kl solution per plant (VKl). Ten plants were sprayed in each treatment, and the control (CK) was sprayed with 0.02% Tween 20 in water. The plants were inoculated with F. graminearum PH-1 4 hours after treatment.

[0059] (4) Inoculation of wheat with F. graminearum PH-1 and evaluation of resistance to scab: The middle florets (5th-6th from the base) of the main spike of the wheat treated with vitamin Kl or the control (water) were selected, and 20 μL of the spore suspension was taken using a pipette. The spores were vertically dripped onto the column head of the floret and between the lemma and the palea. Ten florets were inoculated for each material, and a transparent plastic bag was used to keep the material moist. The bag was removed after 3 days, and the material was kept moist by spraying water. The number of diseased florets was investigated 21 days after inoculation, and the disease rate was calculated as (number of diseased florets / total number of florets) x 100%. The resistance was evaluated according to the "Technical Specification for Wheat Disease Resistance Evaluation" (NY / T 1443.4-2007).

[0060] The results are shown in Figure 3 Fig. 2. The F. graminearum PH-1 on the control (CK) wheat spike caused the entire spike to die, while the F. graminearum PH-1 on the vitamin Kl-treated wheat spike only caused the inoculated florets to die (Fig. 2A), indicating that vitamin Kl treatment can prevent the spread of F. graminearum PH-1 on the wheat spike. Figure 3 Figure 3 The disease index of the wheat scab was found to be 83% ± 5% on the control wheat spike and 39% ± 5% on the vitamin Kl-treated wheat spike (Fig. 2B). These results indicate that vitamin Kl treatment can improve the resistance of wheat to fungal diseases.

[0061] Example 4: Vitamin Kl solution spraying treatment improves the disease resistance of potato to oomycete diseases.

[0062] (1) Overview of the test site and test materials​ The test site is located at No. 61, Daizong Street, Taishan District, Taishan City, Shandong Agricultural University, Daizong Campus, Shengzhi Building.

[0063] Reagents: Vitamin K1, Tween 20 purchased from Shanghai Aladdin Biochem Technology Co., Ltd. Pathogenic microorganisms: Oomycete: Phytophthora infestans EC1 Potato variety: Desiree Culture medium: Rye B medium prepared in the laboratory.

[0064] Vitamin K1, Tween 20 purchased from Shanghai Aladdin Biochem Technology Co., Ltd. (2) Strain activation and conidial induction: Take the EC1 strain from the preserved plate and inoculate it on Rye B medium. After 14 days of dark culture, observe whether sporangia are produced under a microscope. Add 3 mL of sterile water to the culture dish with qualified P. infestans, scrape the mycelium with a glass spreader, collect the sporangia, and place them on ice for 2 h to facilitate the release of conidia. Count the conidia using a hemocytometer and adjust the concentration of the conidia to 5000 / mL with sterile water.

[0065] (3) Potato treatment: Select 2-month-old potato plants for the experiment. Spray the plants with a 0.1 mM solution of vitamin K1, which is denoted as VK1 treatment. Spray the control plants (CK) with 0.02% Tween 20 in water.

[0066] (4) Potato late blight inoculation: Place two layers of soaked water-absorbing paper at the bottom of the inoculation tray. Place the potato leaves treated with sterile water (CK) or vitamin K1 (VK1) for 4 hours on the paper with the back facing up. Symmetrically inoculate two drops of 20 uL of spore suspension on both sides of the leaves. Place the tray in a 21°C light incubator and maintain humidity by spraying. Observe the leaves for disease symptoms after 3-5 days.

[0067] (5) Disease index statistics: First, calculate the percentage X of the total leaf area occupied by water-stained lesions on each potato leaf. According to the disease classification standard, healthy leaves without water-stained lesions are classified as 0, 1% < X < 25% as 1, 26% < X < 50% as 2, 51% < X < 75% as 3, and 76% < X < 100% as 4. The disease index is calculated as follows: .

[0068] In the formula, xi is the disease grade, yi is the number of leaves at each disease grade, and x max is the 4th disease grade.

[0069] Results are shown in Figure 4 Figure 1. The potato leaves treated with CK showed typical yellowing and water-soaked lesions of late blight, while the potato leaves treated with vitamin Kl remained dark green and had lower water-soaked lesion area (A). The disease index of the potato leaves treated with CK was 71 ± 8%, while the disease index of the potato leaves treated with vitamin Kl was 71 ± 8% (B). Figure 4 The results show that vitamin Kl treatment can improve the resistance of potato to oomycete diseases. Figure 4 The results show that vitamin Kl treatment can improve the resistance of potato to oomycete diseases. Example 5: Vitamin Kl does not inhibit the growth of P. infestans EC1 on Rye B medium.

[0070] (1) Test site overview and test materials The test site is located at No. 61, Daizong Street, Taishan District, Taishan University, Shandong Agricultural University, Shengzhi Building.

[0071] Reagents: Vitamin Kl, Tween 20, purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Pathogenic microorganisms: Oomycetes: P. infestans EC1 Culture medium: Rye B medium was prepared in the laboratory.

[0072] Vitamin Kl, Tween 20, purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. (2) Oomycete growth experiment: The oomycete growth experiment has 6 treatments, Treatment 1: Control group (CK), Rye B medium with a final concentration of 0.02% Tween 20; Treatment 2 to Treatment 6: Vitamin Kl treatment group (VK1), with concentrations of 15, 30, 60, 90, and 120 μM, respectively.

[0073] (3) Preparation of Rye B medium: First, weigh about 60 g of rye and add 300 mL of sterile water, avoid light, incubate overnight until the white appears, the next day transfer the soaking solution to the container for standby, use a crusher to crush the rye, 65°C water bath for 1 h, filter the rye residue, mix the filtrate and soaking solution, add 20 g of sucrose, make up to 1000 mL, add 15 g / L agar powder, 121°C high pressure steam sterilization for 15 min.

[0074] (4) Activation and culture of P. infestans EC1: Take P. infestans EC1 from the 4°C glycerol preservation tube, culture on Rye B plate, 28°C, avoid light, inverted culture for 5-7 days (depending on the growth rate of the strain).

[0075] Plate preparation: Add Tween 20 or vitamin K1 solution to 100 mL sterilized Rye B medium to make the concentration of vitamin K1 1.5, 7.5, 15, 30, 60, 90, 120 μM respectively, mix well and pour into sterile petri dishes, and cool and solidify.

[0076] Culture: Use a puncher to punch the edge of the activated colony, use a sterile toothpick to pick up the bacterial mass and inoculate it on the above-mentioned control or vitamin K1-containing Rye B medium, and move it to a 28°C incubator for culture in the dark and inverted, take pictures after 9 days, and measure the diameters of 3 repeated colonies with a ruler, calculate the average value, and record it as the colony diameter.

[0077] The results are shown in Table A and B as follows: Figure 5 The diameters of the colonies of the pathogenic P. infestans EC1 grown on plates with control (water) or different concentrations of vitamin K1 for 9 days were all 8.5 ± 0 cm, indicating that vitamin K1 did not inhibit the growth of P. infestans EC1 on Rye B medium.

[0078] Example 6: Vitamin K1 solution spraying treatment improves the expression of genes in potatoes PR2, WRKY40 .

[0079] (1) Test site overview and test material The test site is located in Wuhan University, Wuhan City, Hubei Province Reagents: Vitamin K1 and Tween 20 were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. RNA extraction kit was purchased from OMEGA company, reverse transcription kit and fluorescent quantitative kit were purchased from ABclonal company.

[0080] Potato variety: Desiree (2) Vitamin K1 spraying treatment of potatoes: Select 2-month-old potato plants for the experiment, use a sprayer to spray a 0.1 mM vitamin K1 solution on the potatoes, record the treatment time, and mark the plants treated within 5 minutes as 0h, and take samples at 1, 3, 8, 12, and 24h after treatment, respectively, and mark them as 1, 3, 8, 12, and 24h.

[0081] Total RNA was extracted from 100 mg of potato material ground to powder in liquid nitrogen using the RNA extraction kit E.Z.N.A Plant RNA Kit (OMEGA BIO-TEK) according to the manufacturer's instructions. Finally, 50 μL of RNase-free deionized water was added to dissolve the RNA. Reverse transcription was performed using the ABScript Neo RT Master Kit (ABclonal, China) according to the manufacturer's instructions in a 20 μL reaction system containing 1 μL of gDNA Remover Mix (20 X), 5 μL of ABScript Neo RT Master Mix (4 X), 37 °C for 2 min, 55 °C for 15 min, 85 °C for 5 min to terminate the reaction, and the reverse transcription product was diluted to 200 μL with ddH2O.

[0082] Quantitative RT-PCR was performed on the Archimed medical fluorescence quantitative PCR system (Kanpeng Gene, Beijing) using the Universal SYBR Green Fast qPCR MiX (ABclonal, China) quantitative PCR kit. In a 20 μL reaction system, 10 μL of Universal SYBR Green Fast qPCR Mix (2 X), 5 μL of reverse transcription product, 0.4 μL of forward primer, and 0.4 μL of reverse primer were added. The reaction parameters were set as follows: 95 °C / 30 s; 95 °C, 5 s, 60 °C, 30 s, 40 cycles. Potato StEF1a was used as an internal reference for RNA sample normalization. The 2 -ΔΔCT method was used for relative quantitative analysis of target gene RNA levels. The primers used are shown in Table 1: Table 1: Primers used in this study

[0083] The results are shown in Figure 6 The expression of disease resistance-related genes PR2 and WRKY40 in potato was significantly induced at different times (1, 3, 8, 12, and 24 h) after vitamin K1 treatment, with PR2 peaking at 1 h after vitamin K1 treatment, WRKY40 peaking at 8 h after vitamin K1 treatment Figure 5 . The above results indicate that vitamin K1 treatment can increase the expression of disease resistance-related genes PR2 and WRKY40 in potato.

[0084] Example 7: Vitamin K1 solution spray treatment increases superoxide levels in potato.

[0085] (1) Test site overview and test material The test site is located in Wuhan University, Wuhan City, Hubei Province Reagents: Vitamin K1, Nitroblue Tetrazolium (NBT), Tween 20 were purchased from Shanghai Aladdin Biochem Technology Co., Ltd. Potato variety: Desiree (2) Vitamin K1 spray treatment of potato and NBT staining: Select 2-month-old potato plants for the experiment, spray the plants with a 0.1 mM concentration of Vitamin K1 solution using a sprayer, record the treatment time, collect the leaves 24 hours after treatment, immerse them in NBT staining solution, and vacuum treat for 0.5 hours. Then remove the leaves, decolorize them multiple times with 95% ethanol to remove chlorophyll from the samples, and finally take photographs for record.

[0086] The results are shown in Figure 7 The control (water) treated potato leaves were transparent and colorless, while blue substances were found on the leaves treated with Vitamin K1, indicating that superoxide was present in the leaves treated with Vitamin K1, further indicating that Vitamin K1 can stimulate the production and accumulation of reactive oxygen species in potato leaves.

[0087] The above only describes preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present application shall be included within the scope of protection of the present application.

Claims

1. Application of Vitamin K1 as an immune inducer in the prevention and control of crop diseases.

2. The application according to claim 1, characterized in that, The crops include rice, wheat, and potatoes.

3. The application according to claim 1, characterized in that, The pathogens that cause the disease include bacteria, fungi, and oomycetes.

4. The application according to claim 1, characterized in that, Vitamin K1 is used to enhance the disease resistance of crops such as rice, wheat, and potatoes against bacteria, fungi, or oomycetes.

5. The application according to claim 1, characterized in that, Vitamin K1 is used to improve the resistance of rice to bacterial and fungal diseases.

6. The application according to claim 1, characterized in that, Vitamin K1 is used to improve wheat's resistance to fungal diseases.

7. The application according to claim 1, characterized in that, Vitamin K1 is used to improve the resistance of potatoes to oomycete diseases.

8. The application according to claim 1, characterized in that, Vitamin K1 is applied to the leaves of crops by spraying.

9. A method for controlling crop diseases, characterized in that, The plants, which are rice, wheat, or potato plants, are treated by spraying vitamin K1.

10. The crop disease control method according to claim 9, characterized in that, The concentration of vitamin K1 in a 0.02% Tween 20 aqueous solution is 0.1-1 mmol / L.

Images