Composition and kit for detecting liver cancer and application of composition and kit

Abstract

The invention relates to the field of molecular biological detection, in particular to the field of liver cancer detection. The invention provides a composition for detecting liver cancer. The composition comprises a detection reagent for detecting the methylation level of the following regions: CHR2: a region shown as SEQ ID NO: 1 in an intergene region of 273. Meanwhile, the invention further provides a kit comprising the composition and application of the composition. The liver cancer can be clinically detected with high sensitivity and good specificity; clinically, the liver cancer can be sensitively and specifically detected at the early stage.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology detection, specifically, to the field of liver cancer detection, more specifically, to the detection of methylation level of liver cancer gene marker. BACKGROUND

[0002] Liver cancer is one of the most common and deadly diseases in the world, which is a malignant tumor with great harm. With the effective control of carcinogenic factors, although the incidence and mortality of liver cancer have shown a downward trend in the past decades, the 5-year survival rate of liver cancer patients is still low. How to further reduce the burden of liver cancer is still a major problem to be solved in the field of public health and chronic disease prevention and control. Liver cancer is insidious in onset, and there is no specific symptom in the early stage. Most liver cancer patients are in the middle and advanced stage when they seek medical treatment, with low surgical cure rate and short survival period. Serum alpha fetal protein (AFP) and ultrasound examination are currently important methods for diagnosing liver cancer, but their sensitivity and specificity are not ideal. The sensitivity of AFP screening can only reach 40-60%, and the AFP level of many early liver cancer patients always remains normal; while in a considerable part of liver disease patients, AFP is also abnormally elevated; ultrasound detection is very dependent on instruments and human operation, and is limited by the distribution of medical resources and the experience of doctors; ultrasound contrast and puncture examination are complex and traumatic, and are not suitable for early screening and diagnosis.

[0003] Tumor marker detection is a method developed in recent years for detecting diseases, and finding accurate, stable and effective liver cancer molecular markers is of great significance for early diagnosis and early treatment of liver cancer. With the gradual deepening of the scientific community's understanding of tumors, more and more studies have confirmed that changes in the epigenetic level of cells are key events in the occurrence and development of tumors. DNA methylation, histone modification and miRNA expression abnormalities all belong to epigenetic changes, and the core link of tumor occurrence is also related to DNA abnormal methylation. DNA methylation detection has good stability, is easy to detect, and its abnormal degree is often related to the progression of cancer, so it is the most potential marker for early screening of tumors.

[0004] Therefore, there is an urgent need in the art for products that can detect early liver cancer with high sensitivity and good specificity, and can provide additional or even better options for clinical diagnosis, especially for blood detection. SUMMARY

[0005] Therefore, the present application provides a composition for detecting liver cancer, which comprises detection reagents for detecting the methylation level in the following regions:

[0006] the region of CHR2:273 intergenic region located at Chr2:2735717-2736037 as set forth in SEQ ID NO: 1.

[0007] Further, the composition of the present application further comprises at least one of the detection reagents for detecting the methylation level in the following regions:

[0008] the region of ALX3 gene as set forth in SEQ ID NO: 2;

[0009] the region of DLX6 gene as set forth in SEQ ID NO: 3;

[0010] the region of MAP3K13 gene as set forth in SEQ ID NO: 4;

[0011] the region of PSD4 gene as set forth in SEQ ID NO: 5; or

[0012] the region of SEPT9 gene as set forth in SEQ ID NO: 6.

[0013] Further, the present application provides a composition for detecting liver cancer, which further comprises at least two of the detection reagents for detecting the methylation level in the above-mentioned regions.

[0014] Specifically, for example, the composition can be the detection reagents for detecting the methylation level in the following regions:

[0015] the region of CHR2:273 intergenic region as set forth in SEQ ID NO: 1; the region of ALX3 gene as set forth in SEQ ID NO: 2; the region of DLX6 gene as set forth in SEQ ID NO: 3. Or

[0016] the region of CHR2:273 intergenic region as set forth in SEQ ID NO: 1; the region of ALX3 gene as set forth in SEQ ID NO: 2; the region of PSD4 gene as set forth in SEQ ID NO: 5.

[0017] Further, the present application provides a composition for detecting liver cancer, which further comprises at least three of the detection reagents for detecting the methylation level in the above-mentioned regions.

[0018] Specifically, for example, the composition can be the detection reagents for detecting the methylation level in the following regions:

[0019] The region between CHR2:273 genes is shown in SEQ ID NO:1; the region in the ALX3 gene is shown in SEQ ID NO:2; the region in the DLX6 gene is shown in SEQ ID NO:3; and the region in the MAP3K13 gene is shown in SEQ ID NO:4.

[0020] Alternatively, the region between the CHR2:273 genes as shown in SEQ ID NO:1; the region in the ALX3 gene as shown in SEQ ID NO:2; the region in the PSD4 gene as shown in SEQ ID NO:5; or the region in the SEPT9 gene as shown in SEQ ID NO:6.

[0021] Furthermore, the present invention provides a composition for detecting liver cancer, the composition further comprising at least four of the detection reagents for detecting methylation levels in the aforementioned region.

[0022] Specifically, for example, the composition can be a detection reagent for detecting methylation levels in the following regions:

[0023] The region between CHR2:273 genes is shown in SEQ ID NO:1; the region in the ALX3 gene is shown in SEQ ID NO:2; the region in the DLX6 gene is shown in SEQ ID NO:3; the region in the MAP3K13 gene is shown in SEQ ID NO:4; and the region in the PSD4 gene is shown in SEQ ID NO:5.

[0024] Alternatively, the region shown in SEQ ID NO:1 in the CHR2:273 intergenic region; the region shown in SEQ ID NO:2 in the ALX3 gene; the region shown in SEQ ID NO:3 in the DLX6 gene; the region shown in SEQ ID NO:5 in the PSD4 gene; or the region shown in SEQ ID NO:6 in the SEPT9 gene.

[0025] Furthermore, the present invention provides a composition for detecting liver cancer, the composition comprising a detection reagent for detecting methylation levels in the following regions:

[0026] The CHR2:273 intergenic region is shown in SEQ ID NO:1;

[0027] The region in the ALX3 gene shown in SEQ ID NO:2;

[0028] The region in the DLX6 gene shown in SEQ ID NO:3;

[0029] The region in the MAP3K13 gene shown in SEQ ID NO:4;

[0030] The region of the PSD4 gene as shown in SEQ ID NO:5; and

[0031] The region in the SEPT9 gene as shown in SEQ ID NO:6.

[0032] In this invention, the regions shown in SEQ ID NO:1 in the CHR2:273 intergenic region, the regions shown in SEQ ID NO:2 in the ALX3 gene, the regions shown in SEQ ID NO:3 in the DLX6 gene, the regions shown in SEQ ID NO:4 in the MAP3K13 gene, the regions shown in SEQ ID NO:5 in the PSD4 gene, and the regions shown in SEQ ID NO:6 in the SEPT9 gene are segments of the CpG islands of their respective regions.

[0033] Specifically, the SEQ ID NO:1 region of the CHR2:273 fragment is shown below:

[0034] TCCACATGGTCCTCACACGCATGTGGCCTGGTCCCTGGGAGGCCATGCAAGATGATACTCAGTAAGACACACAGCAATGTGAAGGTGACCGGCCGACCCCAGCAAGACGCAGATACTCAGTAAGACACACAGCAACGTGAAGGTGACCGCCCGACCCCAG CAAGACGCAGATACTCAGTAAGACACACAGCAATGTGAAGGTGACCGGCCGACCCAGCAAGATGCAGATACTCAGTGAGACACACAGCAACGTGAAAGTGACCGGCCGACCCAGCAAGACGCAGCCACTCACAGTGGGAGGAAAGCAAGAAATGGCAG;

[0035] The SEQ ID NO:2 region of the ALX3 gene is shown below:

[0036] CAGGCGGGTGCGAGCAGAGCCTGGTAGAGATCCTGGCGGCCGCTAGCCTCTGGCGCTCTTGCCGGTGTTCAACGGGCTGCCAGCGTCCCTGCGGCAGAGCGGACCTCGGCGCAGCGCGGCGCGCGGTGGAGCCTGGCTGCTTGAGGACAGTCAGCCCCCAGGGCCGCACAGCCTACTTGGTGGGAAGTGGCGGGCGAAGAGGGAACCCGCCTTATTTCCCGGTTTTTAAAATAACCGGCTCGGAGCGTTTCCAGTCCACACGAGTGAGCGCGCAGCTGCGCCCCATCTGCGGCGCGATCTTTCACGAGGCTGGGCAGTTGC;

[0037] The SEQ ID NO:3 region of the DLX6 gene is shown below:

[0038] GGGACAAAGTTGCCGTGAGAGGCGCAGCCTGCTCGTGGGCTGGTCTGAGCTGTTGGTTGTGTTTTGTTTGAGGATTTGGTCCTCCTCAGGAGAGTCATTTCAAAACATGCCGAGGATGCTTGATGCACTGAGCTTGGAGCTGGTGACATCAAGTCAACTGGCCGCGTAAACACCTGGGTGGCTCAAGCACAGCTTCAGGTACTGTTAAGCCGGGCACAGGGGCCCCGCTCCGCCCGGACAGCTGCCGCCTTGCTGCGCTGCGCACCCCAGAGAGCCTCCGGCACCGCCTCCGCTGCGGCAAAGCGGGCTGTTTGTCTGAGG;

[0039] The SEQ ID NO:4 region of the MAP3K13 gene is shown below:

[0040] AATGGAACAGCATGTGTAGGAATTCTTCGTTGTTGTGAGTATTGCACTCTGTTTTTCCTGTTTCTTCAGTATTTATTTCACAAGGACAGACAGAGAATGTGTGATTTGAGGTGATTAGAAAGCTGATATTATTGAGGGCGACACCGTGAGAGAGACAGAGAGACAGAGGCGGAGAGAAACCCGAAACCCCGTTACAGCTAGGAGCCTCTGAAACTGACAGCTGGTTTTCCTTTGCTTGTCTGCCTGCTAGACGTGGACATTTTTCATTTACGGTTCTGCACGTTACCTCGGATGCCTGCTTGGCTTTCCTTAAAGGGAGAT;

[0041] The SEQ ID NO:5 region of the PSD4 gene is shown below:

[0042] CCTTTCAATCCCAGGCCCCTGCATGGCAGGGAGAGGCCAGTTCCACCATGGCAGGTTCTTTCTAGGCTGGTGTGCAGGGTGGGGGCCTCCAAGGAGCAGGGGCATGGGGAAAGGGGCTGCAGGCGCTGGGCCTAGGAAGAGAGGCTCTTATCTTGTGGGCAGGAAGTGTGAGGTGTTGAGCAGCTAGGGAACCCTGGGGAGGCGGCGGGGAGCAGGAGGGGTGTGTGTTGTGGTGAGGAGGAGCGGAAGTCGGAAGCTCCAGCCGTCACAGCCACATTCACTGGGCAAGCCGACTGTGAGCCAGGAAGTGCTCTTGGGGAG;

[0043] The SEQ ID NO:6 region of the SEPT9 gene is shown below:

[0044] GCTTCTCTGACAGCCGTGTCCATCCCCGCCCTGTGCCCCTTCTCCCGGACAGTGCCTTCTCCAGGGCTCACCCAGGAGGGTGCAGCGGTGGCCCCCGGGGCGGTGGTCGTGGTGGGGGTGTTAGCTGCAGGGGTGCCCTCGGTGGGTGGGAGTTGGTGGC CTCTCGCTGGTGCCATGGGACTCGCATGTTCGCCCTGCGCCCCTCGGCTCTTGAGCCCACAGGCCGGGATCCTGCCTGCCAGCCGCGTGCGCTGCCGTTTAACCCTTGCAGGCGCAGAGCGCGCGGCGGCGGTGACAGAGAACTTTGTTTGGCTGCCCAA.

[0045] Cell-free DNA in blood can be used to detect tumors, offering advantages such as minimal harm to patients and high specificity. However, due to its extremely low concentration in blood, its sensitivity is relatively low. Using the composition of this invention, liver cancer samples can be detected in blood cell-free DNA with a sensitivity of up to 0.8995, a specificity of 0.9563, and an area under the curve of 0.9754. The reagent combination of this invention enables high sensitivity and specificity for liver cancer detection in clinical practice with fewer biomarkers, saving both cost and time. Clinically, it allows for sensitive and specific detection in the early stages of malignant transformation of liver cancer.

[0046] In this invention, "CpG island" is an abbreviation for cytosine (C)-phosphate (p)-guanine (G), which refers to some regions on the genome rich in CpG dinucleotides, with a length of 300 to 3000 bp.

[0047] In some implementations, the detection reagent of the present invention can be used to detect the methylation level of CpG islands or a sequence on a CpG island present in a sample.

[0048] In this invention, a "sample" is a biological sample selected from an individual. Specifically, for example, it is selected from cell lines, histological sections, tissue biopsy / paraffin-embedded tissues, body fluids, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof.

[0049] Preferably, the "sample" of the present invention is blood, that is, cell-free DNA in blood.

[0050] In this invention, "detection reagent" refers to a reagent used to detect the methylation level of genes in a sample. The methylation level is measured using methods such as amplification sequencing, microarray detection, and methylation fluorescent PCR.

[0051] In some specific implementations, the methylation level detection reagent may also be a reagent for detecting the average methylation level of a gene fragment.

[0052] In some specific implementations, the methylation level detection reagent may also be a detection reagent that detects one or more methylation sites within a gene segment.

[0053] In some specific implementations, the detection reagents include, but are not limited to, nucleic acid primers and sequencing tag sequences, used to measure methylation levels through amplification and sequencing.

[0054] In some specific embodiments, the detection reagents include, but are not limited to, chips, which are methylation chips having probes that specifically bind to methylation regions. The chips may be selected from, but are not limited to, Agilent's Human CpG Island Microarrays and Human DNA Methylation Microarrays, Illumina's Infinium HumanMethylation27 BeadChip, Infinium HumanMethylation450 BeadChip, and GoldenGate Methylation Assay, and Roche NimbleGen's Human DNAMethylation 2.1M Deluxe Promoter Array and Human DNA Methylation Array, etc., for measuring methylation levels via the chip.

[0055] In some specific implementations, the detection reagents include, but are not limited to, nucleic acid primers and nucleic acid probes, for measuring methylation levels via quantitative methylation PCR.

[0056] In some specific embodiments, the above composition may also include other reagents, specifically, for example, various reagents required for sample pretreatment or conditioning. Examples include sample release agents for extracting nucleic acids from samples, purifying agents for purifying nucleic acids from samples, and bisulfites or sulfites used for conversion.

[0057] Furthermore, the above composition also includes reagents for extracting cell-free DNA from plasma.

[0058] Secondly, the present invention provides the use of the above-described composition in the preparation of a kit for detecting liver cancer.

[0059] Furthermore, the present invention provides the use of the above composition in the preparation of a kit for detecting liver cancer using cell-free DNA from plasma.

[0060] Thirdly, the present invention provides a kit for detecting liver cancer, the kit comprising the composition described above.

[0061] Furthermore, the kit also includes, but is not limited to, reagents for extracting nucleic acids, reagents for purifying nucleic acids, and sequencing reagents.

[0062] Furthermore, the sequencing reagent includes at least one of bisulfite, T4 polynucleotide kinase, and T4 ligase.

[0063] Furthermore, the reagent for extracting nucleic acid is a reagent for extracting tissue DNA and a reagent for extracting cell-free DNA from plasma.

[0064] Furthermore, the reagent for extracting nucleic acid is a reagent for extracting cell-free DNA from plasma. Attached Figure Description

[0065] Figure 1 The methylation level of the single target Chr2:237 in peripheral blood;

[0066] Figure 2 ROC plot for the single target Chr2:237 in peripheral blood to differentiate between cancer and non-cancerous cells;

[0067] Figure 3 ROC plot of the combined target of the present invention in peripheral blood to distinguish between cancer and non-cancer cells;

[0068] Figure 4 Comparison of methylation in upstream and downstream regions outside the Chr2:237 target region. Detailed Implementation

[0069] The present invention will be described in detail below with reference to specific implementation schemes and embodiments, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific implementation schemes and embodiments are for illustrative purposes only and are not intended to limit the present invention.

[0070] Example 1: Screening of methylation gene markers

[0071] This invention collects and mines hepatocellular carcinoma (HCC) methylation data based on the TCGA dataset and the GEO database of the National Center for Biotechnology Information (NCBI). In a discovery set consisting of peripheral blood samples from 132 HCC patients and 122 individuals at risk of HCC, capture library construction and sequencing methods were used for methylation detection. Various bioinformatics techniques were employed to analyze the differential methylation levels between HCC samples and control samples (at-risk individuals), initially identifying relatively specific methylation biomarkers. Further validation was achieved through next-generation sequencing (NGS) analysis of methylation in real clinical samples. The method for detecting gene methylation levels in clinical samples is as follows:

[0072] 1. Sample preparation

[0073] The sample preparation of this invention is performed using MagMAX. TM The Cell-Free DNA Isolation Kit extracts 4 ml of plasma, elutes with 45 μL of elution buffer, and the total amount of extracted nucleic acid is greater than 20 ng.

[0074] 2. Library preparation

[0075] In this invention, all quality-controlled free nucleic acids were subjected to bisulfite treatment using the EZ DNA Methylation-Lightning™ Kit (Zymo Research, Irvine, CA, USA). Subsequently, the bisulfite-treated sample DNA was used to construct a pre-library library using a capture library construction method. After the pre-library library passed quality control, the target region was captured and enriched using liquid chip hybridization to complete the construction of the final library.

[0076] 2.1 Pretext library construction steps:

[0077] 1) Phosphorylation: T4 polynucleotide kinase phosphorylates the 5' end of bisulfite-treated DNA.

[0078] 2) SS1 ligation: T4 DNA Ligase (Rapid) ligates the SS1 adapter to the 5' end of phosphorylated DNA.

[0079] 3) Nucleic acid purification: Use a 2-volume Agencourt AMPure XP system (Beckman Coulometer, CA, USA) to remove any remaining adapters.

[0080] 4) SS2 ligation: T4 DNA Ligase (Rapid) ligates the SS2 adapter to the 3' end of phosphorylated DNA.

[0081] 5) Nucleic acid purification: Use a 2-volume Agencourt AMPure XP system (Beckman Coulometer, CA, USA) to remove any remaining adapters.

[0082] 6) Amplification: The nucleic acid from the previous step was amplified using NEBNext Q5U Master Mix, primer 1.0 (universal primers), and Bacard sequences.

[0083] 7) Nucleic acid purification: Use 1.2 times the volume of the Agencourt AMPure XP system (Beckman Coulometer, CA, USA) to remove primer dimers and excess primers.

[0084] 8) Quality control: The purified preliminaries are subjected to... The total quality of the library was checked using the dsDNAHS Assay Kit (LifeTechnologies, CA, USA), and the distribution of library fragments was checked using the LabChip GXII Touch.

[0085] 2.2. Microarray (Twist Bioscience) Hybridization Capture Steps:

[0086] 1) Chip hybridization: The 1.5ug library that has passed quality inspection and is mixed is vacuum concentrated into powder and then mixed with Hybridization Mix, Blocker Solution, Universal Blockers, and Hybridization Enhancer reagents (all reagents used in chip hybridization are provided by Twist Bioscience). The mixture is then placed in a PCR instrument and incubated at 70°C for 16 hours overnight, with the hot lid temperature at 85°C.

[0087] 2) Magnetic bead capture: The capture magnetic beads were washed three times with streptavidin binding buffer beforehand. The hybridization product was added to the capture magnetic beads and incubated for 30 minutes. Wash once with washing buffer 1 and three times with washing buffer 2. Finally, 42 μl of ultrapure water was used for elution.

[0088] 3) Amplification: The captured library was amplified using KAPA HiFi HotStart ReadyMix and universal primers.

[0089] 4) Purification: Primer dimers and excess primers were removed using a 1-volume Agencourt AMPure XP system (Beckman Coulometer, CA, USA).

[0090] The purified library was used The dsDNAHS Assay Kit (Life Technologies, CA, USA) and LabChip GXII Touch were used for quality control of the total nucleic acid content, fragment distribution, and primer dimer ratio in the library.

[0091] 3. Sequencing

[0092] Libraries that have passed quality checks regarding total library size, fragment size distribution of amplified products, and primer dimer ratios are mixed in a 1:1 molar ratio and then... The dsDNAHS Assay Kit (Life Technologies, CA, USA) enables precise quantification of mixed libraries, followed by denaturation and dilution of the libraries before sequencing.

[0093] 4. Establishment of a liver cancer classification model

[0094] For the raw FASTQ data obtained from sequencing, the raw data was filtered, and methylation analysis of the microarray captured fragments was performed using Bismark methylation analysis software to obtain the methylation levels of candidate genes. Based on the methylation levels of candidate gene fragments, differential analysis and model construction were conducted for liver cancer and control samples.

[0095] Ultimately, we identified the CHR2:273 promoter region, the CpG island, as the detection target. The methylation level of CHR2:273 in peripheral blood samples from the discovery set was as follows: Figure 1 As shown.

[0096] Example 2: Performance Analysis of CHR2:273 and its Combinations

[0097] A diagnostic model was developed using CHR2:273 combined with one or more of the ALX3, DLX6, MAP3K13, PSD4, and SEPT9 genes. The discovery set and validation set samples were tested using the method described in Example 1. The discovery set consisted of peripheral blood samples from 132 patients with hepatocellular carcinoma and 122 individuals at risk of hepatocellular carcinoma. The validation set consisted of peripheral blood samples from 61 patients with primary hepatocellular carcinoma, 28 patients with cirrhosis, and 33 patients with hepatitis. The sensitivity and specificity of all samples in the discovery and validation sets were analyzed, and the results are shown in Table 1 below.

[0098] Table 1

[0099]

[0100] The ROC plot of the single target Chr2:273 in peripheral blood for differentiating between cancer and non-cancer cells is shown below. Figure 2As shown, the ROC plots for differentiating cancer from non-cancerous cells in peripheral blood by combined target 1 (Chr2:273, ALX3) and combined target 2 (Chr2:273, ALX3, PSD4) are as follows. Figure 3 As shown.

[0101] Plasma test results show that the detection sensitivity of the target combination biomarkers of the present invention in plasma samples from liver cancer patients reaches 0.8995, and the specificity reaches 0.9563. The detection performance is better than traditional screening methods (ultrasound and AFP examination), and can effectively improve the detection rate of liver cancer. Based on the target combination biomarkers of the present invention, a logistic classification model was constructed with an area under the curve of 0.9754, and the prediction results have high accuracy, which can assist in clinical judgment of the degree of liver cancer risk.

[0102] Example 3: Detection performance of the diagnostic model of the present invention on the discovery set samples.

[0103] The diagnostic model was constructed by combining CHR2:273 with ALX3, DLX6, MAP3K13, PSD4, and SEPT9 in Example 2. The model was used to detect peripheral blood samples from 132 patients with liver cancer and 122 patients at risk of liver cancer. The detection results of this diagnostic model in different types of liver cancer risk populations and patient stages are shown in Table 2.

[0104] Table 2

[0105]

[0106] Example 4: Detection performance of the diagnostic model of the present invention on validation set samples

[0107] A diagnostic model was constructed using CHR2:273 combined with ALX3, DLX6, MAP3K13, PSD4, and SEPT9 from Example 2. This model was used to analyze the peripheral blood samples of 61 patients with primary liver cancer, 28 patients with cirrhosis, and 33 patients with hepatitis. The model was used to detect and analyze the methylation levels of DNA methylation markers in the samples. The diagnoses of hepatocellular carcinoma, cirrhosis, and hepatitis were based on the final hospital pathological diagnosis. Plasma was promptly separated from the samples and stored at -80°C for later use. Methylation detection was performed on the samples according to the methylation detection method in Example 1, and the methylation detection results were used to determine the results using the constructed classification model. The results are shown in Table 3 below.

[0108] Table 3

[0109]

[0110] Comparative Example 1: Detection of clinical plasma samples using compositions targeting other genes.

[0111] As described in Example 1, the inventors also screened common genes closely related to liver cancer, ALX3, APC, GRASP, PPFIA1, and SEPT9, known in the art, during the invention process. To examine whether the target combination biomarkers of this invention are the optimal combination for detection, the CpG of the above genes was used as the detection target, and detection was performed according to the method of Example 1. Sensitivity and specificity were calculated for all target combinations, and the detection results are shown in Table 4 below.

[0112] Table 4

[0113]

[0114] As can be seen from the table above, the area under the curve for the control gene combination with the highest free DNA is 0.9427, which is lower than the area under the curve for the Chr2:273 target combination of this invention.

[0115] Comparative Example 2: Performance comparison of samples detecting methylation at different gene positions in this invention

[0116] The methylation levels of other regions upstream and downstream of CHR2:273 were selected as biomarkers. Compared with the combination of segments in this invention, the two showed different methylation differences and performance in cancer and non-cancer samples. The results are as follows: Figure 4 As shown, the methylation sites of CHR2:273 upstream and downstream of the selected target segment did not differ significantly between cancer and non-cancer individuals, and are therefore unsuitable as a biomarker for detecting liver cancer.

Claims

1. A composition for detecting liver cancer, said composition comprising a detection reagent for detecting methylation levels in the following regions: The intergenic region of CHR2:273 located in Chr2:2735717-2736037 is shown in SEQ ID NO:

1.

2. The composition according to claim 1, characterized in that, The composition also includes at least one detection reagent for detecting the methylation level in the following regions: The region in the ALX3 gene shown in SEQ ID NO:2; The region in the DLX6 gene shown in SEQ ID NO:3; The region in the MAP3K13 gene shown in SEQ ID NO:4; The region in the PSD4 gene as shown in SEQ ID NO:5; or The region in the SEPT9 gene as shown in SEQ ID NO:

6.

3. The composition according to claim 1, characterized in that, The composition also includes at least three detection reagents for detecting methylation levels in the following regions: The region in the ALX3 gene shown in SEQ ID NO:2; The region in the DLX6 gene shown in SEQ ID NO:3; The region in the MAP3K13 gene shown in SEQ ID NO:4; The region in the PSD4 gene as shown in SEQ ID NO:5; or The region in the SEPT9 gene as shown in SEQ ID NO:

6.

4. The composition according to claim 1, characterized in that, The composition also includes a detection reagent for detecting the methylation level in the following regions: The region in the ALX3 gene shown in SEQ ID NO:2; The region in the DLX6 gene shown in SEQ ID NO:3; The region in the MAP3K13 gene shown in SEQ ID NO:4; The region of the PSD4 gene as shown in SEQ ID NO:5; and The region in the SEPT9 gene as shown in SEQ ID NO:

6.

5. The composition according to claim 1, characterized in that, The detection reagents are those used in amplification sequencing, chip detection, or fluorescent PCR detection of methylation levels.

6. The composition according to any one of claims 1 to 5, characterized in that, The composition also includes reagents required for pretreatment or pretreatment of the sample.

7. Use of the composition according to any one of claims 1 to 6 in the preparation of a kit for detecting liver cancer.

8. The use according to claim 7, characterized in that, The kit is used to detect cell-free DNA in plasma.

9. A reagent kit for detecting liver cancer, characterized in that, The kit comprises the composition according to any one of claims 1 to 6.

10. The kit according to claim 8, wherein, The kit also includes reagents for extracting nucleic acids, reagents for purifying nucleic acids, and sequencing reagents.

Images