Method for detecting anaerobic bacteria based on CRISPR Cas12 one-step method

Abstract

The invention relates to a method for detecting anaerobic bacteria based on a CRISPR Cas12 one-step method, which comprises the following steps: respectively adding a reaction buffer solution, an additive, a fluorescent report probe for indicating whether CRISPR enzyme digestion reaction occurs or not, a target sequence amplification primer, sgRNA for guiding CRISPR / Cas protease to recognize a target sequence, DNA polymerase and CRISPR / Cas protease into a reaction tube, placing on a fluorescent quantitative PCR instrument, a constant-temperature metal heat block or a water bath kettle, and detecting the anaerobic bacteria in the reaction tube. Carrying out isothermal amplification and CRISPR detection at 57 to 62 DEG C; and judging the result according to the real-time or end point fluorescence signal change value or the color change in the reaction tube under the ultraviolet light. The method realizes detection of anaerobic bacteria (toxin-producing clostridium difficile) in clinical specimens, has high sensitivity and high specificity, is convenient for infection diagnosis, and especially has application potential of bedside detection.

Description

Technical Field

[0001] This invention belongs to the field of nucleic acid detection technology, and specifically relates to a one-step method for detecting anaerobic bacteria based on CRISPR Cas12. Background Technology

[0002] Clostridium difficile is a Gram-positive anaerobic bacillus and the leading cause of hospital-acquired infectious diarrhea. In its 2019 "Antibiotic Resistance Threat Report," the U.S. Centers for Disease Control and Prevention (CDC) listed Clostridium difficile as a top-priority "urgent" public health threat. The main pathogenic factors of Clostridium difficile are its secreted toxin A (TcdA) and toxin B (TcdB). The key to diagnosing Clostridium difficile infection is detecting toxin-producing Clostridium difficile in the stool of patients experiencing three or more episodes of unexplained diarrhea within 24 hours. Existing laboratory detection methods include toxin culture, cytotoxicity neutralization assays, immunological detection, and nucleic acid amplification assays. Toxin culture, cytotoxicity neutralization assays, and polymerase chain reaction-based nucleic acid amplification assays have high sensitivity and specificity, but they are either time-consuming, cumbersome, require specialized equipment, and are costly. Immunological methods for detecting glutamate dehydrogenase are only used as screening tests and cannot distinguish between toxin-producing and non-toxin-producing Clostridium difficile. They may even produce false-positive results due to interference from other bacteria. Furthermore, the sensitivity for detecting TcdA and TcdB is low, making false-negative results common in clinical practice. Therefore, these tests still fail to meet the clinical need for rapid, simple, inexpensive tests with high sensitivity and specificity.

[0003] Nucleic acid detection technology based on the CRISPR / Cas system has received widespread attention both domestically and internationally in recent years. The reaction system of this type of platform includes pre-amplification and CRISPR detection. The basic principle of the reaction is to amplify the target to a level that can be captured by the CRISPR system through nucleic acid amplification. Then, guided by CRISPR RNA (crRNA) or single-guide RNA (sgRNA), the Cas effector protein recognizes and binds to a specific target containing a protospacer-jacent motif (PAM), forming a Cas protein / crRNA (sgRNA) / target ternary complex. This activates the Cas protein's cis-cleavage activity specifically targeting the target and its trans-cleavage activity indiscriminately cleaving any single-stranded DNA (ssDNA) or RNA in the surrounding environment. Nucleic acid detection based on the CRISPR / Cas system utilizes the unique trans-cleavage mechanism of the Cas protein: ssDNA or RNA molecular probes with fluorescent and quenching groups attached to their ends are introduced into the detection system; if the Cas protein recognizes the target and cleaves the surrounding probe, the fluorescent group of the probe is released, and the reaction system emits fluorescence, thus confirming the presence of the specific target. Pre-amplification can amplify the target and improve the sensitivity of the entire detection system, and isothermal amplification is usually used. Compared with temperature-variable amplification, isothermal amplification completes the amplification of the target nucleic acid at a constant temperature, without the need for thermal cycling, thus taking less time and not relying on specialized laboratory equipment such as thermal cyclers. The CRISPR / Cas system can eliminate false positive results that may occur with isothermal amplification, improving the specificity of the entire detection system. In summary, the main characteristics of nucleic acid detection technology based on the CRISPR / Cas system are rapid reaction, simple conditions (temperature-controlled water bath or constant-temperature metal bath is sufficient to ensure smooth reaction), and the ability to detect micromolar (atmolar, aM, 10) samples. -18 This method targets nucleic acids at the M level, identifying variations in single bases. Furthermore, the detection results can be determined either by real-time numerical changes displayed on a fluorescence detection device or by visually observing color changes under blue or ultraviolet light. Therefore, this method is suitable for both laboratory and field testing.

[0004] However, the compatibility between nucleic acid amplification systems and CRISPR enzyme digestion reaction systems is poor. This is because the reaction buffers of the two systems are different, and there is a competitive relationship between nucleic acid amplification and CRISPR digestion. Specifically, when the Cas protein recognizes classical PAM, its ability to specifically cleave the target gene is too strong, and the amplified target nucleic acid product can be rapidly consumed, making it difficult to achieve exponential amplification. This results in the target not being effectively enriched, thus causing delayed and unstable fluorescence signal generation. Therefore, nucleic acid detection platforms based on the CRISPR / Cas system typically employ a two-step method and a one-tube two-step method in practice. The two-step method first requires preparing the nucleic acid amplification system and the CRISPR detection system separately. Then, the sample to be tested is added to the nucleic acid amplification system and allowed to react for a period of time before the amplification product is transferred to the CRISPR reaction system for final detection. This method is relatively complex and greatly increases the risk of cross-contamination, potentially affecting the reliability of the results. The one-tube method optimizes this process by fusing the two systems into the same reaction tube to avoid opening the cap, minimizing aerosol contamination and increasing the reliability of the detection results. However, most methods employ a two-step, single-tube approach. While all reaction components are added to the same tube (first the amplification system is added to the bottom, then the CRISPR system to the top), the nucleic acid amplification and CRISPR digestion reactions are still performed sequentially. Additional intervention is required during the experiment (after isothermal amplification has been underway for a period, the CRISPR components are centrifuged to the bottom of the tube) to complete the detection, making the process inconvenient. Currently, no single-step CRISPR detection system for Clostridium difficile requiring only one liquid handling step has been established internationally. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a one-step method for detecting anaerobic bacteria based on CRISPR Cas12. This method realizes the detection of anaerobic bacteria (toxigenic Clostridium difficile) in clinical specimens with high sensitivity and high specificity, which is convenient for diagnosing infections and has particular potential for point-of-care testing.

[0006] This invention provides a one-step method for detecting anaerobic bacteria based on CRISPR Cas12, comprising the following steps:

[0007] Add reaction buffer, additives, fluorescent reporter probe indicating whether CRISPR digestion has occurred, target sequence amplification primers, sgRNA guiding CRISPR / Cas protease to recognize the target sequence, DNA polymerase, and CRISPR / Cas protease to their respective reaction tubes. Place the tubes on a real-time PCR instrument, a constant-temperature metal heating block, or a water bath, and perform isothermal amplification and CRISPR detection at 57–62°C. Interpret the results based on real-time or endpoint fluorescence signal changes or color changes within the reaction tubes under UV light.Figure 1 As shown.

[0008] Preferably, the reaction buffer comprises isothermal amplification buffer, dNTPs, and magnesium sulfate.

[0009] Preferably, the reaction buffer comprises: 1X isothermal amplification buffer, 0.8–1.4 mM dNTPs, and 8–12 mM magnesium sulfate.

[0010] Preferably, the additive is glycine, and the concentration is preferably 240-720 mM.

[0011] Preferably, the fluorescent reporter probe is a single-stranded DNA with the sequence CCCCCCCC, which can be recognized and cleaved by CRISPR / Cas protease. Its 5' end can be labeled with a FAM fluorescent group, and its 3' end can be labeled with a BHQ1 quencher group.

[0012] Preferably, the concentration of the fluorescent reporter probe is 250–1000 nM.

[0013] Preferably, the target sequence amplification primers include:

[0014]

[0015] Preferably, the specific sequence of the sgRNA is as follows:

[0016]

[0017] Preferably, the concentration of the target sequence amplification primer is 1X; the concentration of sgRNA is 125–1500 nM.

[0018] Preferably, the DNA polymerase is a DNA polymerase with strand displacement function, capable of displacing downstream DNA strands without template denaturation. Bst 2.0 Warmstart DNA polymerase can be used.

[0019] Preferably, the CRISPR / Cas protease is a CRISPR / Cas protease that can tolerate reaction temperatures above 55°C, can specifically recognize target DNA under the guidance of sgRNA, and has both cis and trans cleavage activities, such as AapCas12b.

[0020] Preferably, the anaerobic bacteria are toxin-producing Clostridium difficile.

[0021] Preferably, the DNA polymerase is 8 units, and the CRISPR / Cas protease concentration is 125–750 nM.

[0022] Preferably, the ratio of CRISPR / Cas protease to sgRNA is 1:1, 1:1.5, or 1:2.

[0023] This invention is simple to operate, enabling simultaneous target amplification and detection within a single reaction tube. Once the amplification reaction begins, no intervention is required, reducing the risk of contamination from opening the tube. It also has low temperature control requirements, lowering laboratory equipment requirements and shortening detection time. It amplifies and detects DNA in test samples, featuring high sensitivity, strong specificity, and rapid, convenient operation.

[0024] The nucleic acid sample to be tested in this invention can be obtained by extracting nucleic acid from fecal samples using a column method.

[0025] Beneficial effects

[0026] (1) This invention enables the detection of anaerobic bacteria (toxin-producing Clostridium difficile) in clinical specimens, which facilitates the diagnosis of infection, and the method has particular potential for point-of-care testing.

[0027] (2) High sensitivity: The present invention can achieve high sensitivity detection by screening suitable primers and sgRNA and optimizing the concentration of each component and reaction temperature;

[0028] (3) High specificity: This invention uses sgRNA to guide the CRIPSR / Cas protein to specifically recognize the target nucleic acid;

[0029] (4) This invention does not necessarily require expensive and precise real-time PCR instruments, which effectively reduces the detection cost;

[0030] (5) The present invention uses ordinary PCR tubes for detection, completes the sample addition in one go, and the whole process is a closed tube reaction, which is not easy to generate contamination. Moreover, no intervention is required after the amplification reaction begins, which truly realizes one-step detection. Attached Figure Description

[0031] Figure 1 This is a schematic diagram of the workflow of the present invention.

[0032] Figure 2 This invention provides a positive and negative control for the detection of toxin-producing Clostridium difficile.

[0033] Figure 3 ad is the sensitivity test for detecting toxin-producing Clostridium difficile in this invention.

[0034] Figure 4 ab is the specific test of this invention for detecting toxin-producing Clostridium difficile. Detailed Implementation

[0035] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0036] Example 1

[0037] 1.1 Experimental Materials

[0038] 1.1.1 Reaction buffer

[0039] 1X Isothermal Amplification Buffer, 0.8–1.4 mM dNTPs, 8–12 mM magnesium sulfate.

[0040] 1.1.2 Additives

[0041] 240–720 mM glycine.

[0042] 1.1.3 Fluorescent reporter probe

[0043] 250~1000nM 5'-FAM-CCCCCCCCC-BHQ1-3'.

[0044] 1.1.4 Target sequence amplification primers and sgRNA

[0045] The sequence information of the amplification primers and sgRNA is the same as above. The primer set concentration is 1X, 125–1500 nM sgRNA.

[0046] 1.1.5 DNA polymerase and CRISPR / Cas protease

[0047] 8uBst 2.0 Warmstart DNA polymerase, 125-750nMAapCas12b.

[0048] 1.1.6 Positive control, negative control, and sample to be tested

[0049] Positive control: Standard plasmid containing targets tcdA and tcdB, details are as follows:

[0050]

[0051] Negative control: salmon sperm DNA solution or nuclease-free water or bufferATE.

[0052] Samples to be tested: Clinical stool specimens were collected from patients suspected of Clostridium difficile infection at Huashan Hospital affiliated with Fudan University. Inclusion criteria: (1) Age ≥ 18 years; (2) Received antimicrobial treatment within 60 days; (3) Diarrhea ≥ 3 times per day, with mostly unformed stools (Bristol stool classification 5-7).

[0053] Exclusion criteria: (1) chronic diarrhea; (2) use of laxatives within 3 days prior to diarrhea; (3) other clear causes of diarrhea, such as lactose intolerance.

[0054] 1.2 Detection of toxin-producing Clostridium difficile using a one-step CRISPR / Cas12 method for positive and negative controls.

[0055] 1.2.1 Pretreatment

[0056] Preparation of premixed solutions: 1X Isothermal Amplification Buffer, 0.8mM dNTPs (tcdA detection system) or 1mM dNTPs (tcdB detection system), 8mM magnesium sulfate, 720mM glycine (tcdA detection system) or 480mM glycine (tcdB detection system), 1000nM 5'-FAM-CCCCCCCC-BHQ1-3', 1X primer set, 500nM tcdA-sgRNA (tcdA detection system) or 750nM tcdB-sgRNA (tcdB detection system), 8uBst 2.0 Warmstart DNA polymerase, 500nM MAapCas12b (tcdA detection system) or 750nM MAapCas12b (tcdB detection system) (tcdA and tcdB detection systems are prepared separately).

[0057] 1.2.2 Pretreatment II

[0058] Add the tcdA detection system premix to tubes 1 and 5;

[0059] Add the tcdB detection system premix to tubes 2-4 and 6-8;

[0060] Add tcdA plasmid to tube 1;

[0061] Add the tcdB1 plasmid to tube 2;

[0062] Add the tcdB2 plasmid to tube 3;

[0063] Add the tcdB3 plasmid to tube 4;

[0064] Add negative control (salmon sperm DNA solution) to tubes 5, 6, 7 and 8.

[0065] 1.2.3, Reaction

[0066] After a brief centrifugation, place the reaction tube in the amplification device (in this example, a real-time PCR instrument is used).

[0067] 1.2.4 Results Analysis

[0068] like Figure 2 As shown, in both the tcdA and tcdB detection systems, the fluorescence intensity of the positive control was significantly higher than that of the negative control.

[0069] 1.3 Sensitivity test of CRISPR / Cas12 one-step method for detecting toxin-producing Clostridium difficile

[0070] 1.3.1 Pretreatment

[0071] Preparation of premixed solutions: 1X Isothermal Amplification Buffer, 0.8mM dNTPs (tcdA detection system) or 1mM dNTPs (tcdB detection system), 8mM magnesium sulfate, 720mM glycine (tcdA detection system) or 480mM glycine (tcdB detection system), 1000nM 5'-FAM-CCCCCCCC-BHQ1-3', 1X primer set, 500nM tcdA-sgRNA (tcdA detection system) or 750nM tcdB-sgRNA (tcdB detection system), 8uBst 2.0 Warmstart DNA polymerase, 500nM MAapCas12b (tcdA detection system) or 750nM MAapCas12b (tcdB detection system) (tcdA and tcdB detection systems are prepared separately).

[0072] 1.3.2 Pretreatment II

[0073] The standard plasmids tcdA, tcdB1, tcdB2, and tcdB3 were serially diluted using salmon sperm DNA solution. Five concentration gradients were set up for each target (tcdA, tcdB1, tcdB2, and tcdB3 standard plasmids), and eight replicates were set up for each concentration gradient.

[0074] 1.3.3. Add the tcdA detection system premix to tubes 1-5 and 21 of the three-dimensional pretreatment system;

[0075] Add the tcdB detection system premix to tubes 6-20 and 22-24;

[0076] Add tcdA standard plasmids of decreasing concentration sequentially to tubes 1 through 5;

[0077] Add tcdB1 standard plasmid in descending concentrations to tubes 6 through 10;

[0078] Add tcdB2 standard plasmid in descending concentrations to tubes 11 through 15;

[0079] Add tcdB3 standard plasmid in descending concentrations to tubes 16 through 20;

[0080] Add negative control (salmon sperm DNA solution) to tubes 21-24.

[0081] 1.3.4, Reaction

[0082] After a brief centrifugation, place the reaction tube in the amplification device (in this example, a real-time PCR instrument is used).

[0083] 1.3.5 Result Judgment

[0084] The sensitivity of the detection method is reflected by the determination of the limit of detection (LoD). LoD is defined here as the lowest copy number of fluorescence intensities that can reach the threshold in repeated experiments with the corresponding template before the reaction ends.

[0085] 1.3.6 Results Analysis

[0086] from Figure 3 As can be seen, the LoD value of the tcdA detection system is approximately 14 copies per reaction; the LoD values ​​of the tcdB detection systems targeting tcdB1, tcdB2, and tcdB3 plasmids are approximately 9, 14, and 3 copies per reaction, respectively. Therefore, this method has high sensitivity.

[0087] 1.4 Specificity test for CRISPR / Cas12 one-step method for detecting toxin-producing Clostridium difficile

[0088] 1.4.1 Pretreatment

[0089] Preparation of premixed solutions: 1X Isothermal Amplification Buffer, 0.8mM dNTPs (tcdA detection system) or 1mM dNTPs (tcdB detection system), 8mM magnesium sulfate, 720mM glycine (tcdA detection system) or 480mM glycine (tcdB detection system), 1000nM 5'-FAM-CCCCCCCC-BHQ1-3', 1X primer set, 500nM tcdA-sgRNA (tcdA detection system) or 750nM tcdB-sgRNA (tcdB detection system), 8uBst 2.0 Warmstart DNA polymerase, 500nM MAapCas12b (tcdA detection system) or 750nM MAapCas12b (tcdB detection system) (tcdA and tcdB detection systems are prepared separately).

[0090] 1.4.2 Pretreatment II

[0091] The bacterial DNA required for specific detection was prepared using the boiling template method. The bacteria used included clinical isolates of toxin-producing Clostridium difficile (C. difficile) and other opportunistic pathogens of the human intestinal tract, including Escherichia coli (E. coli), Klebsiella pneumoniae (K. pneumoniae), Pseudomonas aeruginosa (P. aeruginosa), Proteus mirabilis (P. mirabilis), Staphylococcus aureus (S. aureus), Enterococcus faecalis (E. faecalis), and Bacteroides fragilis (B. fragilis).

[0092] 1.4.3 Pretreatment III

[0093] Add the tcdA detection system premix to tubes 1-9;

[0094] Add the tcdB detection system premix to tubes 10–18;

[0095] DNA from C. difficile, K. pneumoniae, P. aeruginosa, E. coli, S. aureus, E. faecalis, P. mirabilis, and B. fragilis was added sequentially to tubes 1 through 8.

[0096] DNA from C. difficile, K. pneumoniae, P. aeruginosa, E. coli, S. aureus, E. faecalis, P. mirabilis, and B. fragilis was added sequentially to tubes 10 through 17.

[0097] Negative control (nuclease-free water) was added to tubes 9 and 18.

[0098] 1.4.4, Reaction

[0099] After a brief centrifugation, place the reaction tube in the amplification device (in this example, a real-time PCR instrument is used).

[0100] 1.4.5 Results Analysis

[0101] from Figure 4 As can be seen, positive results were only generated when Clostridium difficile toxin-producing DNA templates were added to the tcdA and tcdB reaction systems. No amplified fluorescence signal was observed when DNA from other bacteria or the negative control was added. This indicates that there is no cross-reaction between the two systems for the detection of target and non-target components. Therefore, this one-step platform has high specificity.

[0102] 1.5. Testing of CRISPR / Cas12 one-step method for clinical sample detection

[0103] 1.5.1 Pretreatment

[0104] Preparation of premixed solutions: 1X Isothermal Amplification Buffer, 0.8mM dNTPs (tcdA detection system) or 1mM dNTPs (tcdB detection system), 8mM magnesium sulfate, 720mM glycine (tcdA detection system) or 480mM glycine (tcdB detection system), 1000nM 5'-FAM-CCCCCCCC-BHQ1-3', 1X primer set, 500nM tcdA-sgRNA (tcdA detection system) or 750nM tcdB-sgRNA (tcdB detection system), 8uBst 2.0 Warmstart DNA polymerase, 500nM AapCas12b (tcdA detection system) or 750nM AapCas12b (tcdB detection system) (tcdA and tcdB detection systems are prepared separately).

[0105] 1.5.2 Pretreatment II

[0106] Genomic DNA was extracted from clinical stool samples using the QIAamp Fast DNA Stool Mini Kit.

[0107] 1.5.3 Pretreatment III

[0108] Clinical stool specimens were tested using a Clostridium difficile toxin A / B gene detection kit (qPCR method), and the results were used as a reference.

[0109] 1.5.4 Pretreatment IV

[0110] DNA extracted from clinical specimens was added to the one-step detection system for tcdA and tcdB, respectively, with Buffer ATE used as the negative control.

[0111] 1.5.5, Reaction

[0112] After a brief centrifugation, place the reaction tube in the amplification device (in this example, a real-time PCR instrument is used).

[0113] 1.5.6 Results Analysis

[0114] Table 1. Relationship between one-step method and qPCR method detection results (tcdA)

[0115]

[0116]

[0117] Table 2 Relationship between one-step method and qPCR method detection results (tcdB)

[0118]

[0119] Table 3 Statistical Analysis of Clinical Specimen Detection Data

[0120]

[0121] Based on the qPCR results, the CRISPR / Cas12 one-step detection platform exhibited high sensitivity, specificity, positive predictive value, and negative predictive value. Kappa test showed good agreement between the CRISPR / Cas12 one-step method and the qPCR method for detecting tcdA and tcdB. McNemar's test indicated no statistically significant difference between the CRISPR / Cas12 one-step method and the qPCR method for detecting tcdA and tcdB (all P values ​​> 0.05).

Claims

1. A one-step method for detecting anaerobic bacteria based on CRISPR Cas12, characterized in that, Includes the following steps: Add the reaction buffer, additives, fluorescent reporter probe indicating whether CRISPR digestion has occurred, target sequence amplification primers, sgRNA guiding CRISPR / Cas protease to recognize the target sequence, DNA polymerase, and CRISPR / Cas protease to the reaction tubes respectively. Place the tubes on a real-time PCR instrument, a constant temperature metal heating block, or a water bath, and perform isothermal amplification and CRISPR detection at 57–62°C. The results are judged based on the real-time or endpoint fluorescence signal changes or the color changes in the reaction tubes under ultraviolet light.

2. The method according to claim 1, characterized in that: The reaction buffer includes isothermal amplification buffer, dNTPs, and magnesium sulfate.

3. The method according to claim 1, characterized in that: The additive is glycine.

4. The method according to claim 1, characterized in that: The fluorescent reporter probe is a single-stranded DNA with the sequence CCCCCCCC.

5. The method according to claim 1, characterized in that: The target sequence amplification primers include: tcdA-FIP: CCGCCAAAATTTTTTAGGGCTAATATTTATAGTCAGGAGTTGTTAAATCG; tcdA-BIP:GCTTCCAGGTATTCACTCTGATTTAACGGTCTAGTCCAATAGAGC; tcdA-F3:AGTTTGTTTTACAGAACAAGAGTT; tcdA-B3: GCCTCTAATTTTATCATTTCCCA; tcdA-LF: AGATGCTGCAGCTAAATTTCCA; tcdB-FIP:TTGCAGTTGTAGCTGCTGTTAAGTTAGTGACCCATTATTAAGACAAG; tcdB-BIP:TTAGGGATAGCTAGTGGATTTAGTGTATACCTGCTGAAATACCTG; tcdB-F3:GCAATCAAAGAGYTAAGTGAA; tcdB-B3:GTACAAGTTCATRTTTACTAAGC; tcdB-LF: CTGCCATTACTATCTTAGCTTC.

6. The method according to claim 1, characterized in that: The specific sequence of the sgRNA is as follows: tcdA-sgRNA: GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAA AGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACUAAAACAAUAUCUAGACCUA;tcdB-sgRNA: GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAA AGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACACUUUUAGUUCCUUUAGCAG.

7. The method according to claim 1, characterized in that: The DNA polymerase is Bst 2.0 Warmstart DNA polymerase.

8. The method according to claim 1, characterized in that: The CRISPR / Cas protease is AapCas12b.

9. The method according to claim 1, characterized in that: The anaerobic bacteria are toxin-producing Clostridium difficile.

Images