Primer group for plasmodium genus and species identification and detection method

Abstract

The invention belongs to the field of molecular biology and biomedical engineering, and particularly relates to a primer group for plasmodium genus and species identification and a colorimetric detection method based on loop-mediated isothermal amplification (LAMP). The primer group comprises a primer group of plasmodium and a specific primer group between plasmodium species; wherein the primer group (Pan-Plasmodium (Pan)) of the plasmodium is sequence information (5 '-3'), and the specific details are recorded in the specification. And through the optimally designed LAMP reaction system and the chromogenic reaction of the magnesium ion by-product and the pH indicator, the identification result of the sample can be judged, the detection efficiency is improved, and the visual instant detection of the plasmodium species is realized. Compared with existing microscope detection and rapid diagnosis test paper, the test paper has the advantages of short detection time, high sensitivity, strong specificity and the like, and provides a new technical means for accurate diagnosis, prevention and control of malaria.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and biomedical engineering, specifically relating to a primer set for identifying Plasmodium genus and species and a colorimetric detection method based on loop-mediated isothermal amplification (LAMP). Background Technology

[0002] Malaria is a parasitic disease caused by Plasmodium parasites, posing a significant threat to global public health. It is primarily caused by pathogens such as *Plasmodium falciparum*, *Plasmodium vivax*, *Plasmodium malariae*, and *Plasmodium ovale*, with *Plasmodium falciparum* infection causing the highest mortality rate. According to the latest statistics from the World Health Organization (WHO), 263 million cases were reported globally in 2023, resulting in 597,000 deaths, an increase of 11 million cases compared to 2022, showing a clear upward trend. Despite significant international investment in malaria control over the past decade, the disease continues to be prevalent in tropical and subtropical regions, placing a heavy burden on local healthcare systems.

[0003] In the clinical diagnosis and treatment of malaria, rapid, accurate, and economical diagnostic techniques are crucial. An ideal diagnostic method should possess the following characteristics: accurate identification of malaria parasites, avoidance of misdiagnosis, guidance for precise medication, and reduction of treatment costs. Currently, microscopic examination of blood smears remains the "gold standard" for malaria diagnosis recommended by the World Health Organization. However, this method has significant limitations: firstly, it requires experienced laboratory personnel and relies on large laboratory equipment, making it difficult to implement in resource-scarce areas; secondly, the testing process typically takes 2-3 hours, failing to meet the rapid response needs during outbreaks; more importantly, its detection sensitivity significantly decreases when the density of malaria parasites in the patient's peripheral blood is below 50-100 / μL. Furthermore, different malaria parasites are morphologically similar, making it difficult to identify mixed infections through routine microscopy. Rapid Diagnostic Tests (RDTs) are a malaria detection method based on immunochromatography, achieving rapid diagnosis by detecting malaria parasite-specific antigens in the patient's blood. Although diagnostic techniques like randomized controlled trials (RDTs) are simple to perform and overcome the limitations of microscopic examination, such as reliance on specialists and time consumption, they still have drawbacks. These include a risk of false negatives due to antigenic variation, limited detection capabilities for low-density infections, and insufficient sensitivity. These limitations severely hinder the early detection and timely intervention of malaria, necessitating the development of novel detection methods.

[0004] In recent years, loop-mediated isothermal amplification (LAMP) has become an ideal choice for point-of-care testing (POCT) due to its unique advantages. This technology has the following outstanding features: (1) simple operation, requiring only isothermal conditions to complete the reaction; (2) low requirements for instruments and equipment, suitable for use in resource-limited areas; (3) high detection efficiency, with results obtainable within 1 hour; and (4) excellent sensitivity, capable of detecting as few as 5-10 copies of the target sequence. The detection principle of the LAMP reaction is based on two byproducts generated during the amplification process: hydrogen ions (H+) cause a decrease in pH, while magnesium phosphate precipitation changes the turbidity of the solution. By adding appropriate colorimetric indicators (such as phenol red, EBT, etc.), a visible color change can be achieved, significantly reducing the technical threshold for result interpretation.

[0005] It is worth noting that the specificity of LAMP technology is highly dependent on primer design. An ideal LAMP primer set typically contains 4-6 specific primers capable of recognizing 6-8 specific regions of the target gene. If the primer design is inappropriate, primers are prone to dimerization or mismatch, potentially leading to non-specific amplification. This can also produce signals when interpreting results using dyes (such as SYBR Green), resulting in false positives. Furthermore, the turbidity of the sample itself can interfere with interpretation when using the byproduct magnesium pyrophosphate precipitation for turbidity analysis. Secondly, LAMP is best suited for amplifying shorter target fragments. Amplifying longer fragments significantly reduces efficiency and specificity. The sensitivity of LAMP is also highly dependent on optimized primers and reaction systems. In practical applications, especially for samples with complex backgrounds (such as blood and soil), insufficient sensitivity may be a concern. Summary of the Invention

[0006] The purpose of this invention is to provide a primer set and detection method for identifying Plasmodium genus and species.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] A primer set for identifying Plasmodium genus and species, comprising primer sets for Plasmodium genus and interspecific primer sets for each Plasmodium species; wherein the primer set for Plasmodium genus (Pan-Plasmodium(Pan)) contains sequence information (5'-3').

[0009] FIP: AGCTATTTCTCAGGCTCCCTCTAACATGGCTATGACGGGT; BIP: CCACATCTAAGGAAGGCAGCACCTTGTATTGTTATTTCTTGTCACT; F3: TGATGTTAGGGTATTGGCC;

[0010] B3: CCAATTACAAAAACCATGAAATGG;

[0011] LF:GGAATCGAACTCTAATTCCCCGTT;

[0012] LB: GGCCGGTAAATTACCCAATTCTAAA.

[0013] The Plasmodium species mentioned are Plasmodium falciparum (Pf), Plasmodium vivax (Pv), Plasmodium malariae (Pm), and Plasmodium ovale (Po), and the species-specific primer sets for each Plasmodium species are shown below:

[0014]

[0015]

[0016] An application of the primer set described herein, specifically its application in the identification of Plasmodium genus and interspecific species.

[0017] A method for detecting Plasmodium species and genus using the primer set described above involves using a blood sample as a template and amplifying the sample in a LAMP colorimetric reaction system using primers for the Plasmodium genus in the primer set. The characteristic fluorescence signal of the amplification product increases and the color of the reaction solution changes from purplish-red to pale yellow, indicating that the sample is carrying Plasmodium.

[0018] The samples carrying malaria parasites were further amplified in a LAMP colorimetric reaction system using the interspecific primer sets for each malaria parasite in the primer set of claim 1. The amplified products showed a characteristic increase in fluorescence signal and a change in the color of the reaction solution from purplish-red to pale yellow. The amplified products with a 311bp band were identified as Plasmodium falciparum; those with a 306bp band were identified as Plasmodium vivax; those with a 291bp band were identified as Plasmodium malariae; and those with a 256bp band were identified as Plasmodium ovale, thus achieving interspecific differentiation of the samples.

[0019] The LAMP colorimetric system was constructed as follows: the total volume of the reaction system was 15 μL, containing 4.8 μL buffer, 0.8 μL 100 mM mixture of various Plasmodium LAMP primers, 2.1 μL 10 mM dNTPs, 0.6 μL 1.2 mM EBT, 0.3 μL 1 mM phenol red, 0.6 μL Bst 2.0 DNA polymerase (8000 U / mL), 0.5 μL Eva Green (20×), 1.2 μL 10 mM MgSO4, 3.1 μL nuclease-free water, and 1 μL template.

[0020] The buffer solution is prepared by mixing 8 μL of 1M KOH, 10 μL of 1M (NH4)2SO4, 25 μL of 2M KCl, 1 μL of Tween 20 and 280 μL of nuclease-free water, and storing it at -20°C until use.

[0021] The LAMP primer mixtures for each Plasmodium species were prepared by using 5 μL of 100 μM F3 / B3, 40 μL of 100 μM FIP / BIP, and 20 μL of 100 μM LF / LB, respectively.

[0022] Compared with existing technologies, the present invention has significant detection advantages:

[0023] Firstly, regarding detection efficiency, this invention utilizes the LAMP colorimetric detection system to identify four major malaria parasites infecting humans. The reaction is conducted at a constant temperature of 65°C, eliminating complex temperature control requirements. This overcomes the temperature-dependent limitations of traditional PCR and the time bottleneck of microscopic detection, reducing detection time from several hours to within one hour, while simultaneously increasing sensitivity to 10-10. 3 Copy / μL; secondly, at the detection technology level, primers targeting the conserved region of the 18S rRNA gene, specifically those for the genus *Plasmodium* (P. falciparum), were designed, along with primers for four specific species. Through differentiated amplification products, simultaneous detection and accurate typing of four major *Plasmodium* species (*P. falciparum*, *P. vivax*, *P. malariae*, and *P. ovale*) were achieved, effectively solving the technical challenge of microscopic identification of mixed infections; furthermore, the LAMP reaction generates a large amount of hydrogen ions (H+). + The amplification byproducts lower the pH of the solution, at which point a significant color change can be observed using a pH indicator. Furthermore, the presence of magnesium ions (Mg²⁺) in the LAMP reaction system... 2+ It can react with pyrophosphate ions (PPi) precipitated from deoxyribonucleic acid triphosphate substrates (dNTPs). 4-The reaction produces a white precipitate of magnesium pyrophosphate, so the presence or absence of a visually perceptible color change can be used to determine whether or not someone is infected with Plasmodium and the specific species, significantly lowering the operational threshold. Therefore, the method of this invention provides a new technical means for developing specific detection methods and platforms for Plasmodium. Attached Figure Description

[0024] Figure 1 This is a sequence comparison diagram of the nested PCR amplification products of Plasmodium provided in the embodiments of the present invention.

[0025] Figure 2 The principles and steps for malaria parasite species detection and identification provided in the embodiments of the present invention.

[0026] Figure 3 This is a schematic diagram illustrating the results of detecting Plasmodium genus and identifying species based on the LAMP colorimetric method provided in an embodiment of the present invention.

[0027] Figure 4A The graph shows the sensitivity effect of the LAMP colorimetric method for detecting Plasmodium genus primers (Pan primers) provided in the embodiments of the present invention.

[0028] Figure 4B The graph shows the sensitivity of the LAMP colorimetric method for detecting Plasmodium species primers (Pf primers) provided in this embodiment of the invention.

[0029] Figure 4C The graph shows the sensitivity effect of the LAMP colorimetric method for detecting Plasmodium species primers (Pm primers) provided in the embodiments of the present invention.

[0030] Figure 4D The graph shows the sensitivity effect of the LAMP colorimetric method for detecting Plasmodium species primers (Pv primers) provided in the embodiments of the present invention.

[0031] Figure 4E The graph shows the sensitivity effect of the LAMP colorimetric method for detecting Plasmodium species primers (Po primers) provided in this embodiment of the invention. Detailed Implementation

[0032] The following examples further illustrate specific embodiments of the present invention. It should be noted that the specific embodiments described herein are merely for illustration and explanation and are not intended to limit the scope of the present invention.

[0033] This invention targets four Plasmodium species that infect humans: *Plasmodium falciparum*, *Plasmodium vivax*, *Plasmodium malariae*, and *Plasmodium ovale*. To achieve simultaneous detection of Plasmodium species and genera, universal LAMP primers were designed to amplify nucleic acid fragments containing both conserved and variant regions of the Plasmodium 18S rRNA. Specific primers for each of the four Plasmodium species were then designed for identification of these four species. The detection method utilizes LAMP colorimetry, where the presence or absence of color changes in each reaction tube allows for the identification and typing of Plasmodium infection. This highly practical method is particularly suitable for remote or underdeveloped areas.

[0034] Example 1: LAMP primer design.

[0035] Based on the similarity between sequences of 18S rRNA gene fragments from various Plasmodium species (four human-infecting Plasmodium species, including P. falciparum, P. vivax, P. malariae, and P. ovale), obvious insertion and deletion regions were eliminated to determine conserved sequences. Using the LAMP primer explorer online webpage (http: / / primerexplorer.jp / lampv5e / index.html), multiple sets of specific primers were designed for specific conserved regions of the four Plasmodium genes. These primers target 6-8 different regions (F3c, F2c, and F1c regions at the 3' end of the target gene, and B1, B2, and B3 regions at the 5' end of the target gene). Each set of primers includes a pair of F3 / B3 outer primers, a pair of FIP / BIP inner primers, and one or two loop primers (LF / LB). After multiple verifications, the primer set with the best theoretical parameters and highest success rate was selected as the LAMP primer set for identifying Plasmodium genus and species. The primer set consists of primer sets for Plasmodium genus and primer sets specific to each Plasmodium species. Among them, the primer set for Plasmodium genus (Pan-Plasmodium(Pan)) contains sequence information (5'-3').

[0036] FIP: AGCTATTTCTCAGGCTCCCTCTAACATGGCTATGACGGGT; BIP: CCACATCTAAGGAAGGCAGCACCTTGTATTGTTATTTCTTGTCACT; F3: TGATGTTAGGGTATTGGCC;

[0037] B3: CCAATTACAAAAACCATGAAATGG;

[0038] LF:GGAATCGAACTCTAATTCCCCGTT;

[0039] LB: GGCCGGTAAATTACCCAATTCTAAA.

[0040] The species-specific primer sets for each Plasmodium species are shown below:

[0041]

[0042] Example 2: LAMP-based colorimetric detection and species identification of Plasmodium species in blood samples; the principle is described in [link to example]. Figure 1 .

[0043] The samples used in this embodiment were whole blood samples from 20 malaria patients who were diagnosed by nested PCR using the primers listed in Table 1, obtained from the Shanghai Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention.

[0044] (1) Sample collection: Blood samples from patients were collected on filter paper, dried naturally to form dried blood spots, and then sealed in vacuum bags and stored in an ultra-low temperature freezer at -80℃.

[0045] (2) Sample nucleic acid extraction: Extract DNA from the sample according to the QIAGEN Blood kit instructions. The final DNA sample is dissolved in 50 μL of nuclease-free water for later use.

[0046] (3) Using the nucleic acid of each sample to be tested as a template, amplification was performed in the LAMP colorimetric reaction system using LAMP primer mixtures (specific primer sets for each species of Plasmodium recorded in the table above); wherein, the LAMP colorimetric system was constructed as follows: the total volume of the reaction system was 15 μL, containing 4.8 μL buffer, 0.8 μL 100 mL LAMP primer mixture, 2.1 μL 10 mM dNTPs, 0.6 μL 1.2 mM EBT, 0.3 μL 1 mM phenol red, 0.6 μL Bst 2.0 DNA polymerase (8000 U / mL), 0.5 μL LEva Green (20×), 1.2 μL 10 mM MgSO4, 3.1 μL nuclease-free water and 1 μL template. The buffer solution was prepared by mixing 8 μL of 1M KOH, 10 μL of 1M (NH4)2SO4, 25 μL of 2M KCl, 1 μL of Tween 20, and 280 μL of nuclease-free water, and then storing at -20°C for later use. The LAMP primer mixtures for each Plasmodium species were prepared by mixing 5 μL of 100 μM F3 / B3, 40 μL of 100 μM FIP / BIP, and 20 μL of 100 μM LF / LB, respectively. The amplified products were incubated at 65°C for 60 minutes using a Roche LightCycler 480 PCR (LC480) instrument. Fluorescence signals were collected every minute, and changes in fluorescence signal were reported for real-time analysis. Further detection was performed by electrophoresis.

[0047] When amplification is performed using a specific primer set for Plasmodium falciparum, the characteristic fluorescence signal in the amplification product increases and the color of the reaction solution changes from purplish-red to pale yellow, and a 311bp band appears in the amplification product, which indicates that it is Plasmodium falciparum.

[0048] When amplification is performed using a specific primer set for Plasmodium vivax, the characteristic fluorescence signal in the amplification product increases and the color of the reaction solution changes from purplish-red to pale yellow. The presence of a 306bp band in the amplification product indicates that it is Plasmodium vivax.

[0049] When amplification is performed using a specific primer set for Plasmodium malariae, the characteristic fluorescence signal in the amplification product increases and the color of the reaction solution changes from purplish-red to pale yellow. The presence of a 291bp band in the amplification product indicates that it is Plasmodium malariae.

[0050] When amplification was performed using a specific primer set for Plasmodium ovale, the characteristic fluorescence signal in the amplification product increased and the color of the reaction solution changed from purplish-red to pale yellow. The appearance of a 256bp band in the amplification product indicated Plasmodium ovale, thus enabling interspecies differentiation of 20 samples.

[0051] That is, the 20 verified samples included 5 cases of infection with each of Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale.

[0052] Example 3: Specificity characterization of five LAMP primer sets, including Pan primers.

[0053] To ensure the quality of Plasmodium nucleic acid extraction and the effectiveness of the detection system, the samples used in Example 2 were employed. First, a primer set of Plasmodium genus (Pan-Plasmodium (Pan)) was used to detect the DNA templates of four Plasmodium species and a negative control. The Pan primers target a conserved gene (18S rRNA gene) common to the four Plasmodium species, specifically recognizing Plasmodium nucleic acid. They do not cross-react with the human genome or other common pathogens (such as hepatitis B virus, dengue virus, etc.), and are used to preliminarily determine whether the sample contains Plasmodium nucleic acid. The culture system was consistent with step (3) in Example 2, except that the primers were replaced. After amplification, the product was incubated at 65°C for 60 minutes using a Roche LightCycler 480 PCR (LC480) to complete the reaction. Fluorescence signals were collected every minute, and changes in fluorescence signals were reported for real-time analysis.

[0054] Experimental results are from Figure 3 The results showed that, except for the negative control (without primer reaction system (NC)), the primer set LAMP system for each Plasmodium species exhibited typical S-type fluorescence amplification curves and color changes, confirming that Plasmodium infection was present in all samples and that the detection system was effective, allowing for subsequent species-specific detection.

[0055] Based on this, four species-specific LAMP primers (Pf, Pv, Pm, Po) were used for further detection. Except for the negative control, if a sample showed a typical (S-type) fluorescence amplification curve and color change in the detection using a particular species-specific primer group, and a specific band appeared, it was determined to be infected with the species corresponding to that primer; if no S-type amplification curve and color change appeared, it was determined to be negative for that species.

[0056] The results showed that all four specific primer sets (Pf / Pv / Pm / Po) exhibited strict species specificity, producing positive signals only for their respective target species (Plasmodium falciparum / Plasmodium vivax / Plasmodium malariae / Plasmodium ovale). Subsequently, when template DNA from different species was added to LAMP-specific primers for other species, no obvious fluorescence amplification curves or color changes were observed; a reaction only occurred with primers and targets specific to that species. This specific LAMP primer set produced a positive signal only for its target Plasmodium species, while showing negative results for all other non-target pathogens. No non-specific amplification was observed in the cross-reactivity test. This demonstrates that the LAMP detection method possesses both high specificity and accuracy, and can be used for the precise differential diagnosis of the four Plasmodium species.

[0057] Example 4: Sensitivity characterization of five LAMP primer sets, including Pan primers. The sensitivity characterization of the LAMP detection method described in this invention for Plasmodium is as follows:

[0058] Recombinant plasmids containing Plasmodium gene fragments corresponding to the five sets of LAMP-specific primers (see Table 1) were obtained. Plasmid pUC57 was used as the base vector. This part was completed by the company. The copy number of the target gene in the plasmid was calculated using the following formula: MW = DNA length × 660 dalton / bp = dalton = g / mol

[0059] Copy number concentration = (6.02 × 10) 23 )×(plasmid concentration ng / μL×10 -6 ) / MW = copies / μL

[0060] Among them, DNA length represents the total number of plasmid bases containing the target gene.

[0061] The four specific Plasmodium target recombinant plasmids obtained above were serially diluted 10-fold with nuclease-free water. After absolute quantification, the plasmids with a copy number of 10 were selected. 5 copies / μL to 10 0 Copies / μL were used as a template to verify the analytical sensitivity, and negative controls and repeated experiments were set up to verify the analytical sensitivity of the visualized LAMP (see Figure 4).

[0062] As shown in Figure 4, the detection method of this invention achieves a limit of detection (LOD) of 10 for all four types of Plasmodium parasites. 3 With copies / μL, the detection sensitivity of the pan primer can reach 10 copies / μL. 2 Specifically, when the template concentration is ≥10 copies / μL. 3 At a template concentration of ≥10 copies / μL, characteristic fluorescence signal enhancement and a significant color change from purplish-red to pale yellow were observed in all detections of the four Plasmodium species; when the template concentration was ≥10 2 At a concentration of copies / μL, the Pan primer group showed a significant increase in characteristic fluorescence signal and a marked color change from purplish-red to pale yellow in all detections of Plasmodium. Real-time fluorescence monitoring revealed a good linear relationship between template concentration and amplification time (Ct value), and consistent results from multiple replicate experiments also demonstrated that this method has excellent detection repeatability and stability.

[0063] Table 1. Detection sequences corresponding to primer sets on Plasmodium 18S rRNA.

[0064]

Claims

1. A primer set for identifying the genus and species of Plasmodium, characterized in that: The primer sets consist of primer sets for the genus Plasmodium and primer sets specific to each Plasmodium species; among them, the primer set for the genus Plasmodium (Pan-Plasmodium(Pan)) contains sequence information (5'-3'). FIP: AGCTATTTCTCAGGCTCCCTCTAACATGGCTATGACGGGT; BIP: CCACATCTAAGGAAGGCAGCACCTTGTATTGTTATTTCTTGTCACT; F3: TGATGTAGGGTATTGGCC; B3: CCAATTACAAAAACCATGAAATGG; LF:GGAATCGAACTCTAATTCCCCGTT; LB: GGCCGGTAAATTACCCAATTCTAAA.

2. The primer set for identifying Plasmodium species according to claim 1, characterized in that: The Plasmodium species mentioned are Plasmodium falciparum (Pf), Plasmodium vivax (Pv), Plasmodium malariae (Pm), and Plasmodium ovale (Po), and the species-specific primer sets for each Plasmodium species are shown below:

3. An application of the primer set according to claim 1, characterized in that: Application of the primer set in the identification of malaria species and genera.

4. A method for detecting Plasmodium species and genus using the primer set described in claim 1, characterized in that: Using the blood sample to be tested as a template, the primer set of Plasmodium in the primer set of claim 1 is used for amplification in the LAMP colorimetric reaction system. The characteristic fluorescence signal of the amplification product increases and the color of the reaction solution changes from purple-red to light yellow. The sample is the sample carrying Plasmodium. The samples carrying malaria parasites were further amplified in a LAMP colorimetric reaction system using the interspecific primer sets for each malaria parasite in the primer set of claim 1. The amplified products showed a characteristic increase in fluorescence signal and a change in the color of the reaction solution from purplish-red to pale yellow. The amplified products with a 311bp band were identified as Plasmodium falciparum; those with a 306bp band were identified as Plasmodium vivax; those with a 291bp band were identified as Plasmodium malariae; and those with a 256bp band were identified as Plasmodium ovale, thus achieving interspecific differentiation of the samples.

5. The method for detecting Plasmodium species and genus using primer sets according to claim 4, characterized in that: The LAMP colorimetric system was constructed as follows: the total volume of the reaction system was 15 μL, containing 4.8 μL buffer, 0.8 μL 100 mM mixture of LAMP primers for each Plasmodium parasite, 2.1 μL 10 mM dNTPs, 0.6 μL 1.2 mM EBT, 0.3 μL 1 mM phenol red, 0.6 μL Bst 2.0 DNA polymerase (8000 U / mL), 0.5 μL Eva Green (20×), 1.2 μL 10 mM MgSO4, 3.1 μL nuclease-free water, and 1 μL template.

6. The method for detecting Plasmodium species and genus using primer sets according to claim 5, characterized in that: The buffer solution is prepared by mixing 8 μL of 1M KOH, 10 μL of 1M (NH4)2SO4, 25 μL of 2M KCl, 1 μL of Tween 20 with 280 μL of nuclease-free water and storing at -20°C until use.

7. The method for detecting Plasmodium species and genus using primer sets according to claim 5, characterized in that: The LAMP primer mixtures for each Plasmodium species were prepared by using 5 μL of 100 μM F3 / B3, 40 μL of 100 μM FIP / BIP, and 20 μL of 100 μM LF / LB, respectively.

Images