Ketoreductase mutant and application thereof in preparation of (R)-1-(3, 5-dichloropyridine-4-substituted) ethanol

The preparation of (R)-1-(3,5-dichloropyridine-4-substituted)ethanol by catalyzing 1-(3,5-dichloropyridine-4-substituted)ethanol under mild conditions using the ketone reductase mutant Mut1 solves the problems of complex operation and dangerous reagent use in existing technologies, and realizes efficient and safe industrial production.

CN121046338APending Publication Date: 2025-12-02SYNCOZYMES SHANGHAI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410693529.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-05-31
Publication Date
2025-12-02

AI Technical Summary

Technical Problem

Existing techniques for preparing (R)-1-(3,5-dichloropyridine-4-substituted)ethanol are cumbersome and involve the use of the hazardous reagent borane, making them unsuitable for industrial production.

Method used

A ketone reductase mutant, Mut1 (T42L/A120K/P166S), was developed and expressed in Escherichia coli, yeast, or Streptomyces through genetic engineering. The ketone reductase mutant was used to catalyze the conversion of 1-(3,5-dichloro-4-pyridyl)acetone to (R)-1-(3,5-dichloropyridin-4-substituted)ethanol under mild conditions, with the aid of coenzyme NADP+ and hydrogen donor glucose. The reaction pH and solvent were optimized to be n-heptane.

Benefits of technology

It achieves a high catalytic conversion rate of ≥98% and an optical purity ee value of ≥98%, making it suitable for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004869009580000011
    Figure BDA0004869009580000011
  • Figure BDA0004869009580000012
    Figure BDA0004869009580000012
  • Figure BDA0004869009580000031
    Figure BDA0004869009580000031
Patent Text Reader

Abstract

The invention discloses a ketoreductase mutant and an application of the ketoreductase mutant in preparation of (R)-1-(3, 5-dichloropyridine-4-substituted) ethanol. The ketoreductase mutant disclosed by the invention can be used for selectively reducing 1-(3, 5-dichloro-4-pyridyl) ethanone to obtain (R)-1-(3, 5-dichloropyridine-4-substituted) ethanol, the substrate concentration can reach 30 g / L, the conversion rate is greater than or equal to 98%, the ee value is greater than or equal to 98%, and the method is simple to operate and mild in reaction condition, and can be used for industrial production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical fields:

[0001] This invention belongs to the field of biocatalysis technology, specifically relating to a ketone reductase mutant and its application in the preparation of (R)-1-(3,5-dichloropyridine-4-substituted)ethanol. Background technology:

[0002] (R)-1-(3,5-dichloropyridine-4-substituted)ethanol, with the structure shown in Formula I and CAS number 1254473-68-1, is an important pharmaceutical intermediate.

[0003]

[0004] The preparation route of compound I disclosed in patent CN103819396B is shown in Scheme 1. This route uses 1-(3,5-dichloro-4-pyridyl)acetone as a substrate and an S-2-methyl-CBS-oxazolium borane and borane dimethyl sulfide complex as a catalyst. The reaction is first carried out at -10°C for 12 hours, then heated to room temperature and methanol is added dropwise. The temperature is then further increased to 70°C and refluxed for 3 hours. This method is cumbersome and uses the hazardous reagent borane, making it unsuitable for industrial production.

[0005]

[0006] Therefore, we need to develop a preparation method that is simple to operate, safe, environmentally friendly, and suitable for industrialization. Summary of the Invention:

[0007] The purpose of this invention is to address the shortcomings of existing technologies by providing a ketone reductase mutant for the preparation of (R)-1-(3,5-dichloropyridine-4-substituted)ethanol.

[0008] On the one hand, the present invention provides a novel ketone reductase mutant, which is obtained by site mutation using the amino acid sequence of the wild-type ketone reductase shown in SEQ ID NO.1 as a reference sequence.

[0009] Furthermore, the wild-type ketone reductase is derived from *Sporobolomyces salmonicolor*, with the wild-type template having NCBI accession number Q9UUN9.3, and its amino acid and nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0010] Furthermore, the wild-type ketone reductase was mutated by changing threonine (Thr) at position 42 to leucine (Leu), alanine (Ala) at position 120 to lysine (Lys), and proline (Pro) at position 166 to serine (Ser), to obtain the ketone reductase mutant Mut1 (T42L / A120K / P166S).

[0011] Furthermore, the amino acid sequence and nucleotide sequence of the ketone reductase mutant are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0012] Furthermore, the ketone reductase is expressed in genetically engineered bacteria.

[0013] Furthermore, the ketone reductase expression strain is selected from Escherichia coli, yeast, Streptomyces or Bacillus subtilis, with Escherichia coli being preferred.

[0014] On the other hand, the present invention provides a method for preparing (R)-1-(3,5-dichloropyridin-4-substituted)ethanol using ketoreductase. This method uses 1-(3,5-dichloro-4-pyridyl)acetone as a substrate, which is converted to (R)-1-(3,5-dichloropyridin-4-substituted)ethanol under the catalysis of a ketoreductase mutant, as shown in Scheme 2.

[0015]

[0016] Furthermore, the ketone reductase is selected from the ketone reductase mutant Mut1.

[0017] Furthermore, the ketone reductase participates in the catalytic reaction in the form of ketone reductase powder, ketone reductase solution, ketone reductase homogenate, or cells containing ketone reductase, with ketone reductase cells being preferred.

[0018] Furthermore, coenzymes can be added to the reaction system to promote the reaction. When using cells containing ketone reductase, the cells already contain a small amount of coenzyme, so adding coenzymes may not be necessary. In some cases, the prepared ketone reductase powder also contains a small amount of coenzyme, so adding coenzymes may also be unnecessary. However, coenzymes can also be added to the reaction system to further promote the reaction. When coenzymes are added to the reaction system to promote the reaction, the coenzyme is selected from NAD+. + NADH, NADP+, NADPH, or combinations thereof, preferably NADP + .

[0019] Furthermore, the concentration of added coenzyme is 0.02–0.4 g / L, preferably 0.04–0.2 g / L.

[0020] Furthermore, the coenzymes used in this technical solution are all selected from coenzyme products sold by Shangke Biomedical (Shanghai) Co., Ltd.

[0021] Furthermore, the reaction requires the addition of a hydrogen donor, which is selected from glucose, ethylene glycol, isopropanol, and sec-butanol, with glucose being preferred.

[0022] Furthermore, the reaction requires the addition of an organic solvent, which is selected from dimethyl sulfoxide, methanol, ethanol, ethylene glycol, isopropanol, sec-butanol, methyl tert-butyl ether, acetonitrile, acetone, ethylene glycol monomethyl ether, toluene, n-hexane, and n-heptane, preferably n-hexane and n-heptane.

[0023] Furthermore, the reaction needs to be controlled at a pH of 5.0–9.0, preferably 7.5–8.5.

[0024] The beneficial effects of this invention are that it provides a novel ketone reductase mutant that can efficiently catalyze the conversion of 1-(3,5-dichloro-4-pyridyl)acetone to (R)-1-(3,5-dichloropyridin-4-substituted)ethanol, with a substrate concentration of up to 30 g / L, a conversion rate of ≥98%, and a product ee value of ≥98%. This method is simple to operate, has mild reaction conditions, and can be used for industrial production. Attached image description:

[0025] Figure 1 Electrophoresis diagram of ketone reductase gene in Example 2

[0026] Figure 2 Electrophoresis diagram of ketone reductase expression in Example 2

[0027] Figure 3 Example 7: HPLC chromatogram of substrate transformation

[0028] Figure 4 Chiral HPLC chromatogram of reference standard

[0029] Figure 5 Example 7: Chiral HPLC Analysis Chromatogram Detailed implementation method:

[0030] The technical content of the present invention will be further described below with reference to specific embodiments, in order to better understand the content of the present invention, but the scope of protection of the present invention is not limited thereto.

[0031] Example 1: Preliminary screening of ketoreductases

[0032] Glucose dehydrogenase powder and glucose powder were dissolved in purified water and pipetteed into KRED enzyme plates (Shanghai Shangke Biomedical Co., Ltd.), 90 μL per well. Substrate was weighed and dissolved in DMSO to prepare a 100 g / L stock solution, which was then pipetteed into KRED enzyme plates, 10 μL per well, for screening at a substrate concentration of 10 g / L. The enzyme plates were placed in a shaker at 30°C for 48 hours. After the reaction, HPLC analysis was performed. The results showed that the Ss-KRED enzyme derived from *Sporobolomyces salmonicolor* produced 31.0% of the product, with an ee value of 42.6%. Further directed evolution modification of this enzyme is planned.

[0033] Example 2: Induced expression of wild-type Ss-KRED

[0034] The Ss-KRED monoclonal strain was used in a container containing Kan + Overnight, cells were incubated upside down on resistant LB agar plates. Single-clonal cells that grew on the plates were selected, and gene amplification was performed on the single clones using universal primers on the vector. The electrophoretic amplification bands are shown in the figure. Figure 1 All monoclonal clones contained exogenous genes of the same size as theoretically possible, thus allowing for further downstream protein expression.

[0035] The monoclonal cells were transferred to 5 mL of LB medium and cultured overnight at 37°C. The cultured seed culture was then transferred at an inoculum rate of 1.5% to cells containing Kansas. + Cells were cultured in resistant 2YT medium at 37°C until the biomass OD... 600 When the value reached approximately 0.8, IPTG induction was performed, the temperature was lowered to 25℃, and after 16 hours of expression, bacterial cells were collected. Cell disruption was achieved using sonication, followed by electrophoretic analysis. Results are shown below. Figure 2 The protein size was consistent with expectations, and it showed good soluble expression.

[0036] Example 3 Construction of mutants

[0037] To quickly screen for highly selective mutants, a random mutagenesis strategy is adopted, that is, by adjusting Mn 2+Concentration and construction of a gene mutant library. Using 50 ng of the recombinant gene sequence pET28a-Ss-IRED as a template, the PCR reaction system consisted of: 20 pmol of T7 and T7-ter primers (see Table 1), 0.25 mM MnCl2, 0.2 mmol / L dNTPs, 10 μL of 10X PCR buffer, and 4 U of dreamTaq DNA polymerase. The PCR program was as follows: 98℃ pre-denaturation for 2 min, each cycle consisting of 98℃ denaturation for 1 min, 55℃ annealing for 25 s, and 72℃ extension for 2 min, for a total of 25 cycles; and a final derivatization at 72℃ for 5 min.

[0038] Table 1 Primers for amplifying the target gene

[0039] Primer name Sequence information (5'-3') T7-primer TAATACGACTCACTATAGGG T7-ter-primer TGCTAGTTATTGCTCAGCGG

[0040] After purification by agarose gel electrophoresis, the PCR products were digested with restriction endonucleases NdeI and EcoRI, purified again, and ligated with the pET-28a vector digested with the same restriction endonucleases using T4 DNA ligase. The ligated vector was then transformed into E. coli competent cells BL21(DE3) and incubated at 37°C for 1 hour before being directly plated onto cells containing Kansas. + On resistant solid culture medium, inverted culture for 16 hours, approximately 100 single clones grew on each plate.

[0041] Wild-type KRED cells and monoclonal cells obtained after saturation mutation were picked and cultured in 96-well plates, each containing 500 μL of LB medium. After culturing at 37°C for 16 h, 50 μL of seed culture per well was transferred to a 96-well plate and cultured at 37°C for 8 h. Then, IPTG was added to each well for induction, and the culture temperature was lowered to 25°C for another 12 h. The cells were then collected by centrifugation and frozen at -80°C for 3 h. After freezing, the cells were removed and substrate was added to each well for screening. After shaking at 30°C for 48 h, the mutants were analyzed by TLC. Similar methods were used to screen for other sites, and finally, the mutant Mut 1 (T42L / A120K / P166S) was obtained. This mutant can catalyze 10 g / L of substrate with a conversion rate of 59.0% and an ee value of 63.5%.

[0042] Example 4: Reaction System Optimization - Hydrogen Donor

[0043] When glucose was used as the hydrogen donor, 0.1 g of substrate, 1 mL of PBS-K (pH 7.0, 1 M), 2 mg of NADP powder, 0.2 g of mutant cells, 8 mL of water, 0.2 g of glucose powder, 1 mL of DMSO, and 0.05 g of GDH enzyme powder (Shanghai Shangke Biopharmaceutical Co., Ltd.) were added to the reactor sequentially. When isopropanol, ethylene glycol, and sec-butanol were used as the hydrogen donors, 0.1 g of substrate, 1 mL of PBS-K buffer (pH 7.0, 1 M), 2 mg of NADP powder, 0.2 g of mutant cells, 8 mL of water, and 1 mL of hydrogen donor solution were added to the reactor sequentially. The reaction system was stirred at 30 °C for 48 h, and samples were taken for HPLC analysis. The results are shown in Table 2. When glucose was used as the hydrogen donor, the conversion rate and ee value were the best.

[0044] Table 2 Optimization of hydrogen donors

[0045] Serial Number hydrogen donor Conversion rate (%) ee value (%) 1 glucose 73.0 85.2 2 Isopropanol 59.3 63.6 3 Ethylene glycol 6.6 2.71 4 sec-butanol 18.7 40.0

[0046] Example 5 Reaction System Optimization - pH

[0047] 0.1 g substrate, 1 mL PBS-K buffer, 2 mg NADP powder, 0.2 g mutant cells, 8 mL water, 0.2 g glucose powder, 1 mL DMSO, and 0.05 g GDH enzyme powder (Shanghai Shangke Biopharmaceutical Co., Ltd.) were added sequentially to the reaction vessel. The reaction temperature was 30 °C, and the reaction was carried out under different pH conditions, with the pH range set to 5.0–9.0. After 48 h of reaction, samples were taken for HPLC analysis. The results are shown in Table 3. The conversion rate and ee value were optimal when the pH was 8.0.

[0048] Table 3 pH optimization

[0049]

[0050]

[0051] Example 6 Reaction System Optimization - Organic Solvent

[0052] Add 0.1g of substrate and 1mL of PBS-K buffer (pH 10) sequentially to the reaction vessel.

[0053] The reaction mixture consisted of 8.0 (1M), 2 mg NADP powder, 0.2 g mutant cells, 8 mL water, 0.2 g glucose powder, 0.05 g GDH enzyme powder (Shanghai Shangke Biopharmaceutical Co., Ltd.), and 1 mL of various organic solvents, including dimethyl sulfoxide, methanol, ethanol, ethylene glycol, isopropanol, sec-butanol, methyl tert-butyl ether, acetonitrile, acetone, ethylene glycol monomethyl ether, toluene, n-hexane, and n-heptane. After stirring at 30 °C for 48 h, samples were taken for HPLC analysis. The results are shown in Table 4. The conversion rate and ee value were optimal when n-heptane was used as the organic solvent.

[0054] Table 4 Optimization of Organic Reagents

[0055] Serial Number Organic reagents Conversion rate (%) ee value (%) 1 Dimethyl sulfoxide 90.1 90.4 2 methanol 21.6 82.34 3 ethanol 18.2 81.64 4 Ethylene glycol 43.6 88.72 5 Isopropanol 59.2 60.39 6 sec-butanol 10.5 79.02 7 Methyl tert-butyl ether 7.1 79.46 8 Acetonitrile 3.6 53.24 9 acetone 2.0 70.23 10 Ethylene glycol monomethyl ether 30.4 79.15 11 Toluene 20.6 89.46 12 n-Hexane 90.0 87.93 13 n-Heptane 99.6 99.7

[0056] Example 7 Reaction System Optimization - Substrate Concentration

[0057] 1 mL of PBS-K buffer (pH 8.0, 1 M), 2 mg of NADP solid powder, 0.2 g of mutant cells, 8 mL of water, 0.2 g of glucose powder, 1 mL of n-heptane, 0.05 g of GDH enzyme powder (Shanghai Shangke Biopharmaceutical Co., Ltd.), and substrate were added sequentially to the reaction vessel. The substrate amounts were 0.1 g, 0.2 g, and 0.3 g, respectively. After stirring the reaction system at 30 °C for 48 h, samples were taken for HPLC analysis. The results showed that when the substrate concentration was 30 g / L, the conversion rate and ee value could still reach 99%. The HPLC chromatogram of substrate conversion is shown in [Figure number missing]. Figure 3 As shown, the chiral HPLC chromatogram of the reference standard is shown in [reference image]. Figure 4 As shown, the HPLC chromatogram of the product's chiral purity is shown in [reference needed]. Figure 5 As shown.

[0058] Table 5 Optimization of substrate concentration

[0059] Serial Number Substrate concentration (g / L) Conversion rate (%) ee value (%) 1 10 99.9 99.9 2 20 99.8 99.9 3 30 98.9 98.5 4 40 85.5 89.2

Claims

1. A ketone reductase mutant, characterized in that, The amino acid and nucleotide sequences of the ketone reductase mutant are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively.

2. The ketone reductase mutant as described in claim 1, characterized in that, The ketone reductase mutant was expressed in genetically engineered bacteria.

3. A method for preparing (R)-1-(3,5-dichloropyridine-4-substituted)ethanol, characterized in that, 1-(3,5-dichloro-4-pyridyl)acetone is converted to (R)-1-(3,5-dichloropyridin-4-substituted)ethanol under the catalysis of a ketone reductase mutant, wherein the ketone reductase mutant is selected from the ketone reductase mutant of claim 1.

4. The preparation method according to claim 3, characterized in that, The ketone reductase participates in the catalytic reaction in the form of ketone reductase powder, ketone reductase clear solution, ketone reductase homogenate, or cells containing ketone reductase.

5. The preparation method according to claim 3, characterized in that, The reaction requires the addition of a hydrogen donor, which is selected from glucose, ethylene glycol, isopropanol, and sec-butanol.

6. The preparation method according to claim 3, characterized in that, The reaction requires the addition of an organic solvent, which is selected from dimethyl sulfoxide, methanol, ethanol, ethylene glycol, isopropanol, sec-butanol, methyl tert-butyl ether, acetonitrile, acetone, ethylene glycol monomethyl ether, toluene, n-hexane, and n-heptane.

7. The preparation method according to claim 3, characterized in that, The reaction is carried out at a pH of 5.0 to 9.0.

Citation Information

Patent Citations

  • A method for synthesizing chiral 1-(3,5-dichloropyridin-4-yl)-ethanol

    CN103819396B