Application of corn nitrogen utilization related gene ZmbZIP75

Abstract

The invention relates to the technical field of crop molecular biology, in particular to application of a ZmbZIP75 gene in efficient utilization of plant nitrogen, which comprises the following steps: measuring the contents of five amino acids (glutamic acid, glutamine, aspartic acid, asparagine and lysine) of the overground part of a corn inbred line under the conditions of low nitrogen and normal nitrogen, and determining the content of five amino acids in the overground part of the corn inbred line by taking the change rate of the aspartic acid content as an index; through whole genome association analysis, a candidate gene ZmbZIP75 is identified. According to the research, related genes are knocked out and overexpressed in a corn wild-type plant, and a corresponding experimental method is used for detecting that the low nitrogen resistance of the transgenic plant is improved compared with that of the wild-type plant, so that the research is provided for researching a molecular mechanism of the corn responding to low nitrogen stress and a main effect factor influencing main physiological and biochemical processes of the corn. Furthermore, high-quality gene resources related to low nitrogen are explored, and a certain theoretical basis is provided for further improving the low nitrogen resistance of the corn and efficiently utilizing new varieties of nitrogen.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and molecular biology, and specifically to the application of the maize nitrogen utilization-related gene ZmbZIP75. Background Technology

[0002] Maize is an important food crop, and nitrogen is a crucial factor limiting its growth, development, and yield. However, excessive application of nitrogen fertilizer not only increases economic costs but also causes serious environmental pollution. Therefore, improving nitrogen use efficiency in crops while reducing inputs is urgently needed. Amino acids are products of primary metabolism and are the foundation of various crop quality traits; their synthesis is regulated by multiple quantitative trait loci. Among them, aspartic acid, as an important nitrogen carrier in plants, plays a vital role in nitrogen assimilation. Previous studies have found significant differences in the responses of different maize inbred lines to nitrogen stress, but the underlying important genetic variation loci remain to be explored.

[0003] Corn is one of the world's three major food crops, and nitrogen is essential for its growth and development, playing a crucial role in increasing yield. In the past few decades, large amounts of nitrogen fertilizer have been applied to boost crop yields. However, only 30%-40% of the applied nitrogen fertilizer is absorbed and utilized by crops, with the majority being lost into the environment, causing severe environmental pollution. Nitrogen assimilation is an important process in nitrogen metabolism. Nitrogen assimilation in plants refers to the assimilation of inorganic nitrogen (NO3). - NH4 + Nitrogen assimilation (N2) is the process by which nitrogen is ultimately converted into nitrogen-containing organic compounds (amino acids, nucleotides, etc.) within plants through various reactions. Nitrogen assimilation is generally classified into three types: primary nitrogen assimilation, re-assimilation of ammonia during photorespiration, and cyclic re-assimilation of nitrogen. Based on this, more attention is paid to the metabolism of glutamate (Glu), glutamine (Gln), aspartic acid (Asp), and asparagine (Asn), as they are the main components of free amino acids in most crops. Lysine (Lys) is classified as an important essential amino acid because it cannot be synthesized by humans and other animals. It can be synthesized through the aspartic acid pathway in plants, and its breakdown can generate Glu.

[0004] Breeding is the most direct and fundamental method to improve nitrogen use efficiency in maize. Traditional hybridization breeding not only has a long breeding cycle but also lacks a clear understanding of the mechanisms of target genes. By constructing CRISPR / Cas9 materials, the desired breeding materials can be obtained quickly through targeted and site-specific editing of target genes. Therefore, clarifying gene function, location, and structure is crucial for constructing CRISPR / Cas9 materials. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the purpose of this invention is to provide an application for the nitrogen utilization-related gene ZmbZIP75 in maize. By constructing materials with this gene knocked out, the function of this gene under low-nitrogen conditions can be clarified.

[0006] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows:

[0007] Application of reduced or absent expression of the nitrogen use-related gene ZmbZIP75 in maize in plant resistance to low nitrogen stress.

[0008] Application of reduced or absent expression of the nitrogen-use-related gene ZmbZIP75 in nitrogen-efficient plant breeding.

[0009] Methods to enhance plant resistance to low nitrogen stress

[0010] The maize ZmbZIP75 gene was weakened using genetic engineering techniques; the weakening included knocking out or reducing the expression of the ZmbZIP75 gene.

[0011] According to the above application or method, its nucleotide sequence is shown in SEQ ID NO.1.

[0012] According to the above application or method, the amino acid sequence of the protein encoded by the maize ZmbZIP75 gene is shown in SEQ ID NO.2.

[0013] Preferably, CRISPR / Cas gene editing technology is used to mutate the maize ZmbZIP75 gene, resulting in the loss of function of the corresponding gene.

[0014] Preferred breeding methods include designing gRNA sequences; amplifying, recovering, and constructing vectors; transferring Agrobacterium; and infecting plants.

[0015] Preferably, the sequence of the gRNA action site is 5'-GCGCTGTATACCCGGTGAT-3'.

[0016] Preferably, primers with sequences SEQ ID NO.6 and SEQ ID NO.7 are used for amplification to construct the vector.

[0017] The expression vector ZmbZIP75-pBUE411C for the low nitrogen tolerance gene in maize is obtained by ligating the fragment shown in SEQ ID NO.1 to the vector pBUE411C.

[0018] The beneficial effects of this invention are:

[0019] The application of the ZmbZIP75 protein and its encoding gene provided by this invention provides new germplasm resources for breeding nitrogen-efficient maize varieties, and at the same time lays a certain theoretical foundation for studying plant low nitrogen response and improving plant nitrogen use efficiency. Attached Figure Description

[0020] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the embodiments of the invention to explain the invention and do not constitute a limitation thereof.

[0021] Figure 1 Manhattan plot and QQ plot for the rate of change of Asp content in the aboveground parts of the population;

[0022] Figure 2 ZmbZIP75 Crispr Schematic diagram of material sequence alignment

[0023] Figure 3 For ZmbZIP75 OE The expression levels of the ZmbZIP75 gene in three materials and wild-type maize were detected, with the Ubiquitin gene in maize used as an internal control.

[0024] Figure 4 ZmbZIP75 Crispr Sand culture phenotypes of materials under normal-nitrogen (NN) and low-nitrogen (LN) treatments Detailed Implementation

[0025] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0026] The main reagents used in the following examples were: Taq DNA polymerase, T4 ligase, and high-fidelity DNA polymerase were purchased from Novizan Biotechnology Co., Ltd. (Nanjing); plasmid miniprep kit and agarose gel extraction kit were purchased from Tiangen Biotech (Beijing) Co., Ltd.; agar powder, agarose, ampicillin (Amp), kanamycin (Kan), rifampin (Rif), and other antibiotics, as well as glucose, BSA, LB medium, etc., were purchased from Sigma, Bio-Rad, etc.; and all other chemical reagents used in the examples were imported or domestically produced analytical grade reagents.

[0027] Example 1: Screening of nitrogen-efficient genes

[0028] The statistical results of the contents of Glu, Gln, Asp, Asn and Lys in the aboveground parts of 349 B73 maize inbred lines under different nitrogen treatments were collected and the change rate was calculated. Combined with the known population genotype data, GWAS analysis was performed using TASSEL 3.0 software. The program successively generated Manhattan plots and QQ plots (i.e., quantile plots) of the five amino acids under low nitrogen, normal nitrogen and change rate conditions. A threshold line parallel to the horizontal axis was plotted when the y-value was 5.6.

[0029] Phenotypic data of the rate of change in aspartic acid (Asp) content in maize inbred line populations were analyzed to screen and identify nitrogen utilization-related genes. Transgenic maize seeds were obtained from the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University for phenotypic verification, ultimately identifying genes located on chromosome 8, -log 10 A candidate gene within a 40kb interval with a p-value of 7.43, such as Figure 1 The figures show Manhattan and QQ plots of the change rate of Asp content in the aboveground parts of a maize inbred line population. The highest point circled in red is the SNP site that selected the ZmbZIP75 candidate gene.

[0030] The nucleotide sequence of the maize ZmbZIP75 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.2. Its accession number in the maize genome database is GRMZM2G168079. The maize ZmbZIP75 gene consists of 4690 bases, with the reading frame of the T01 transcript extending from base 352 to 1590 at the 5′ end. This gene contains five exons, located at bases 1 to 271, 272 to 1395, 1396 to 1467, 1468 to 1497, and 1498 to 1886 of the transcript.

[0031] SEQ ID NO.1

[0032]

[0033] SEQ ID NO.2

[0034]

[0035] Example 2: Construction and Detection of ZmbZIP75 Gene CRISPR / Cas9 Material

[0036] The method for constructing ZmbZIP75 material includes the following steps:

[0037] 1) Based on the coding region sequence of the ZmbZIP75 gene, candidate target sequences were designed and screened using the website http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html. The target sequences were located within or upstream of the conserved functional domain of the CDS and had a GC content between 45% and 75%.

[0038] 2) Use the CRISPR-RGEN-Tools website (http: / / www.rgenome.net / cas-offinder / ) to perform off-target analysis on candidate target sequences, and further screen and determine the optimal specific target sequences with low potential off-target rates and no impact on other gene coding regions.

[0039] 3) Using the candidate target sequence as the target, design specific primers upstream and downstream of it, use the genomic DNA of the recipient material as a template to amplify the target gene, and verify the PCR product by sequencing. If there are differences, correct the target sequence and perform off-target analysis again. Finally, select the optimal target sequence for vector construction.

[0040] Based on the coding region sequence analysis of the ZmbZIP75 gene, the gRNA target sequence of ZmbZIP75 was found in the second exon by querying the data management system of the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University. Primers were designed based on the gRNA sequence to identify whether it was homozygous.

[0041] The gRNA sequence is 5'-GCGCTGTATACCCGGTGAT-3' (SEQ ID NO.3), and the vector used is the pBUE411C vector from the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University.

[0042] 4) After the vector was constructed and sequenced, it was transformed into Agrobacterium strain EHA105. The Agrobacterium was used to infect maize embryos to obtain mutant-positive seedlings. Homozygous mutant materials were obtained through self-crossing and sequencing.

[0043] Primers were designed based on the target, and CRISPR / Cas9 targeting vectors (CRISPR / Cas9 gene editing vectors) were constructed through operations such as PCR, enzyme digestion, and ligation.

[0044] The construction method of the CRISPR / Cas9 gene editing vector is as follows: The primers used are as follows:

[0045] F: 5'-GGCGGCGCTGTATACCCGGTGAT-3' (SEQ ID NO.4)

[0046] R: 5'-AAACATCACCGGGTATACAGCGC-3' (SEQ ID NO.5)

[0047] (1) Annealing: Dilute the above primers to 10 μM and perform gradient annealing to anneal them into double strands to obtain annealed fragments with enzyme sites on the primers.

[0048] (2) Vector digestion: The vector was digested according to the reaction system and reaction procedure shown in Table 1 to obtain the digested vector.

[0049] Table 1. Vector enzymatic digestion reaction system and reaction conditions

[0050]

[0051]

[0052] (3) Ligation: The enzyme digestion vector obtained in step (2) and the annealed fragment in step (1) are ligated according to the reaction system and reaction procedure shown in Table 2 to obtain the product of the enzyme digestion-ligation system. Table 2

[0053]

[0054] (4) Take 5 μl of the enzyme digestion-ligation system product obtained in step (3) and transform it into competent E. coli cells. Screen positive clones on LB plates containing 50 μg / mL kanamycin, identify single clones by colony PCR, select positive clones for sequencing, and obtain the CRISPR / Cas9 gene editing vector for ZmbZIP75 gene mutation.

[0055] The primers used for colony PCR are as follows:

[0056] F: 5'-GGCGGCGCTGTATACCCGGTGAT-3' (SEQ ID NO.6)

[0057] R: 5'-AAACATCACCGGGTATACAGCGC-3' (SEQ ID NO.7)

[0058] The sequencing primers are as follows:

[0059] OsU3-FD3: 5'-GACAGGCGTCTTCTACTGGTGCTAC-3' (SEQ ID NO.8)

[0060] The correctly sequenced CRISPR / Cas9 gene-editing vector constructed in Example 1 was transformed into competent Agrobacterium EHA105 strain using the heat shock method, and positive clones were obtained by colony PCR identification. Single colonies of the correctly identified Agrobacterium were inoculated into 2-3 mL of liquid medium containing 100 μg / mL kanamycin and 50 μg / mL rifampin, and cultured overnight at 28°C with shaking. The next day, the colonies were transferred to a large volume of liquid medium containing antibiotics and cultured with shaking. After several transfers, the bacterial cells were collected and resuspended until the OD600 was between 0.8 and 1.0. After infecting B73 maize embryos extracted under aseptic conditions, callus formation was induced. Transgenic positive plants were identified by PCR amplification and sequencing of gene fragments, including the target site. Finally, three candidate gene knockout materials for ZmbZIP75 (named ZmbZIP75) were obtained. crispr -1, ZmbZIP75 crispr -2 and ZmbZIP75 crispr -3), sequencing results showed that three homozygous mutant transgenic lines were obtained, such as Figure 2 .

[0061] The PCR procedure is as follows:

[0062]

[0063] (Srep 2-Step 4, repeat 37 times)

[0064] The primer sequences are designed as follows:

[0065] ZmbZIP75-F:TGGAGGACTTCCTCGTGAA(SEQ ID NO.9)

[0066] ZmbZIP75-R:AATACGCAAAGAGCACGAAA(SEQ ID NO.10)

[0067] PCR amplification and sequencing were performed using the primers described above. The results showed that ZmbZIP75... Crspr The mutation in material -1 is the insertion of a T base at position 817 of the second exon of this gene, while ZmbZIP75 Crispr -2 and ZmbZIP75 Crispr All three materials had missing fragments of varying sizes, including ZmbZIP75. Crispr 2 represents a 49bp deletion at positions 778-826 of the second exon of this gene, ZmbZIP75. Crispr 3 represents a 5bp deletion at positions 813-817 of the second exon of this gene, such as... Figure 2 As shown.

[0068] The protein sequences of all three mutant materials experienced premature termination. Among them, ZmbZIP75... Crispr- The material undergoes a sequence change starting from the 247th amino acid, ZmbZIP75 Crispr -2 The sequence of material changes starting from the 235th amino acid, ZmbZIP75 Crispr -3 The material undergoes a sequence change starting from the 245th amino acid, such as Figure 2 As shown.

[0069] Example 3 Detection of ZmbZIP75 gene overexpression materials

[0070] Under normal nutritional conditions, ZmbZIP75 is cultivated. OE -1, ZmbZIP75 OE -2, ZmbZIP75 OE RNA was extracted from the aboveground parts of three overexpression materials and wild-type materials during the seedling stage for real-time quantitative PCR. ZmbZIP75 was used in this study. OE -1, ZmbZIP75 OE -2, ZmbZIP75 OE -3 All materials were provided by the Crop Functional Genomics and Molecular Breeding Center of China Agricultural University.

[0071] The primer sequences are:

[0072] bZIP75-Fo:ATGATCAAGAACCGCGAGT(SEQ ID NO.11)

[0073] bZIP75-Ro:TTCTCCACCAGCATCTTTTC(SEQ ID NO.12)

[0074] ZmUBI-F:TGGTTGTGGCTTCGTTGGTT(SEQ ID NO.13)

[0075] ZmUBI-R:GCTGCAGAAGAGTTTTGGGTACA(SEQ ID NO.14)

[0076] Using Polymer's 2×Realtime PCR Super mix, three replicates were made for each sample, as follows:

[0077]

[0078] The program settings for the real-time quantitative PCR instrument are as follows:

[0079]

[0080] (Repeat Step 2-Step 3 40 times)

[0081] The expression level of the ZmbZIP75 gene in wild-type materials was normalized, and ZmUBI was used as an internal reference gene. A bar chart of the relative expression level of the ZmbZIP75 gene was obtained, as shown below. Figure 3 As shown in the figure, the expression level of the ZmbZIP75 gene is low in the wild type, and the fold increase of the ZmbZIP75 gene in the three overexpression materials is 4000-5000 times that of the wild type, showing a progressively increasing trend. It can be determined that ZmbZIP75... OE -1, ZmbZIP75 OE -2, ZmbZIP75 OE -3 All three overexpression materials produced overexpression of the ZmbZIP75 gene.

[0082] Example 4: Phenotypic observation and low-nitrogen tolerance test of ZmbZIP75 gene CRISPR materials and overexpression materials

[0083] Wild-type corn and ZmbZIP75 crispr -1, ZmbZIP75 crispr -2, ZmbZIP75 crispr -3 and ZmbZIP75 OE -1, ZmbZIP75 OE -2, ZmbZIP75 OE -3 strains germinated on filter paper in the dark. Two days after germination, they were cultured in sand to eliminate the influence of other nitrogen sources. High and low nitrogen nutrient solutions were prepared for treatment. The hydroponic seedlings were then divided into those with normal nitrogen and those with low nitrogen. and low nitrogen Treatment was administered, and the phenotype was observed 10 days later.

[0084] Specifically, place the counted seeds into a transparent resealable bag, pour in a saturated calcium sulfate solution to submerge the seeds, leave for 5-8 hours, then pour off the saturated calcium sulfate solution and rinse four times with deionized water.

[0085] Then, place a sheet of toilet paper and a filter paper on the tray, arrange the seeds neatly, then cover with another sheet of filter paper and a sheet of toilet paper. Moisten with ultrapure water and absorb excess moisture. Place in a dark place for two days to germinate. Before planting, mix sand and vermiculite in a 1:1 volume ratio in a box, fill equal portions into flowerpots, and place them on the black tray. Prepare a normal nitrogen solution. and low-nitrogen nutrient solution Pour 2L of nutrient solution into each tray and label it. Remove the seeds that have germinated for two days, place one seed in each pot, and cover with soil to the same height. Treat for 10 days, until a clear phenotype is observed.

[0086] The results showed that under normal nitrogen (HN) treatment, no significant difference was observed between the mutant and wild-type materials, and both exhibited good growth; however, under low nitrogen (LN) treatment, ZmbZIP75... Crispr All three mutant lines exhibited a certain degree of tolerance phenotype, such as Figure 4 As shown in Figure A, the first leaf of the three mutant lines was not completely chlorotic, and none of them experienced leaf drop; while the first leaf of the wild-type plant had already turned yellow and wilted, and almost fell off. ZmbZIP75 Crispr -2 materials exhibit a strong tolerance phenotype.

[0087] Under normal nitrogen treatment, ZmbZIP75 OE The material showed no difference in growth compared to the wild type. However, under low-nitrogen treatment, ZmbZIP75... OE The materials all exhibited relatively sensitive phenotypes, such as Figure 4 As shown in Figure B, the first leaf turns yellow earlier than in the wild type, while the leaves of the wild type plant are still green. (ZmbZIP75) OE _1 and ZmbZIP75 OE The -2 materials sequentially showed more sensitive phenotypes. Therefore, inhibiting the expression of the ZmbZIP75 gene can improve nitrogen use efficiency in maize.

[0088] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

[0089] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of reduced or absent expression of the nitrogen use-related gene ZmbZIP75 in maize in plant resistance to low nitrogen stress.

2. Application of reduced or absent expression of the nitrogen utilization-related gene ZmbZIP75 in nitrogen-efficient plant breeding.

3. A method for enhancing plant resistance to low nitrogen stress, characterized in that, The maize ZmbZIP75 gene was weakened using genetic engineering techniques; the weakening included knocking out or reducing the expression of the ZmbZIP75 gene.

4. The application or method according to any one of claims 1-3, wherein the nucleotide sequence is shown in SEQ ID NO.

1.

5. In the application or method according to claim 4, the amino acid sequence of the protein encoded by the maize ZmbZIP75 gene is shown in SEQ ID NO.

2.

6. The application or method according to any one of claims 1-3, characterized in that, Using CRISPR / Cas gene editing technology, the maize ZmbZIP75 gene was mutated, resulting in the loss of function of the corresponding gene.

7. The application or method according to claim 6, characterized in that, Breeding methods include designing gRNA sequences; amplification, recovery, and vector construction; transformation into Agrobacterium; and infection of plants.

8. The method according to claim 6, characterized in that, The sequence of the gRNA action site is 5'-GCGCTGTATACCCGGTGAT-3'.

9. The application or method according to any one of claims 1-3, characterized in that, The vector was constructed using primers with sequences SEQ ID NO.6 and SEQ ID NO.

7.

10. Maize low nitrogen tolerance gene plant expression vector ZmbZIP75-pBUE411C, which is obtained by ligating the fragment shown in SEQ ID NO.1 to the vector pBUE411C.

Images