Mulberry aquaporin coding gene and application thereof

Abstract

The invention discloses a mulberry aquaporin coding gene and application thereof. The nucleotide sequence of the coding gene is shown as SEQ ID NO. 1. According to the invention, the aquaporin MnPIP1 is cloned in a woody plant mulberry; 2 genes, the expression of the gene is obviously up-regulated in the process of infecting mulberry trees by bacterial wilt, and the gene is a key factor for responding infection by ralstonia solanacearum. According to the invention, mulberry MnPIP1 is silenced through a virus-induced gene silencing technology; the disease resistance of the plant to ralstonia solanacearum is obviously enhanced, which shows that the infection speed of pathogenic bacteria is slowed down, and the disease index is reduced. The invention discloses MnPIP1 for the first time; the invention provides a novel theoretical basis and a potential target gene for mulberry disease-resistant breeding by virtue of a molecular regulation mechanism of 2 in mulberry bacterial wilt resistance, and is expected to improve the disease resistance of plants, so that the purposes of increasing the yield and reducing the pesticide are achieved, and the application prospect is important.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a mulberry aquaporin coding gene and application thereof. BACKGROUND

[0002] Mulberry (Morus alba L.) is a kind of excellent traditional tree species with economic value, medicinal value and ecological value, and is the core foundation of the development of the silkworm and mulberry industry. The mulberry bacterial wilt caused by Ralstonia pseudosolanacearum is a soil-borne vascular disease, and is one of the most destructive diseases in the growth process of mulberry, which is called the 'cancer' of mulberry. In the early stage of infection, the pathogen locates the plant host by sensing and chemotaxis of plant root exudates, amino acids, sugars, organic acids and other beneficial compounds through flagellar movement, invades the plant through the root wound, and then continuously reproduces in the vascular bundle of the plant, produces a large amount of extracellular polysaccharide to block the vascular bundle conduit, so that the water transport is blocked, and then the plant wilts and dies. This disease seriously restricts the sustainable development of the silkworm and mulberry industry in China.

[0003] At present, the prevention and control of mulberry bacterial wilt mainly adopts agricultural and chemical control methods. Due to the high cost of chemical agents and unstable effect, long-term use will destroy the balance of soil microorganisms, reduce the abundance of beneficial bacteria, and drug residues may harm the healthy feeding of silkworm through mulberry leaves. In comparison, the breeding of resistant varieties is considered to be a more economical, more environmentally friendly and more effective strategy to prevent and control mulberry bacterial wilt. Therefore, it is urgent to excavate the genes that play an important role in the interaction between mulberry and bacterial wilt and reveal the potential molecular mechanism. SUMMARY

[0004] The application provides a mulberry aquaporin MnPIP1;2 gene, and the application of silencing the gene can enhance the disease resistance of mulberry to bacterial wilt, and can be used for cultivating new mulberry varieties with the ability to resist bacterial wilt of mulberry.

[0005] In order to achieve the above object, the application provides a mulberry aquaporin coding gene MnPIP1;2, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 1.

[0006] The application provides a mulberry aquaporin coding gene MnPIP1;2, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 1.

[0007] The application provides a mulberry aquaporin coding gene MnPIP1;2, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 1.

[0008] The application contains the gene silencing vector of the mulberry aquaporin coding gene MnPIP1;2.

[0009] The application of the mulberry aquaporin coding gene MnPIP1;2 or the protein or the vector in regulating the disease resistance of the mulberry.

[0010] The application of the mulberry aquaporin coding gene MnPIP1;2 in regulating the disease resistance of the mulberry.

[0011] The application of the mulberry aquaporin coding gene MnPIP1;2 in regulating the disease resistance of the mulberry.

[0012] The application of the mulberry aquaporin coding gene MnPIP1;2 in regulating the disease resistance of the mulberry.

[0013] The application of the mulberry aquaporin coding gene MnPIP1;2 or the protein or the vector in cultivating the transgenic mulberry plant with the ability of resisting the mulberry bacterial wilt.

[0014] The method for cultivating the transgenic mulberry plant with strong bacterial wilt resistance comprises the following steps:

[0015] (1) a silencing target gene sequence and specific primers thereof are designed according to the mulberry aquaporin coding gene MnPIP1;2, and the nucleotide sequence of the target gene sequence is shown in SEQ ID NO. 3;

[0016] (2) the target gene sequence is constructed on a VIGS vector pTRV2 to obtain a pTRV2-MnPIP1;2 recombinant plasmid;

[0017] (3) the above-mentioned recombinant silencing plasmid is transformed into an agrobacterium competent cell to obtain an agrobacterium containing the mulberry MnPIP1;2 gene silencing vector;

[0018] (4) the agrobacterium in step (3) is transformed into the mulberry to obtain a transgenic mulberry plant containing the mulberry MnPIP1;2 gene silencing vector.

[0019] Further, the identification method of the mulberry MnPIP1;2 gene as a disease resistance target gene in the application comprises the following steps:

[0020] (1) fluorescence quantitative PCR primers of the mulberry aquaporin MnPIP1;2 gene and the mulberry actin MnActin gene are designed;

[0021] (2) based on a water-cultured wounded root method mulberry bacterial wilt infection system, the mulberry bacterial wilt MRS-5 is cultured to OD 600After 0.5, the seedlings are inoculated by water culture wound root method, and RNA of root, stem and leaf tissues is extracted at 7 time points within 0-96h to reverse transcribe into cDNA as a template.

[0022] (3) Further, by using MnActin as an internal reference gene, the expression dynamics of MnPIP1;2 gene in the roots, stems and leaves of mulberry infected by Ralstonia solanacearum at different infection times are detected by fluorescence quantitative PCR, the relative expression level is calculated by using 2 -ΔΔCt After the infection of Ralstonia solanacearum, the expression level of MnPIP1;2 gene is significantly up-regulated, which indicates that it may be involved in the regulation of the defense response process of plants.

[0023] In the present application, the MnPIP1;2 gene silencing strain is constructed by VIGS technology, and after the infection of Ralstonia solanacearum, the silencing strain shows significantly enhanced disease resistance, and the resistance mechanism is as follows:

[0024] (1) Activation of antioxidant enzyme system: the activities of three main antioxidant enzymes in the MnPIP1;2 silencing strain after the inoculation of pathogenic bacteria are significantly up-regulated compared with the control group.

[0025] (2) Inducing the expression changes of key genes in hormone signal pathway: the silencing of MnPIP1;2 gene breaks the dynamic balance of SA, ET and JA signal pathways. The rapid start of SA pathway provides basic resistance for early defense, and the continuous activation of JA and ET signal pathways may enhance the adaptive response of plants to the infection process of Ralstonia solanacearum.

[0026] In the present application, a water channel protein MnPIP1;2 gene is cloned from woody plants mulberry, and the gene is significantly up-regulated in the process of Ralstonia solanacearum infection, which is a key factor responding to the infection. The functional research shows that MnPIP1;2 gene is a negative regulatory factor of Ralstonia solanacearum resistance of mulberry, and the sensitivity of plants to Ralstonia solanacearum can be effectively affected by regulating the expression level of MnPIP1;2. In the present application, the silencing of MnPIP1;2 gene of mulberry by VIGS (virus-induced gene silencing) significantly enhances the disease resistance of plants to Ralstonia solanacearum, which is manifested as the slowing down of the infection speed of pathogenic bacteria and the decrease of disease index. The antioxidant enzyme activity in the plant with silenced MnPIP1;2 gene is improved, and the expression level of key genes in multiple plant hormone signal pathways is increased. The present application first reveals the molecular regulation mechanism of MnPIP1;2 in the resistance of mulberry to Ralstonia solanacearum, and provides a new theoretical basis and potential target gene for disease resistance breeding of mulberry, which is expected to improve the disease resistance of plants, so as to achieve the purpose of increasing yield and reducing pesticide, and has important application prospect. The present application first reveals that the PIP family member MnPIP1;2 of mulberry negatively regulates the resistance of mulberry to Ralstonia solanacearum, and provides a new target gene and theoretical basis for the molecular breeding of disease resistance of mulberry.

[0027] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0028] This invention marks the first cloning of a novel mulberry aquaporin-encoding gene, MnPIP1;2, from mulberry trees. By silencing the MnPIP1;2 gene using virus-induced gene silencing (VIGS) technology, the host adaptability of *Ralstonia solanacearum* (S. solanacearum) is blocked, enhancing the resistance of mulberry trees to *Ralstonia solanacearum*. This method is unaffected by *Ralstonia solanacearum* race variation. The successful knockdown of the MnPIP1;2 gene significantly enhances the disease resistance of mulberry trees, indicating that the MnPIP1;2 gene is a negative regulator of mulberry bacterial wilt resistance. This invention reveals for the first time the important role of the MnPIP1;2 gene in mulberry resistance to *Ralstonia solanacearum*, providing a new theoretical basis for breeding mulberry trees with resistance to bacterial wilt. Attached Figure Description

[0029] Figure 1 The expression levels of the MnPIP1;2 gene in mulberry root tissue at different time points after Ralstonia solanacearum infection were determined.

[0030] Figure 2 The expression levels of the MnPIP1;2 gene in mulberry stem tissue at different time points after Ralstonia solanacearum infection were determined.

[0031] Figure 3 The expression levels of the MnPIP1;2 gene in mulberry leaf tissues infected with Ralstonia solanacearum at different times were determined.

[0032] Figure 4 Map of cloning and plasmid construction for the silenced MnPIP1;2 gene.

[0033] Figure 5 Phenotypic analysis and silencing efficiency of plants with silenced MnPIP1;2 genes.

[0034] Figure 6 To determine the resistance of MnPIP1;2 gene-silenced plants to Ralstonia solanacearum and the activity of antioxidant enzymes in vivo.

[0035] Figure 7 To investigate the effects of Ralstonia solanacearum infection on the expression of salicylic acid, jasmonic acid, and ethylene signaling pathway genes in MnPIP1;2 silenced lines of mulberry seedlings. Detailed Implementation

[0036] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0037] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.

[0038] Strains: MRS-5, a wild type P. mori, was provided by Jiangsu University of Science and Technology.

[0039] Mulberry: Fengchi, from Jiangsu University of Science and Technology / Chinese Academy of Agricultural Sciences Institute of Sericulture.

[0040] Reagent configuration:

[0041] Preparation of LB liquid medium: yeast extract 5 g, tryptone 10 g, sodium chloride 10 g, make up to 1 L, sterilize at 120℃ for 20 min.

[0042] Preparation of YEB liquid medium: tryptone 5 g, yeast powder 1 g, beef extract 5 g, sucrose 5 g, magnesium sulfate heptahydrate 0.49 g, make up to 1 L, mix well, adjust pH to 7.0, sterilize at 121℃ for 20 min.

[0043] Preparation of CPG liquid medium: glucose 5.08 g, tryptone 10 g, hydrolyzed casein 1 g, make up to 1 L, mix well, adjust pH to 7.0, sterilize at 115℃ for 30 min.

[0044] Preparation of solid medium corresponding to the above liquid medium: add 1.5% agar powder.

[0045] Preparation of TTC solid medium: glucose 5.08 g, tryptone 10 g, hydrolyzed casein 1 g, TTC 0.5 g, agar powder 15 g, make up to 1 L, mix well, adjust pH to 7.0, sterilize at 115℃ for 30 min. TTC powder is added to the medium after sterilization before pouring the plate.

[0046] Preparation of 50 mg / mL kanamycin (Kana): kanamycin 0.5 g is dissolved in 10 mL of ddH2O, then filtered with a water filter membrane (diameter = 0.22 μm), and stored in a -20℃ refrigerator after preparation.

[0047] Preparation of 100 mg / mL rifampicin (Rif): rifampicin 0.5 g is dissolved in 5 mL of dimethyl sulfoxide, then filtered with a water filter membrane (diameter = 0.22 μm), and stored in a -20℃ refrigerator after preparation.

[0048] Example 1

[0049] Cloning of Mulberry Aquaporin MnPIP1;2 Gene

[0050] Trizol reagent was used to extract total RNA from Morus notabilis (roots, stems, and leaf tissues). 1 mL of Trizol reagent (Aikuer, Hunan) and 3 magnetic beads were added to a sterile grinding tube, 100 mg of fresh plant tissue was taken and placed in the grinding tube, and the tissue was broken up using a grinder (70 Hz, 3 min). The mixture was centrifuged at 4°C and 12000 rpm for 10 min. 800 μL of supernatant was carefully transferred to a new enzyme-free centrifuge tube, 200 μL of chloroform was added, and the mixture was thoroughly mixed. The mixture was incubated on ice for 3 min, centrifuged at 4°C and 12000 rpm for 10 min, and 450 μL of the upper colorless aqueous phase was transferred to a new enzyme-free centrifuge tube. An equal volume of isopropanol was added, the mixture was thoroughly mixed, and the mixture was incubated on ice for 5 min. The mixture was centrifuged at 4°C and 12000 rpm for 8 min, and the supernatant was discarded (a gel-like precipitate formed on the tube wall and tube bottom). 1 mL of 75% ethanol (DEPC water) was added to rinse the precipitate, the mixture was centrifuged at 4°C and 12000 rpm for 3 min, and the supernatant was discarded. The tube cap was opened and the tube was placed on a clean bench at room temperature for 5-10 min until the ethanol completely evaporated. 50-70 μL of DEPC water was added to dissolve the precipitate. The RNA concentration (A260 / A280 ratio should be between 1.8 and 2.0) was determined using a NanoDrop 2000, and 1-2 μg of RNA was subjected to 1.25% agarose gel electrophoresis to observe the integrity of the 28S / 18S rRNA bands. Finally, the Evo M-MLV reverse transcription premix tracer kit (Aikuer, Hunan) was used to remove gDNA from the total RNA and reverse transcribe the first strand cDNA.

[0051] Specific primers were designed from the Morus notabilis genome database, and the cDNA was used as a template for sequence amplification. The primer sequences are as follows:

[0052] MnPIP1;2-F: ATGGAGGGCAAAGAAGAAGA

[0053] MnPIP1;2-R: CTTGAAGGGAAGTGCTCTGA

[0054] The CDS sequence of the amplified MnPIP1;2 gene is shown in SEQ NO. 1, and the amino acid sequence of the encoded protein is shown in SEQ NO. 2.

[0055] According to the obtained sequence of the Morus notabilis aquaporin MnPIP1;2, primers for fluorescence quantitative analysis were designed, and the primer sequences are as follows:

[0056] MnPIP1;2-qF: TTCTCCGCTACTGATGCTAA

[0057] MnPIP1;2-qR: CGTCCCAAGCATGTTCTCTG

[0058] The mulberry actin gene MnActin (LOC21410617), stably expressed in mulberry trees and identified in the National Center for Biotechnology Information (NCBI) database, was used as an internal reference gene. Primers for quantitative real-time analysis were designed, and the primer sequences are as follows:

[0059] MnActin–F:AGTGGACGTACGACTGGTATC

[0060] MnActin–R:AGTAACCACGCTCCGTCAAG.

[0061] Example 2

[0062] Gene expression levels of MnPIP1;2 genes in mulberry trees at different time points and in different parts after infection with Ralstonia solanacearum

[0063] MRS-5 *Ralstonia solanacearum* was inoculated using the hydroponic root-damage method. Glycerol culture of *Ralstonia solanacearum* MRS-5, previously stored at -80℃, was streaked onto TTC plates and incubated at 28℃ for 48 h. Subsequently, single colonies were picked and inoculated into CPG liquid medium and incubated at 28℃ and 220 rpm for 48 h. The cultured culture was resuspended in sterile water, and the OD was... 600 The value was adjusted to 0.5. The tested Fengchi mulberry seedlings (21 days old) were removed from the soil, rinsed thoroughly with clean water, and placed in tissue culture bottles containing 150 mL of Ralstonia solanacearum suspension. A control group was also established, treating mulberry seedlings with an equal volume of sterile water. Throughout the treatment process, all experimental seedlings maintained consistent abiotic conditions (temperature, light intensity, photoperiod, and humidity) (normal greenhouse conditions, 25°C, 70% relative humidity, 14-hour photoperiod). Samples were taken at 0, 6, 12, 24, 48, 72, and 96 hours after treatment. Samples were immediately frozen in liquid nitrogen and stored at -80°C for subsequent RNA extraction (method as in Example 1). Quantitative real-time PCR was performed using primers designed in Example 1, with the mulberry actin MnActin gene as an internal control, to determine the expression levels of various target genes after Ralstonia solanacearum infection of mulberry seedlings.

[0064] The expression levels of MnPIP1;2 genes in different parts of mulberry trees at different time points after infection with Ralstonia solanacearum showed that in root tissues, MnPIP1;2 expression began to show significant upregulation 6 hours after pathogen infection, and the expression level increased more than 30-fold at 48 hours, reaching a peak before declining. Figure 1 In stem tissues, the expression level of MnPIP1;2 gradually increased from 6 hours after infection, reaching its maximum at 96 hours after infection, an upregulation of approximately 15-fold. Figure 2) in leaf tissues, MnPIP1;2 was significantly up-regulated at 12h after infection, reached the maximum at 24h and then gradually decreased, the expression change fold of MnPIP1;2 gene in leaf was relatively low, about 4 folds compared with root and stem tissues. Figure 3 ) Further confirmed that MnPIP1;2 showed significant differential expression in both root and stem tissues, and had strong response to Ralstonia solanacearum infection. It was proved that the expression level of MnPIP1;2 could effectively affect the sensitivity of the plant to bacterial wilt, and MnPIP1;2 gene was a key factor for regulating the resistance of mulberry to bacterial wilt.

[0065] Example 3

[0066] Construction of mulberry MnPIP1;2 gene silencing vector

[0067] A 269bp fragment of PIP1;2 gene of mulberry was designed by SGN-VIGS tool, and a recombinant vector pTRV2-MnPIP1;2 was constructed. The specific primers pTRV2-MnPIP1;2-F: gtgagtaaggttaccgaattcTTGCCGCAGGATACAGCAAG (EcoR I) and pTRV2-MnPIP1;2-R: gggacatgcccgggcctcgagAATCCAATGGTCGTCCCAAG (Xho I) were designed, and the PCR amplification (2×Phanta Max Master Mix P525, Takara) was performed with the mulberry cDNA of Example 1 as the template to obtain a PCR amplification product of about 269bp. The about 269bp fragment 1 was recovered, and the nucleotide sequence thereof was shown in SEQ ID NO. 3. The plant expression vector pTRV2 was double-digested with restriction endonuclease EcoR I and Xho I (TaKaRa) to recover a vector backbone 2 of about 9.6k. The fragment 1 and the vector backbone 2 were connected by homologous recombination (DLV201T relief Seamless Cloning Kit, Daling Biotech) to obtain the recombinant plasmid pTRV2-MnPIP1;2. Figure 4 ) After double digestion verification, the recombinant plasmid was sequenced (Sanger sequencing, Shanghai Sangon Biological Engineering Co., Ltd.), and the sequencing results showed that the recombinant plasmid contained the nucleotide sequence shown in SEQ NO. 3 in the sequence table.

[0068] PCR reaction system:

[0069]

[0070] PCR amplification program: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 sec, 60℃ annealing for 15 sec, 72℃ extension for 30 sec, repeated 30 times for denaturation, annealing, and extension, followed by a final extension at 72℃ for 5 min. Simultaneously, MnPIP1;2 was replaced with MnPDS (SEQ ID NO.4) to obtain the recombinant plasmid pTRV2-MnPDS, where PDS is a silenced reporter gene, specifically phytoene desaturase, used as a positive control.

[0071] Double enzyme digestion reaction system:

[0072]

[0073] Double enzyme digestion procedure: Incubate at 37℃ for 15 min.

[0074] Homologous recombination system:

[0075]

[0076] *Refer to the instruction manual to calculate the volume of the target fragment and the linearized carrier.

[0077] Homologous recombination procedure: react at 50℃ for 15 min.

[0078] Example 4

[0079] Phenotypic analysis and silencing efficiency of the silenced MnPIP1;2 gene in plants

[0080] The recombinant plasmid pTRV2-MnPIP1;2 or pTRV2-MnPDS constructed in Example 3 was transformed into Agrobacterium competent cells (GV3101) using the freeze-thaw method. The Agrobacterium culture was then streaked onto YEB plates containing both Rif (50 μg / mL) and Kan (50 μg / mL) antibiotics and incubated at 28°C for 48 h. Single colonies were selected and incubated overnight at 28°C in 2 mL of YEB liquid medium containing the corresponding antibiotics. Subsequently, bacterial PCR was performed (primers as in Example 3) to confirm the correct strain. The cultured bacterial culture was then inoculated into 25 mL of YEB liquid medium containing the corresponding antibiotics and incubated overnight at 28°C. The cultured bacterial culture was centrifuged at 6000 rpm / min for 5 min, the supernatant was discarded, and the bacterial cells were resuspended in infection solution (final resuspension concentration: 10 mM MgCl2, 10 mM MES, and 150 μM MAS, pH = 5.6) to adjust the OD of the bacterial culture. 600= 1.0, and left at room temperature for 3 h. An equal volume of pTRV1 and pTRV2-MnPDS Agrobacterium resuspension liquid was mixed as a positive control group, an equal volume of pTRV1 and empty pTRV2 Agrobacterium resuspension liquid was mixed as an empty control group, and an equal volume of pTRV1 and pTRV2-MnPIP1;2 Agrobacterium resuspension liquid was mixed as an experimental group. The mulberry seedlings without any treatment were used as a blank control group.

[0081] The 1-week-old mulberry seedlings with fully expanded cotyledons and without the first pair of true leaves were selected. 1 mL of resuspended bacteria was taken with a syringe and injected from the lower epidermis of the cotyledon, and the leaf was fully infiltrated. After 24 h of dark culture, the treated plants were transferred to normal light. About 12 d after Agrobacterium infection, the mulberry seedlings in the MnPDS silencing group showed a significant white phenotype Figure 5 A). 14 d after Agrobacterium infection, the RNA of the newly grown young leaves of CK, TRV, and MnPIP1;2 silencing plants was extracted (same as in Example 1), and the expression level of MnPIP1;2 gene was detected by real-time fluorescent quantitative qRT-PCR with the mulberry actin MnActin gene as an internal reference to evaluate the silencing efficiency. The results showed that the expression level of MnPIP1;2 in the silencing plants was significantly lower than that in the CK and TRV plants, which was reduced by about 65% and 40%, respectively Figure 5 B).

[0082] Example 5

[0083] Resistance of MnPIP1;2 gene silencing plants to Ralstonia solanacearum and determination of antioxidant enzyme activity in vivo

[0084] The TRV (empty vector control) and TRV-MnPIP1;2 (gene silencing) lines cultivated in Example 4 were inoculated with Ralstonia solanacearum by the water-cultured wound-root method (same as in Example 2). The results showed that the TRV-MnPIP1;2 silencing line showed a significantly enhanced Ralstonia solanacearum disease resistance phenotype. 72 h after inoculation, the control plants began to show typical wilting symptoms, with slightly drooping and yellowing leaves; while the silencing line remained normal growth, and no obvious pathological symptoms were observed Figure 6 A).

[0085] The activities of antioxidant enzymes in mulberry trees infected with Ralstonia solanacearum were determined using catalase (CAT), peroxidase (POD), superoxide dismutase (SOD), and malondialdehyde (MDA) kits (all kits were purchased from Nanjing Jiancheng Biotechnology Co., Ltd., and the instructions were followed). The results showed that the activities of the three major antioxidant enzymes were significantly upregulated in the TRV-MnPIP1;2 silenced lines after pathogen inoculation compared to the control group. Specifically, the basal activity of CAT in the silenced lines was nearly twice that of the control group. Figure 6 B), POD activity was increased by approximately 30% compared to the control group. Figure 6 C), SOD activity increased by approximately 10% ( Figure 6 D), while the content of malondialdehyde (MDA) did not differ significantly between the two groups. Figure 6 E). The above experimental results clearly demonstrate that silencing the MnPIP1;2 gene significantly activates the antioxidant defense system in mulberry trees, particularly promoting the synergistic expression of key antioxidant enzymes such as SOD, POD, and CAT. This systemic enhancement of antioxidant capacity effectively eliminates excess reactive oxygen species (ROS) accumulated during pathogen infection, maintains cellular redox homeostasis, and thus significantly reduces the plant's susceptibility to Ralstonia solanacearum.

[0086] Example 6

[0087] Effects of Ralstonia solanacearum infection on gene expression in salicylic acid, jasmonic acid, and ethylene signaling pathways in MnPIP1;2 silenced lines

[0088] Using the hydroponic root-damage method (same as in Example 2), TRV (empty vector control) and TRV-MnPIP1;2 (gene silenced) lines cultivated in Example 4 were inoculated with Ralstonia solanacearum. Samples were collected at four time points: 0, 24, 48, and 72 days after inoculation. Hormone signaling pathway-related genes were screened from the *Lonicera japonica* database: key genes of the salicylic acid (SA) signaling pathway (MnPR1 and MnPAL1), key regulatory genes of the jasmonic acid (JA) signaling pathway (MnJAZ4 and MnCYP73A), the rate-limiting enzyme gene for ethylene (ET) biosynthesis (MnACO1), and the core transcription factor of the jasmonic acid and ethylene signaling pathways (MnWRKY33). Primers for quantitative real-time PCR were designed (Table 1), and the dynamic response of hormone signaling pathways in the MnPIP1;2 gene-silenced lines during Ralstonia solanacearum infection was analyzed through quantitative experiments.

[0089] qRT-PCR results showed that 24 h after Ralstonia solanacearum infection, the expression levels of key SA signaling pathway genes MnPR1 and MnPAL1 in the MnPIP1;2 silencing line were significantly upregulated by 2-fold compared to the control group. Figure 7A, B), where the expression of MnPR1 maintained a stable induction level of 2-fold higher than the control group at 72 h, while the expression of MnPAL1 returned after 48 h; the expression of MnWRKY33, the core transcription factor of JA and ET signaling pathways, showed a significant time-dependent enhancement feature, with its expression being 2-fold, 3-fold and 5-fold higher than the control at 24 h, 48 h and 72 h, respectively Figure 7 C); the key regulatory gene MnJAZ4 of the JA signaling pathway was significantly up-regulated by 5-fold and 15-fold in the TRV-MnPIP1;2 silenced strain at 24 h and 48 h, respectively Figure 7 D); in addition, another key gene MnCYP73A of the JA pathway was up-regulated by 2-3-fold at 24-72 h Figure 7 E), and the ethylene biosynthesis rate-limiting enzyme gene MnACO1 was up-regulated by 2-fold at 48 and 72 h compared with the control Figure 7 F). This indicates that the silencing of the MnPIP1;2 gene leads to the disruption of the dynamic balance of the SA, ET and JA signaling pathways. The rapid activation of the SA pathway provides a basic resistance for early defense, and the sustained activation of the JA and ET signaling pathways may enhance the adaptive response of the plant to the infection process of P. solanacearum.

[0090] Table 1. Fluorescent quantitative PCR primers

[0091]

[0092]

Claims

1. A mulberry aquaporin-encoding gene MnPIP1;2, characterized in that, The nucleotide sequence of the coding gene is shown as SEQ ID NO.

1.

2. A protein encoded by a mulberry aquaporin gene MnPIP1;2, characterized in that, The amino acid sequence of the protein is shown as SEQ ID NO.

2.

3. A vector containing the mulberry aquaporin coding gene MnPIP1;2 according to claim 1.

4. A gene silencing vector containing the mulberry aquaporin coding gene MnPIP1;2 according to claim 1.

5. Use of the mulberry aquaporin coding gene MnPIP1;2 according to claim 1 or the protein according to claim 2 or the vector according to claim 3 or 4 in regulating the disease resistance of mulberry.

6. Use according to claim 5, characterized in that, The regulation of the disease resistance of mulberry is to enhance the resistance of mulberry to bacterial wilt.

7. Use according to claim 6, characterized in that, Preferably, the use of silencing the mulberry aquaporin coding gene MnPIP1;2 in the plant in vivo to enhance the disease resistance of the plant to Pseudomonas syringae pv. actinidiae.

8. Use according to claim 6, characterized in that, By silencing the mulberry aquaporin coding gene MnPIP1;2 in the plant in vivo, the antioxidant enzyme activity in the plant in vivo is improved, and the expression level of key genes in multiple plant hormone signaling pathways is increased.

9. Use of the mulberry aquaporin coding gene MnPIP1;2 according to claim 1 or the protein according to claim 2 or the vector according to claim 3 or 4 in cultivating transgenic mulberry plants with resistance to bacterial wilt of mulberry.

10. Use according to claim 8, characterized in that, The method for cultivating transgenic mulberry plants with strong resistance to bacterial wilt is: (1) Designing a silencing target gene sequence and specific primers thereof according to the mulberry aquaporin coding gene MnPIP1;2, wherein the nucleotide sequence of the target gene sequence is shown as SEQ ID NO. 3; (2) Constructing the target gene sequence into a VIGS vector pTRV2 to obtain a pTRV2-MnPIP1;2 recombinant plasmid; (3) Transferring the above-mentioned recombinant silencing plasmid into an Agrobacterium competent cell to obtain an Agrobacterium containing a mulberry MnPIP1;2 gene silencing vector; (4) Transferring the Agrobacterium of step (3) into a mulberry plant in vivo to obtain a transgenic mulberry plant containing a mulberry MnPIP1;2 gene silencing vector.

Images