Method for cultivating salt-tolerant plant by expressing GmSWEET3c
By expressing the GmSWEET3c gene in soybean and using Agrobacterium-mediated transformation, the salt tolerance of soybean was improved, solving the problem of soybean's sensitivity to salt stress. This resulted in improved survival rate and growth potential of transgenic plants under salt stress, providing new gene resources for salt-tolerant breeding.
Patent Information
- Application Number
- CN202511275846.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-08
- Publication Date
- 2025-12-05
AI Technical Summary
In existing technologies, soybeans are sensitive to salt stress, which leads to root nodulation, plant growth, agronomic traits and final yield being inhibited. The lack of effective salt-tolerant gene resources has limited the progress of salt-tolerant breeding.
By expressing the soybean GmSWEET3c gene, transformants were constructed using Agrobacterium-mediated transformation to enhance the expression level of GmSWEET3c. Through a stable Agrobacterium-mediated genetic transformation system, salt-tolerant transformants were obtained. Using a combination of molecular biology and plant tissue culture, transformants were constructed using expression vectors for plant transformation. Transgenic plants were screened and their phenotypic characteristics under salt stress were identified.
It significantly improved the survival rate and growth potential of transgenic plants under salt stress, revealing the key role of GmSWEET3c in the regulation of soybean salt tolerance, providing a new gene resource for salt-tolerant breeding, and is applicable to the genetic improvement of salt tolerance in soybean and other crops.
Smart Images

Figure CN121065205A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering, in particular to a method for cultivating salt-tolerant plants by expressing GmSWEET3c. BACKGROUND
[0002] Soybean is an important economic crop for food and oil in China, and is also the main source of plant protein, playing a vital role in agricultural production and national economy. With the increasing shortage of arable land resources, developing and utilizing saline-alkali land and improving crop salt tolerance have become a major strategic demand to ensure food security.
[0003] Soybean is a moderately salt-tolerant plant, which is sensitive to salt stress. Under salt stress conditions, the nodulation of soybean root system, plant growth, key agronomic traits, final yield and grain quality are all significantly inhibited. Therefore, breeding and creating new salt-tolerant soybean varieties has great significance for effectively utilizing low-salinity land, expanding planting area and improving domestic soybean self-sufficiency rate.
[0004] Recent studies have shown that plant SWEET family sugar transporters play a key role in regulating sugar distribution, participating in growth and development and responding to stress. For example, knockout of the maize ZmSWEET1b gene leads to more severe wilting phenotype in plants under salt stress, indicating that the gene positively regulates salt tolerance. However, in soybean, which SWEET members are involved in salt stress response and the specific mechanism are not clear, which limits the application of this family of genes in salt-tolerant breeding.
[0005] Therefore, in view of the deficiencies of the prior art, the key genes with salt tolerance function in the SWEET family of soybean are explored and utilized, and an efficient and stable genetic transformation and salt tolerance identification technology system is established, so as to cultivate new soybean materials with strong salt tolerance and excellent agronomic traits, which has important theoretical value and practical significance for promoting salt-tolerant soybean breeding and improving the utilization efficiency of saline-alkali land. SUMMARY
[0006] In view of this, the present application provides a method for cultivating salt-tolerant plants by expressing GmSWEET3c to solve the above-mentioned problems existing in the prior art.
[0007] To achieve the above-mentioned purpose, the present application provides a method for cultivating salt-tolerant plants by expressing GmSWEET3c, which comprises introducing a target gene into a plant to be improved and obtaining a transgenic plant, so that the survival rate of the transgenic plant under salt stress is increased relative to the wild type; the target gene is soybean gene Glyma.13G041300 or a gene with equivalent or corresponding biological function and sequence similarity not less than 90%.
[0008] Further, the step of introducing the target gene into the plant to be improved comprises constructing an overexpression vector containing the target gene, and using the overexpression vector to construct a transformant for plant transformation.
[0009] Further, the overexpression vector is pTF101 or a recombinant plant expression vector constructed using pTF101 as a backbone, and the vector contains a promoter capable of driving the expression of the target gene in plants and a selection marker gene for screening.
[0010] Further, the overexpression vector is constructed by cloning GmSWEET3c into the vector through restriction enzyme digestion or homologous recombination, and the enzyme digestion sites used for constructing the overexpression vector are XbaI and BamH I.
[0011] Further, the plant to be improved is a soybean plant.
[0012] Further, the method of using the overexpression vector to construct a transformant for plant transformation is an Agrobacterium-mediated transformation method, and the Agrobacterium is EHA101.
[0013] Further, the Agrobacterium-mediated transformation method comprises the following steps: transforming Agrobacterium EHA101 using the overexpression vector to obtain an engineered bacterium; using the engineered bacterium to infect soybean explants; and sequentially culturing the infected explants on CCM medium, SIM medium and SEM medium for co-culture, bud induction and somatic embryogenesis culture to screen and obtain a transgenic plant.
[0014] Further, the transgenic plant is positively identified by a PCR method, and the PCR uses primers targeting the selection marker gene Bar and / or the target gene.
[0015] Further, the nucleotide sequence of the target gene is as shown in SEQ ID NO. 1 and SEQ ID NO. 2.
[0016] The application also provides a kit for implementing the above method, and the kit contains necessary components for overexpressing the target gene, and the components are selected from one or more of the following: template DNA containing the coding sequence of Glyma.13G041300 gene, specific primer pairs, restriction enzymes, pTF101 vector, buffer solution, and Agrobacterium EHA101 competent cells.
[0017] Compared with the prior art, the application has the beneficial effects that, The application improves the expression level of GmSWEET3c gene in plants through genetic manipulation, thereby significantly enhancing the tolerance of transgenic plants to salt stress. Experiments show that the transgenic plants obtained by the above method exhibit excellent survival advantage under salt stress, and the overall growth and survival rate are obviously improved compared with the wild type control.
[0018] The method first reveals and verifies the key positive role of GmSWEET3c gene in soybean salt tolerance regulation, and provides a new important gene resource for plant stress resistance breeding. Through the stable genetic transformation system mediated by Agrobacterium, the efficient integration and expression of the gene in soybean can be realized, and the genetic stability is good, which is convenient for subsequent breeding utilization.
[0019] The technical solution established in the application is not only suitable for soybean, but also can provide reference for salt tolerance genetic improvement of other crops such as corn, rice and other cereal crops, and has wide application potential and important practical value. The research provides a new idea and technical approach for improving crop stress resistance by using sugar transporter gene family. BRIEF DESCRIPTION OF DRAWINGS
[0020] Figure 1 W82 and GmSWEET3c under normal growth (CK) and salt treatment for 14 days, and survival rate statistics of W82 and GmSWEET3c under salt treatment for 14 days are shown in the schematic diagram. DETAILED DESCRIPTION
[0021] Now, various exemplary embodiments of the application will be described in detail, which should not be considered as limiting the application, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the application.
[0022] All raw materials of the application have no special restrictions on their sources, and can be purchased on the market or prepared according to conventional methods well known to those skilled in the art.
[0023] All raw materials of the application have no special restrictions on their purity, and the application preferably uses analytical pure raw materials or raw material purity commonly used in the field of chemical synthesis.
[0024] The application adopts the method of combining molecular biology and plant tissue culture, obtains stable transgenic soybean plants by constructing overexpression vector containing soybean GmSWEET3c (gene number Glyma.13G041300) cDNA, and performs phenotype identification and statistical analysis on the tolerance of the transgenic plants under salt stress conditions, so as to prove that GmSWEET3c overexpression can improve the survival rate of soybean under salt stress. The implementation steps include the determination and sequence acquisition of the target gene, the construction of the overexpression vector, the introduction of the vector into Agrobacterium and the use of the vector for soybean explant transformation, tissue culture and callus, molecular identification of positive plants, and salt stress resistance detection, and the like. The following will be described in detail (the conditions listed in the following examples are preferred conditions, which are not limited).
[0025] Example 1 Determination and sequence acquisition of target gene The target gene includes: a. soybean-derived gene GmSWEET3c with gene number Glyma.13G041300; b. genes having equivalent or corresponding biological functions to the soybean-derived gene with gene number Glyma.13G041300, genes with a similarity of 90%, and known genes or newly identified unknown genes.
[0026] Example 2 Construction of overexpression vector According to the obtained GmSWEET3c cDNA sequence, a primer is designed and a target fragment is amplified on the cDNA.
[0027] The primer sequence (the sequence marked by an underline is the corresponding enzyme cutting site and protection base) is: GmSWEET3c-PTF101-F: TCCCCCGGG ATGGCAGAGACCCTTCG (SEQ ID NO. 1); GmSWEET3c-PTF101 -R : CGGGATCC TCATGAGTTGAAGTTACTAGGA (SEQ ID NO. 2); The total RNA from Williams 82 was reverse transcribed to synthesize cDNA, and the cDNA was used as a template for PCR amplification to obtain the target fragment. The amplification product was separated by agarose gel electrophoresis, and the gel was cut and recovered. The purified PCR product was recovered using a commercial agarose gel DNA recovery kit. Subsequently, the pTF101 vector (as a cDNA carrier) was linearized with the corresponding restriction enzymes XbaI and BamHI, and the recovered target fragment was ligated to the pTF101 vector using the method of homologous recombination, transformed into E. coli DH5a for cloning and identification. The correct recombinant plasmid was extracted and transformed into Agrobacterium EHA101 for storage and use.
[0028] Example 3 Preparation of Agrobacterium and preparation of transformation material The Agrobacterium strain EHA101 used for transformation was streaked on YEP solid medium, and a single colony was inoculated into 5 mL of YEP liquid medium and incubated at 28°C with 200 rpm shaking until the OD600 was about 1.0 to ensure the activity of the bacterial cells. To detect the activity, 500 μL of bacterial solution was plated on solid medium containing the corresponding resistance marker, and the growth of bacterial lawn was observed within about 16 h to confirm that the strain was well active.
[0029] Example 4 Disinfection and germination of material (preparation of explants) Select intact, full and disease-free Williams 82 soybean seeds for surface disinfection: briefly soak the seeds in 75% ethanol for about 30 s, wipe dry with absorbent paper, then place in a petri dish, and then place the petri dish in a vacuum dryer and use the chlorine gas generated by commercial bleach and concentrated hydrochloric acid for disinfection for 12-16 h. After disinfection, blow in a clean bench until there is no obvious chlorine smell, and store sealed for later use. To germinate, soak the seeds in sterile water for 1 d to germinate to the appropriate state (place 100 seeds in a sterile 12 cm glass dish, add about 100 mL of sterile water, and soak to two-thirds of the beans), and supplement water as needed during the germination process.
[0030] Example 5 Agrobacterium infection and preparation of explants Agrobacterium was cultured and reached the desired OD value, before infection, the bacteria were resuspended to OD 600 0.7-0.8 with the corresponding liquid medium (CCM or CC resuspension liquid), using a sterilized scalpel to cut off the radicle and cut longitudinally along the embryo axis, each soybean was divided into two explants (hypocotyl length ≤3 mm), each explant contained the growth point. The explants were placed in the resuspension liquid containing the Agrobacterium to be infected, and the infection conditions were placed in a horizontal shaker at room temperature at 80-100 rpm for infection. The explants were moved to CCM solid medium padded with filter paper (about 40-50 explants per dish) 2 days after infection, and dark culture for 3-5 days to restore and start callus formation.
[0031] Example 6 Induction of differentiation and subculture of callus If the swollen hypocotyl appeared after infection and culture in CCM, the operation of transferring to bud induction medium (SIM / S1 bud induction medium) was carried out in turn: the hypocotyl was cut to about 0.5 cm, the wound was inserted into S1 medium at an angle of about 45° with the wound facing down and the cotyledon facing up, about 18 explants were placed in each tissue culture box, and subculture was carried out after culture in a light culture room at 24°C with 18 h light / 6 h dark for about 14 days.
[0032] The grown buds were then transplanted and screened for the second time: the long buds were cut in half to inhibit excessive elongation, and the explants were inserted into the second SIM medium with the inside facing down at an angle of 45°, and cultured for about 2 weeks; then transferred to SEM medium (promote the upward growth of buds) and cultured in a light and temperature incubator at 24°C with 16 h light / 8 h dark for about 2 weeks. Generally, multiple subcultures (change medium every 2 weeks) are needed on SEM medium, and if it is still difficult to obtain seedlings or the positive rate is low after 7-8 subcultures, the batch can be stopped for further subculture.
[0033] When the seedlings appear for the second or third time during the SEM transfer process, the seedlings can be cut from the explants with a sterile blade when they elongate to about 3 cm and inserted into rooting medium for rooting culture, the rooting period is about 7-14 days, and after rooting, the seedlings are transferred to vermiculite or suitable substrate for further culture and planting.
[0034] Example 7 Positive identification of transgenic seedlings Molecular identification was carried out on the obtained seedlings to screen positive transgenic plants.
[0035] Leaf material in normal growth state was taken, and genomic DNA was extracted by CTAB method, and the selection marker Bar gene was first detected to preliminarily determine the positive single plant.
[0036] Example of PCR detection system (10 μL system is prepared): 2×Taq Mix 5 μL, Primer F 0.5 μL, Primer R 0.5 μL, ddH2O 4 μL.
[0037] PCR cycling conditions are exemplified as follows: 95 ℃ 5 min; 26 cycles of 95 ℃ 30 s, 54-58 ℃ annealing (determined according to the Tm value of the primer) / 72 ℃ 30 s (extension time is calculated according to the length of the fragment, usually 1 kb / min); final 72 ℃ extension for 10 min, 16 ℃ incubation.
[0038] After the positive single clone of Bar gene is determined, the target sequence primer is used to amplify the target fragment and sent to the sequencing company for sequencing to confirm the correctness of the inserted fragment; this amplification system can be expanded to 30 μL and the number of cycles is changed to 30 to improve the sensitivity.
[0039] Example 8. Salt stress resistance detection (phenotype evaluation under greenhouse conditions) The wild type control (Williams 82) and the positive transgenic mutant GmSWEET3c screened are planted in the greenhouse at the same time, and rhizobium USDA110 can be inoculated when germinating to maintain physiological consistency. On the 7th day of germination, 100 mM NaCl salt treatment is applied to the salt treatment group, and distilled water is maintained for normal irrigation in the control group; salt treatment continues until obvious phenotype appears.
[0040] Finally, the survival rate of soybeans in each group is counted and compared to evaluate the difference in survival rate of transgenic group and wild type control group under salt stress, to evaluate the promoting effect of GmSWEET3c overexpression on soybean salt tolerance. As shown in Figure 1 the results, the survival rate of transgenic lines overexpressing GmSWEET3c under salt stress is significantly higher than that of wild type, confirming that the gene positively regulates the salt tolerance of soybean.
[0041] The above-described examples are only to describe the preferred modes of the present application, and do not limit the scope of the present application, and various modifications and improvements of the technical solutions of the present application made by those skilled in the art without departing from the design spirit of the present application shall fall within the protection scope determined by the claims of the present application.
Claims
1. A method for breeding salt-tolerant plants by expressing GmSWEET3c, characterized in that, The method comprises introducing a target gene into a plant to be improved and obtaining a transgenic plant, and the transgenic plant has an increased survival rate under salt stress relative to a wild type; the target gene is a soybean gene Glyma.13G041300 or a gene having an equivalent or corresponding biological function and a sequence similarity of not less than 90% to the gene.
2. The method of claim 1, wherein, The step of introducing the target gene into the plant to be improved comprises constructing an overexpression vector containing the target gene, and using the overexpression vector to construct a transformant for plant transformation.
3. The method of claim 2, wherein, The overexpression vector is pTF101 or a recombinant plant expression vector constructed by using pTF101 as a backbone, and the vector contains a promoter capable of driving expression of the target gene in a plant body and a selection marker gene for screening.
4. The method of claim 3, wherein, The overexpression vector is constructed by cloning GmSWEET3c into the vector by restriction enzyme digestion or homologous recombination, and the enzyme digestion sites used for constructing the overexpression vector are XbaI and BamH I.
5. The method of claim 4, wherein, The plant to be improved is a soybean plant.
6. The method of claim 2, wherein, The method for using the overexpression vector to construct a transformant for plant transformation is an Agrobacterium-mediated transformation method, and the Agrobacterium is EHA101.
7. The method of claim 6, wherein, The Agrobacterium-mediated transformation method comprises the following steps: transforming the Agrobacterium EHA101 using the overexpression vector to obtain an engineering bacterium; using the engineering bacterium to infect a soybean explant; and sequentially culturing the infected explant on CCM medium, SIM medium and SEM medium for co-culture, bud induction and somatic embryogenesis culture, and screening to obtain a transgenic plant.
8. The method of claim 1, wherein, The transgenic plant is positively identified by a PCR method, and the PCR uses primers for a selection marker gene Bar and / or the target gene.
9. The method of claim 1, wherein, The nucleotide sequence of the target gene is shown in the amplified sequence of the primer pair of SEQ ID NO. 1 and SEQ ID NO.
2.
10. A kit for carrying out the method according to any one of claims 1 to 9, characterized in that, The kit contains necessary components for overexpression of the target gene, and the components are selected from one or more of the following: template DNA containing a Glyma.13G041300 gene coding sequence, a specific primer pair, a restriction enzyme, a pTF101 vector, a buffer solution and Agrobacterium EHA101 competent cells.
Citation Information
Cited By
Application of GmCIPK6 gene in regulation and control of soybean salt tolerance
CN122104795A