Application of transcription factor S1Fa in regulation and control of plant stress resistance

By overexpressing the SiS1Fa transcription factor in millet, genetic engineering techniques were used to regulate plant salt tolerance, solving the problem of inhibited growth of millet under salt stress, achieving enhanced growth and antioxidant capacity, and improving the physiological state under salt stress.

CN121065244APending Publication Date: 2025-12-05SHANDONG EXPRESSWAY URBAN & RURAL DEV GRP CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511336820.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-18
Publication Date
2025-12-05

AI Technical Summary

Technical Problem

In the current technology, there is little research on the transcription factor S1Fa in millet, which leads to the inhibition of plant growth under salt stress, manifested as yellowing, drying and even death of leaves, and a lack of effective stress resistance regulation means.

Method used

By overexpressing the millet transcription factor SiS1Fa, genetic engineering techniques can be used to enhance SiS1Fa expression in plants and regulate plant salt tolerance. This includes the application of amino acid sequence modifications or fusion proteins, combined with nucleic acid molecules, recombinant vectors, and transgenic technology to promote plant salt tolerance.

Benefits of technology

It improves the salt tolerance of plants, manifested as enhanced growth and biomass, reduced accumulation of reactive oxygen species, increased POD enzyme activity and phenylpropane biosynthesis, enhanced antioxidant capacity, reduced Na+ content and Na+/K+ ratio, and improved physiological state under salt stress conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065244A_ABST
    Figure CN121065244A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to application of a millet transcription factor S1Fa in regulation and control of plant stress resistance. The invention provides a transmembrane transcription factor SiS1Fa which has a CDS area length of 243 bp and is positioned in a cell membrane and a nuclear membrane, and plays an important role in the salt resistance process of millet. The millet plant with overexpressed SiS1Fa shows better growth condition and biomass under salt stress treatment, is obviously superior to WT, and particularly shows prominent ROS (reactive oxygen species) removal capability and oxidative damage relief.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the field of plant genetic engineering technology, and particularly relates to application of foxtail millet transcription factor S1Fa in regulation of plant stress resistance. BACKGROUND

[0002] With the influence of global climate change and human activities, the problem of land salinization is increasingly serious, which seriously affects local agricultural production and ecological environment. As an environmental factor threatening plant growth and crop yield, salt stress is particularly serious in saline-alkali environment, which causes plants to be inhibited, showing yellowing and drying of leaves, and even plant death.

[0003] Transcription factors interact with DNA sequences at the transcription level to regulate gene expression and control, which is a key step in gene expression and control. The structural diversity of transcription factors determines the diversity of expression and control functions. Transcription factors play an important role in the response of plant growth and development to biological or non-biological stress. At the same time, it is also a signal transduction network, and some cross exist between various signal transduction pathways, forming multiple combinations between regulatory factors. About 7% of the coding genes in plants are transcription factor-encoding genes, and studies have found that most of these genes are early response genes to biological and non-biological stress. S1Fa, a small peptide containing 70 amino acids, was first discovered in spinach, which negatively regulates rps1 expression. Its conserved domain contains a nuclear localization signal and a specific DNA binding site, and is highly conserved between dicotyledonous plants and monocotyledonous plants, mainly expressed in tissues such as roots and yellowing seedlings. More and more studies have found that S1Fa-like TFs respond to non-biological stress of plants, such as S1Fa-like in Brassica napus responding to salt stress stimulation; most members of S1Fa-like TFs in cotton (Gossypium hirsutum) are down-regulated in expression under non-biological stress stimulation; the expression of PtS1Fa1 and PtS1Fa2 in Populus trichocarpa is inhibited by drought and salt stress, and responds to hormone stimulation such as ABA, MeJA and SA. PtS1Fa2 increases antioxidant activity and reduces the accumulation of reactive oxygen species (ROS), thereby enhancing the drought tolerance of Populus trichocarpa. However, the transcription factor S1Fa has been less studied in foxtail millet. SUMMARY

[0004] In order to overcome the above problems, the application provides application of transcription factor S1Fa in regulation of plant stress resistance.

[0005] To achieve the above technical purposes, the technical scheme adopted by the present application is as follows: In a first aspect of the present application, the application of foxtail millet transcription factor S1Fa and biological materials related thereto in any of the following is provided: a1 ) use in modulating salt tolerance in plants; a2) use in breeding transgenic plants with improved salt tolerance; The foxtail millet transcription factor SiS1 Fa is a protein as shown in b1 ) or b2) or b3) or b4) below: b1 ) a protein with an amino acid sequence as shown in SEQ ID NO: 2; b2) a fusion protein with a tag linked to the N terminus and / or C terminus of a protein as shown in SEQ ID NO: 2; b3) a protein with the same function as a result of substitution or deletion or addition of one or several amino acid residues of the amino acid sequence as shown in SEQ ID NO: 2; b4) a protein with 75% or more homology to the amino acid sequence as shown in SEQ ID NO: 2 and with the same function.

[0006] In one or more embodiments, the biological material related to the foxtail millet transcription factor SiS1 Fa is any one of c1 ) to c9) below: c1 ) a nucleic acid molecule encoding the foxtail millet transcription factor SiS1 Fa; the sequence of the nucleic acid molecule is as shown in SEQ ID NO: 1 ; c2) an expression cassette containing the nucleic acid molecule of c1 ); c3) a recombinant vector containing the nucleic acid molecule of c1 ) or an expression cassette of c2); c4) a recombinant microorganism containing the nucleic acid molecule of c1 ) or an expression cassette of c2) or a recombinant vector of c3); c5) a transgenic plant cell line containing the nucleic acid molecule of c1 ) or an expression cassette of c2); c6) a transgenic plant tissue containing the nucleic acid molecule of c1 ) or an expression cassette of c2); c7) a transgenic plant organ containing the nucleic acid molecule of c1 ) or an expression cassette of c2); c8) a nucleic acid molecule for increasing the expression of the foxtail millet transcription factor SiS1 Fa; c9) an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ containing the nucleic acid molecule of c8).

[0007] In one or more embodiments, the modulation is promotion.

[0008] In one or more embodiments, the salt tolerance of the plant is manifested as any one of the following, d1) increasing the root system of the plant; d2) increasing the biomass of the plant; d3) reducing the Na+ content and the Na+ / K+ ratio in the plant; d4) reducing the accumulation of reactive oxygen species; d5) increasing the activity of POD enzyme; d6) increasing the expression of genes related to phenylpropanoid biosynthesis.

[0009] Preferably, the biomass in d2) includes total fresh weight, underground part fresh weight, total dry weight and underground part dry weight.

[0010] Preferably, the reactive oxygen species in d4) include O2 - , H2O2 and ROS.

[0011] Preferably, the genes related to phenylpropanoid biosynthesis in d6) include SiC4H.

[0012] In one or more embodiments, the plant is a monocotyledon or a dicotyledon; preferably, the plant is millet.

[0013] In a second aspect of the present application, a method for improving the salt tolerance of a plant is provided, comprising: overexpressing a millet transcription factor SiS1Fa gene in a plant by genetic engineering, wherein the nucleotide sequence of the millet transcription factor SiS1Fa gene is shown as SEQ ID NO: 1.

[0014] In one or more embodiments, the plant is a monocotyledon or a dicotyledon; preferably, the plant is millet.

[0015] In one or more embodiments, the overexpression is achieved by any one of the following methods: e1) by introducing a plasmid containing the gene; e2) by increasing the copy number of the gene on the chromosome of the plant; e3) by changing the promoter sequence of the gene on the chromosome of the plant; e4) by operably linking a strong promoter to the gene; e5) by introducing an enhancer.

[0016] In a third aspect of the present application, the use of a transgenic plant obtained by the method of the second aspect in plant breeding is provided.

[0017] In one or more embodiments, the breeding method comprises transgenesis, hybridization, backcrossing, selfing or vegetative reproduction.

[0018] The present application has the following advantages: The present application relates to the field of plant genetic engineering technology, and particularly relates to application of millet transcription factor S1Fa in regulating plant stress resistance. The present application provides a transmembrane transcription factor SiS1Fa with a CDS region length of 243 bp and located in cell membrane and nuclear membrane, and the SiS1Fa plays an important role in the process of salt resistance of millet. The millet plant overexpressing SiS1Fa shows better growth condition and biomass under salt stress treatment, and is significantly better than WT, especially in ROS clearance capacity and oxidative damage alleviation. Compared with the control group, the growth condition and biomass of SiS1Fa silencing strain under salt stress treatment are poor, and the Na + / K + The present application provides a transmembrane transcription factor SiS1Fa with a CDS region length of 243 bp and located in cell membrane and nuclear membrane, and the SiS1Fa plays an important role in the process of salt resistance of millet. The millet plant overexpressing SiS1Fa shows better growth condition and biomass under salt stress treatment, and is significantly better than WT, especially in ROS clearance capacity and oxidative damage alleviation. Compared with the control group, the growth condition and biomass of SiS1Fa silencing strain under salt stress treatment are poor, and the Na BRIEF DESCRIPTION OF DRAWINGS

[0019] The drawings constituting a part of the specification illustrate the present application and, together with the description, serve to explain the principles of the present application. It will be appreciated that the present application is not limited to the specific embodiments presented and that as such any modifications and / or improvements are considered appropriate.

[0020] Figure 1 (A) and the conserved motif sequence (B) of S1Fa protein phylogenetic evolution tree and conserved domain analysis; Figure 2 (A), the protein secondary structure (B) and the protein tertiary structure (C) analysis of SiS1Fa protein; Figure 3 (A), the transmembrane structure prediction (B), the signal peptide prediction (C) and the protein hydrophilicity analysis (D) of SiS1Fa protein; Figure 4 SiS1Fa gene chromosome distribution; Figure 5 Cis-acting element analysis of millet SiS1Fa gene; Figure 6 Relative expression of SiS1Fa gene in foxtail millet root under different time of salt treatment Figure 7 For the cloning of SiS1Fa gene and the construction of vector. Agarose gel electrophoresis detection map of SiS1Fa gene cloning (A) and colony PCR results of cloning vector (B); Figure 8 For the subcellular localization of SiS1Fa in tobacco leaves Figure 9 For the DNA level identification (A) and transcription level identification (B) of SiS1Fa overexpression strain Figure 10 For the physiological index determination of wild type and SiS1Fa overexpression plants under salt treatment, wherein the growth condition (A), fresh weight (B), root fresh weight (C), plant dry weight (D), root dry weight (E), plant height (F) and root length (G) of wild type and overexpression plants treated by 0 mM NaCl and 150 mM NaCl for 7 days Figure 11 For the salt treatment oxidation index statistics chart of wild type and SiS1Fa overexpression plants, wherein the NBT staining (A), superoxide anion (O2 - ) content (B), H2O2 content (C) and POD activity (D) of wild type and overexpression plants treated by 0 mM NaCl and 150 mM NaCl for 7 days Figure 12 For the relative expression detection of SiS1Fa silencing strain Figure 13 For the salt treatment physiological index determination of control plants and SiS1Fa silencing plants; wherein the growth condition (A), plant fresh weight (B), root fresh weight (C), plant dry weight (D), root dry weight (E), plant height (F) and root length (G) of control plants and SiS1Fa silencing plants treated by 0 mM NaCl and 150 mM NaCl for 7 days Figure 14 For the NBT staining (A) and DAB staining (B) of control plants and SiS1Fa silencing plants under salt treatment Figure 15 For the Na + , K + content determination chart of control plants and SiS1Fa silencing plants under salt treatment; the Na + content (A), K + content (B) and Na + / K + (C) of control plants and SiS1Fa silencing plants treated by 0 mM and 150 mM NaCl for 7 days Figure 16 Figure 13C is a bar graph showing the distribution of gene ontology (GO) categories for peaks associated with the SiS1 Fa transcription factor. Figure 17 Figure 13D is a bar graph showing the GO enrichment analysis of peak-associated genes. Figure 18 Figure 13E is a bar graph showing the KEGG enrichment analysis of peak-associated genes. Figure 19 Figure 13F is a bar graph showing the GO enrichment analysis (A) and KEGG enrichment analysis (B) of the promoter regions of peak-associated genes. Figure 20 Figure 13G is a bar graph showing the motif analysis of the promoter regions of peak-associated genes. Figure 21 Figure 13H is a bar graph showing the screening of downstream target genes regulated by the SiS1 Fa transcription factor, where ABCDEFG represent the expression levels of SiMYBS3, SiIAA23, SiBxOMT7, SiCYS12, SiC4H, SiTS1, and SiUGT5 / 3G, respectively. Figure 22 Figure 13I is a bar graph showing the luciferase reporter gene analysis of the SiS1 Fa transcription factor and SiC4H gene. Figure 23 Figure 13J is a bar graph showing the flavonoid content of wild-type and SiS1 Fa overexpression plants treated with 0 mM NaCl and 150 mM NaCl for 7 days. DETAILED DESCRIPTION

[0021] It should be noted that the following detailed description is merely exemplary and is intended to provide further description of the application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0022] It is to be understood that the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. It should also be noted that, as used herein, the term “and / or” includes any and all combinations of one or more of the associated listed items.

[0023] In order to enable persons skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below with specific examples.

[0024] The materials and related experiments involved in the following examples are as follows: 1.1 Plant materials have two kinds: including millet and tobacco, in which millet is inbred line Ci846, SiS1 Fa overexpression millet lines OE-4, OE-7 and OE-11; tobacco is Nicotiana benthamiana, used for Agrobacterium transient transformation experiment.

[0025] 1.2 Planting of Nicotiana benthamiana: Nicotiana benthamiana seeds are sown in prepared nutrient soil, and after the seedlings emerge, they are transplanted into flowerpots, one plant per flowerpot, and cultured in a phytotron (temperature 26 ℃, light 14 h / dark 10 h, humidity 50%) When 4-5 true leaves grow, Agrobacterium transient transformation experiment is carried out.

[0026] 1.3 Vector and bacteria: T-Vector pMD20 cloning vector from TaKaRa company, pCAMBIA1300-35S:GFP overexpression vector, pTRV2 vector, pGreenII 0800-Luc / Rluc vector, pPR3-N vector, pBT3-STE vector from laboratory preservation. Escherichia coli DH5α, Agrobacterium GV3101 from Jinan Yushuo Biological Technology Co., Ltd. Agrobacterium GV3101-pSoup19, yeast NMY51 competent from Coolaber company.

[0027] 1.4 Fresh and dry weight determination of plants: after 7 days of 0 mM and 150 mM NaCl treatment, the whole plant is washed clean and dried with absorbent paper, the fresh weight of the aboveground and underground parts is weighed using an electronic analytical balance, the plant height and root length are measured using a tape measure, and the materials are placed in an envelope and dried in an oven for 7 days, then the dry weight of the aboveground and underground parts is weighed using an electronic analytical balance.

[0028] 1.5 DAB and NBT staining: DAB staining: prepare 1 g / L DAB staining solution, pH=5.8, cut the same position and size of leaves of each strain treated with 0 mM NaCl and 150 mM NaCl for 7 days. Immerse the leaves in the staining solution, avoid light at 28 ℃ for 12 h, then decolorize with 80% ethanol until the leaves are green, and take pictures.

[0029] NBT staining: prepare 0.5 g / L NBT staining solution, note that NBT is dissolved in PBS (pH 7.2-7.4), cut the same position and size of leaves of each strain treated with 0 mM NaCl and 150 mM NaCl for 7 days. Immerse the leaves in the staining solution, avoid light at 28 ℃ for 3 h, then decolorize with 80% ethanol until the leaves are green, and take pictures.

[0030] 1.6 Determination of hydrogen peroxide (H2O2) content: The hydrogen peroxide content of WT and overexpression lines treated with 0 mM NaCl and 150 mM NaCl for 7 days was determined using the Solabio hydrogen peroxide content detection kit (BC3595), and the specific steps are described in the instructions.

[0031] 1.7 Determination of Na + , K + content: Weigh 0.1 g of sample into a test tube, add 10 mL Wahaha, seal and boil for 3 hours, then cool to room temperature. First, filter the solution through filter paper into a 10 mL centrifuge tube, then dilute with Wahaha purified water. Finally, filter the solution through a 0.22 µm water filter membrane, and determine using a flame spectrophotometer.

[0032] 1.8 Expression pattern analysis of millet SiS1Fa gene: SiActin-F and SiActin-R were used as internal reference primers, RT-SiS1Fa-F and RT-SiS1Fa-R were used as gene quantitative primers, and 150 mM NaCl salt-treated millet roots at different time points (0 h, 6 h, 12 h, 24 h, 48 h) were used as templates. The experimental method was based on the Aikuer quantitative kit, and 3 replicates were set for each treatment. The relative expression of millet S1Fa gene under different salt stresses was calculated according to the 2 --ΔΔCt method, and the data were plotted using Graphpad prism 8 software.

[0033] SiActin-F: CGCATATGTGGCTCTTGACT; SiActin-R: GGGCACCTAAATCTCTCTGC; RT-SiS1Fa-F: GAGGTCAACAAGGGCCTGAA; RT-SiS1Fa-R: AGCGCATAGTTCCCCACAAA.

[0034] Example 1 (1) S1Fa protein phylogenetic tree and conserved domain analysis: According to the S1Fa domain, it was found that the S1Fa gene family in millet contains only one, named SiS1Fa, and 16 homologous proteins from Arabidopsis, millet, sorghum, corn, rice, and wheat were selected to construct a phylogenetic tree. Through phylogenetic tree analysis, it was found that millet and sorghum both contain one S1Fa protein, and the SiS1Fa protein in millet has high homology with the SbS1Fa protein in sorghum, while the similarity with the homologous proteins in rice and Arabidopsis is lower (SiS1Fa: 0.71, SbS1Fa: 0.87, OsS1Fa: 0.63, AtS1Fa: 0.63). Figure 1SiS1Fa protein of foxtail millet and SbS1Fa protein of sorghum contain the same motif, and the motif contained in SiS1Fa protein of foxtail millet, SbS1Fa protein of sorghum and AtS1Fa protein of Arabidopsis thaliana is quite different, which may be due to the fact that foxtail millet and sorghum belong to monocotyledonous plants, while Arabidopsis thaliana belongs to dicotyledonous plants.

[0035] (2) Physicochemical properties and structure analysis of SiS1Fa protein The CDS length of SiS1Fa gene of foxtail millet is 243 bp, which encodes 80 amino acids. Through the analysis of physicochemical properties of SiS1Fa protein, Figure 2 SiS1Fa has an isoelectric point of 9.82, a hydrophobic index of -0.015, and a protein instability index of 34.12, and is subcellularly located in the nucleus. This indicates that SiS1Fa may be a basic amino acid with high hydrophilicity, which is not easy to degrade and is located in the nucleus. Analysis of the secondary structure of SiS1Fa protein of foxtail millet shows that the proportion of α-helix and random coil is high, accounting for 40.00% and 26.25%, Figure 2 respectively. Through the prediction of the tertiary structure of SiS1Fa protein, it is found that SiS1Fa protein is mainly composed of α-helix and random coil, Figure 2 which accounts for 48.62% and 23.62%, respectively.

[0036] (3) Analysis of SiS1Fa protein domain, transmembrane structure and signal peptide: Using SMART online tool to predict the domain of SiS1Fa protein, it is found that the protein has a conserved S1Fa domain, Figure 3 which may have the function of S1Fa transcription factor. The prediction results of transmembrane domain of SiS1Fa protein by TMHMM show that the protein contains a transmembrane domain, Figure 3 which may have the function of S1Fa transcription factor. The prediction results of transmembrane domain of SiS1Fa protein by TMHMM show that the protein contains a transmembrane domain, Figure 3 which may have the function of S1Fa transcription factor. The prediction results of transmembrane domain of SiS1Fa protein by TMHMM show that the protein contains a transmembrane domain, Figure 3 which may have the function of S1Fa transcription factor. The prediction results of transmembrane domain of SiS1Fa protein by TMHMM show that the protein contains a transmembrane domain,

[0037] (4) Chromosome distribution of SiS1Fa gene: The SiS1Fa gene is located on chromosome 7. Figure 4 as shown in

[0038] (5) Analysis of cis-acting elements of the SiS1Fa gene promoter: Transcription factors regulate target gene expression by binding to cis-elements and trans-elements in the promoter regions of downstream target genes. This regulation, in turn, affects plant growth and development, helping plants adapt to various adversities. Therefore, cis-elements and trans-elements in gene promoter regions play a crucial role. Regulatory element prediction was performed on the 2000 bp upstream of the start codon of the SiS1Fa gene, revealing that the SiS1Fa gene contains eight response elements. For example... Figure 5 As shown, the SiS1Fa gene promoter contains two elements related to abscisic acid response, two elements related to salicylic acid response, one element related to methyl jasmonic acid response, and three elements related to light response (Table 1). Under stress conditions, these cis-regulatory elements are crucial for regulating SiS1Fa gene expression and coping with stress. Therefore, analysis of cis-regulatory elements suggests that the SiS1Fa gene may have potential regulatory functions in response to different abiotic stresses.

[0039] Table 1. Analysis of cis-acting elements in the promoter of the millet SiS1Fa gene.

[0040] Example 2 To investigate whether SiS1Fa is involved in salt stress, the expression level of the SiS1Fa gene was examined under salt treatment at different time points. Figure 6 As shown, the expression level of the SiS1Fa gene increased with the increase of salt treatment time, and reached the highest value at 12 h. It is preliminarily speculated that the SiS1Fa gene may be involved in the salt stress response.

[0041] RT-SiS1Fa-F:GAGGTCAACAAGGGCCTGAA; RT-SiS1Fa-R: AGCGCATAGTTCCCCACAAA.

[0042] Example 3 Subcellular localization analysis of SiS1Fa: To investigate the biological function of SiS1Fa, the subcellular localization of the SiS1Fa protein was first determined. Using cDNA from WT plants as a template, the CDS sequence of SiS1Fa was amplified using SiS1Fa-F and SiS1Fa-R primers, and the target band was detected by 1% agarose gel electrophoresis. Figure 7 (A). After purification and recovery of the target fragment, it was ligated into the pCAMBIA1300-35S-GFP expression vector, transformed into competent E. coli cells, and verified by colony PCR. Figure 7The single colony with the brightest fluorescence was selected and used for plasmid extraction, and the extracted plasmid was sent to a company for sequencing. After the sequencing was correct, the pCAMBIA1300-35S:SiS1Fa-GFP recombinant expression vector was obtained.

[0043] SiS1Fa-F: ATGGCGGATCAGTTCGCG; SiS1Fa-R: TTACTCTCCTGGAGCAGAGACACCC; The pCAMBIA1300-35S:SiS1Fa-GFP recombinant expression vector and the pCAMBIA1300-35S-GFP vector were transformed into Agrobacterium, and then injected into tobacco leaves, and the GFP fluorescence signal was observed. The results showed that the GFP fluorescence signal of the pCAMBIA1300-GFP empty vector was uniformly distributed in the whole tobacco cell; while the green fluorescence of the pCAMBIA1300-SiS1Fa-GFP was specifically located in the cell membrane and nuclear membrane area. Figure 8 This result shows that the SiS1Fa protein is mainly located on the cell membrane and nuclear membrane.

[0044] Specific experimental process: 10 μL of the recombinant expression vector pCAMBIA1300-SiS1Fa-GFP, empty vector pCAMBIA1300-GFP, and P19 plasmid were respectively added to 100 μL of Agrobacterium competent cells, and then gently blown and sucked to mix, followed by 5 min on ice, 5 min in liquid nitrogen, 5 min at 37 °C, and 5 min on ice; in the clean bench, 900 μL of sterile LB liquid medium was added to a centrifuge tube, and then cultured in an Agrobacterium incubator at 28 °C for 2.5 h; centrifuged at 5000 rpm for 2 min, and the volume of the supernatant was 100 μL; after resuspension by blowing, 30 μL of the resuspended bacterial solution was uniformly coated on the medium containing the corresponding resistance, and then cultured at 28 °C for 12-16 hours. The GV3101 Agrobacterium containing the successfully transformed pCAMBIA1300-SiS1Fa-GFP and pCAMBIA1300-GFP, and the GV3101 Agrobacterium containing the P19 plasmid were obtained.

[0045] The transformed pCAMBIA1300-SiS1Fa-GFP and pCAMBIA1300-GFP GV3101 Agrobacterium, GV3101 Agrobacterium containing P19 plasmid were inoculated in LB liquid medium, and kanamycin and rifampicin were added to the medium; 28°C overnight culture to turbidity; After the turbidity of the bacterial solution, it was transferred to 50 mL of new LB liquid medium containing kanamycin and rifampicin resistance and 10 μL of 20 μM acetyl syringone (AS), and continued to be cultured in a 28°C incubator; Prepare MMA solution: 10 mM MgCl2, 10 mM MES, adjust the pH value to 5.6, then add 100 μM AS; When the OD 600 =0.9-1 or so, 3000 g centrifugation for 10 min, discard the supernatant and retain the bacterial body, resuspend the bacterial solution with 20 mL of MMA, avoid light and stand for 3 h, then mix with P19 according to 1:1; Water the tobacco and avoid light for 8 h, then inject from the back of the leaf, inject the whole leaf. After the injection is completed, culture for 36-48 h, and use a two-photon laser confocal microscope (Germany Leica TCS SP8 MP) to observe the fluorescence signal.

[0046] Example 4 Research on the function of SiS1Fa gene of Setaria italic under salt stress Construction of overexpression strain: (1) Cloning of SiS1Fa gene of Setaria italic and construction of expression vector Using the cDNA of Setaria italic as the template, the primers SiS1Fa-F and SiS1Fa-R were used for amplification. After the PCR reaction was completed, 1% agarose gel electrophoresis was performed for verification, and the target band was cut and recovered using the agarose gel DNA recovery kit of Nanjing Nuai Zhan Company. The subsequent detection was performed by Beijing Qikong Biotechnology Co., Ltd. The first target DNA, i.e., the CDS sequence of SiS1Fa gene of Setaria italic (the sequence is shown in SEQ ID NO: 2), was obtained, and the protein sequence is shown in SEQ ID NO: 1.

[0047] SiS1Fa-F: ATGGCGGATCAGTTCGCG; SiS1Fa-R: TTACTCTCCTGGAGCAGAGACACCC; Using the first target DNA as the cDNA template, the primers 1300S1Fa-F and 1300S1Fa-R with SacI and BamHI restriction sites were used to amplify the target gene. After the PCR was completed, the gel was recovered and purified, and the second target gene was obtained.

[0048] 1300S1Fa-F: GGTACCATGGCGGATCAGTTCGCG; 1300S1Fa-R: GGATCCCTCTCCTGGAGCAGAGACACCC; The second target gene and pCAMBIA1300-GFP vector were double digested with SacI and BamHI, and the digested DNA fragments and the digested vector were ligated using T4 DNA ligase to obtain a first ligation product.

[0049] Transformation of E. coli: 10 μL of the first ligation product was added to 100 μL of ice-bath melted competent cells DH5α, and after gentle blowing and mixing, it was ice-bathed for 30 min; it was quickly heated at 42°C for 45 s and immediately ice-bathed for 2 min; 750 μL of LB liquid was added to the centrifuge tube in a sterile environment; it was cultured in a 37°C incubator at 180 rpm for 1.5 h; it was centrifuged at 5000 rpm for 1 min; the supernatant was discarded, and about 100 μL of supernatant was retained for resuspending the bacterial cells; 30 μL of bacterial solution was uniformly spread on a LB solid plate containing kanamycin; the plate was inverted and placed in a 37°C incubator for 12-16 hours. After plasmid extraction and sequencing, the recombinant expression vector pCAMBIA1300-SiS1Fa-GFP was obtained.

[0050] Agrobacterium transformation steps: 10 μL of the recombinant expression vector pCAMBIA1300-SiS1Fa-GFP and the control empty vector and pCAMBIA1300-GFP were added to 100 μL of Agrobacterium competent cells, respectively, and after gentle blowing and mixing, they were sequentially ice-bathed for 5 min, liquid nitrogen for 5 min, 37°C for 5 min, and ice-bathed for 5 min; in a clean bench, 900 μL of sterile LB liquid was added to the centrifuge tube, and it was cultured in a 28°C Agrobacterium incubator for 2.5 h; it was centrifuged at 5000 rpm for 2 min, and the volume of the supernatant was 100 μL; after resuspension by blowing, 30 μL of resuspended bacterial solution was uniformly spread on the medium containing the corresponding resistance, and it was cultured at 28°C overnight for 12-16 hours.

[0051] (2) Screening and identification of millet SiS1Fa overexpression lines In order to further study the biological function of SiS1Fa, SiS1Fa overexpression lines were constructed. The leaf DNA of WT and SiS1Fa overexpression plants was used as a template, and 1300-F and 1300-R were used as primers for PCR reaction. The results are as follows Figure 9As shown in Fig. 2A, compared with WT, there were 1000 bp target bands in lanes OE-2, OE-3, OE-4, OE-5, OE-7, OE-8, OE-11 and OE-16, indicating that the SiS1Fa overexpression vector was successfully transformed. The target bands of OE-3, OE-4, OE-7, OE-11 and OE-16 were selected for further detection of the expression level of SiS1Fa gene. Figure 9 As shown in Fig. 2B, the identification results showed that the expression level of SiS1Fa gene in each plant was increased, and the OE-4, OE-7 and OE-11 strains with relatively high expression were selected for subsequent experiments.

[0052] 1300-F: ATGACGCACAATCCCACTATCCTT; 1300-R: ACCCCGGTCAACAGCTCCTC.

[0053] (3) Phenotype and biomass analysis of wild type and SiS1Fa overexpression strains under salt treatment Firstly, the seeds of Ci846, SiS1Fa overexpression strains OE-4, OE-7 and OE-11 with uniform morphology and full particles were placed in 75% alcohol solution for two times, each time lasting for 1 minute. Then, the seeds were washed with distilled water for five times, and then uniformly placed on 90 mm plastic dishes covered with absorbent paper, and cultured at 22 ℃ with light for 16 h / dark for 8 h. After the seeds germinated, they were transferred to flowerpots mixed with proper water at a ratio of 1:1 of nutrient soil and vermiculite, and cultured in an artificial climate chamber (temperature 26 ℃, light for 14 h / dark for 10 h, humidity 50%). The seeds were watered in time every 2 days. When the millet grew to the three-leaf-one-heart stage, the millet seedlings with uniform growth were selected for treatment.

[0054] The millet prepared for salt treatment was transferred to a clean and dry tray, treated with 50 mM NaCl and 100 mM NaCl for 12 hours, and then treated with 150 mM NaCl for seven days. After that, the millet was photographed and sampled, and stored in a-80 ℃ refrigerator for standby.

[0055] In order to verify whether SiS1Fa is involved in salt stress response, the WT, OE-4, OE-7 and OE-11 seedlings with uniform growth at the three-leaf-one-heart stage were treated with 0 mM NaCl and 150 mM NaCl for 7 days, and their growth conditions were observed. The results showed that the growth of the overexpression strains treated with 0 mM NaCl was similar to that of the WT under normal conditions, and the difference was not significant; however, under 150 mM NaCl stress, the growth of the overexpression strains was obviously better than that of the WT (Fig. 3). Figure 10(A). Biomass-related indicators were measured, and it was found that under salt-free stress (0 mM NaCl), there was no significant difference in total fresh weight and root fresh weight between the overexpression line and the WT plant; however, when subjected to 150 mM NaCl stress, the total fresh weight and root fresh weight of the overexpression line were significantly higher than those of the WT line. Figure 10 (B and C). Dry weight determination results showed that the dry weight of the aboveground parts and roots of the overexpression lines treated with 150 mM NaCl was significantly higher than that of WT ( ). Figure 10 (D, E). Regarding plant height, there was no significant difference between the overexpression lines and WT under salt-free stress (0 mM NaCl), but under 150 mM NaCl stress, the plant height of the overexpression lines was significantly higher than that of WT. Figure 10 In addition, under 150 mM NaCl stress, the root length of the overexpressing lines was also significantly higher than that of the WT lines. Figure 10 (G). In summary, the biomass of the SiS1Fa overexpression lines under salt stress was significantly higher than that of WT, indicating that they have strong salt tolerance.

[0056] (4) Detection of oxidative indicators in wild-type and SiS1Fa overexpression lines under salt treatment Salt stress induces O2 - The production of H2O2 disrupts the redox balance within plants, damaging cell structure and function. Under normal conditions, plants can effectively remove O2 through their own antioxidant systems. - Reactive oxygen species (ROS) are present in plants, maintaining intracellular redox homeostasis. NBT staining is a method for observing O2 levels in plants. - Common methods for determining the content. Leaves of similar size and location were selected for NBT staining. Results showed that the color changes of the SiS1Fa overexpression line treated with 0 mM NaCl were essentially the same as those of the WT line. However, the SiS1Fa overexpression line showed a significantly lower degree of bluening under 150 mM NaCl stress compared to the WT line. Figure 11 (A) indicates that the SiS1Fa overexpression lines accumulated less O2 under salt stress. - O2 in the leaves of various millet lines after salt treatment was measured. - The content of O2 in the SiS1Fa overexpression line was found to be similar to that in WT under 0 mM NaCl conditions. - The content was basically the same; under 150 mM NaCl conditions, the O2 content of the SiS1Fa overexpression line and WT was similar. - The significantly increased O2 content indicates that all lines suffered varying degrees of oxidative damage; however, the O2 content of the overexpressing lines treated with 150 mM NaCl was significantly higher. - The accumulation was significantly reduced compared to WT. Figure 11Fig. 3B. The above results show that SiS1 Fa overexpression lines have stronger antioxidant capacity under salt stress, and can more effectively reduce oxidative damage.

[0057] O2 - H2O2 is generated by SOD catalysis. Therefore, we detected the H2O2 content of each line of millet, and found that under 0 mM NaCl conditions, the H2O2 content of SiS1 Fa overexpression lines and WT had no significant difference; however, after 150 mM NaCl treatment for 7 days, the H2O2 content of SiS1 Fa overexpression lines and WT increased significantly, but the H2O2 accumulation of SiS1 Fa overexpression lines was significantly lower than that of WT (Fig. 3C). Under salt stress environment, overexpression of SiS1 Fa gene effectively inhibited the generation of H2O2, and significantly enhanced the tolerance of plants to oxidative damage. This result further confirmed that SiS1 Fa plays a key role in antioxidant defense. Figure 11

[0058] Antioxidant enzyme POD plays an important role in plant growth and development and response to stress environment. After salt treatment, the activity of POD in the leaves of different lines of millet was determined. As shown in Fig. 3D, under 0 mM NaCl conditions, the POD activity of SiS1 Fa overexpression lines and WT was basically the same, and under 150 mM NaCl treatment, the POD activity of WT and SiS1 Fa overexpression lines increased, but the POD activity of overexpression lines increased more significantly, about 1.5 times of WT. This result shows that SiS1 Fa overexpression lines can more efficiently activate the activity of POD enzyme under salt stress, thereby enhancing their antioxidant capacity. Figure 11

[0059] Example 5 (1) Construction of SiS1 Fa silenced plants: Construction of recombinant expression vector: ​​The first target DNA is homologously amplified by PCR using primers SiS1Fa-VIGS-F and SiS1Fa-VIGS-R, and the target gene is obtained after sequencing. The vector pTRV2 is digested (BamH1 and Sma1 double digestion), and the target gene and the digested vector are ligated using homologous recombinase to obtain the ligation product. The 10 μL ligation system is as follows: 2×CE IIBuffer: 2 μL; Exnase II: 1 μL; double-digested vector: 3 μL; PCR amplification product: 2 μL; ddH2O: 2 μL; 37°C reaction for 30 min, then reduce to 4°C or immediately place on ice to cool. Thaw the DH5α competent cells on ice, add the above 5 μL second ligation product to 100 μL competent cells, mix gently, and stand on ice for 30 min; 42°C water bath for 45 s, then immediately place on ice for 2 min cooling; add 700 μL LB medium without antibiotics, 200 rpm 37°C shaking for 1 h; plate the LB solid medium containing kanamycin in a 37°C incubator; 5000 rpm centrifugation for 3 min, discard the supernatant; resuspend the bacteria, and gently spread them on the plate containing kanamycin using a sterile spreader; invert culture in a 37°C incubator for 12 h; the colonies that are positive in colony PCR are inoculated into liquid LB medium containing kanamycin and cultured overnight, the plasmid is extracted, and the recombinant expression vector pTRV2-SiS1Fa is obtained after sequencing.

[0060] SiS1Fa-VIGS-F: GACGCACAATCCCACTATCC; SiS1Fa-VIGS-R: GACACGGATCTACTTAAAGAACCG; Infection solution preparation: pTRV1, pTRV2:00, pTRV2-SiS1Fa were inoculated into 5 mL LB liquid medium containing 25 μg / mL Kan and 50 μg / mL Rif, and cultured in a 28°C incubator with shaking to activate. After the bacterial solution became turbid, it was transferred into new LB liquid medium containing 25 μg / mL Kan and 50 μg / mL Rif, and continued to be cultured in a 28°C incubator with shaking until OD600=0.6. pTRV1 was mixed with pTRV2:00, pTRV2-SiS1Fa bacterial suspension 1:1, and acetyl-syringone (AS) (19.62 mg ml-1), cysteine (Cys) (400 mg ml-1) and Tween-20 (5 ml L-1) were added and mixed to obtain the infection solution.

[0061] Infection: The just germinated seeds of foxtail millet were soaked in the prepared infection buffer, vacuum infiltrated in a vacuum drying oven (-95 kPa) for 120 min. After vacuum infiltration, the seedlings were co-cultured with Agrobacterium for 3 h, and then the seeds were laid on wet filter paper to germinate.

[0062] (2) Identification of SiS1Fa gene silencing lines: To further detect the response of SiS1Fa gene deletion to salt stress, virus-induced gene silencing (VIGS) technology was used to silence the SiS1Fa gene of foxtail millet to obtain plants with silenced SiS1Fa gene expression. By detecting the expression amount of SiS1Fa gene in the same part of VIGS treated lines, it was found that the expression amount of SiS1Fa was knocked down in most of the 28 lines Figure 12 The plants with more than 50% relative expression reduction were selected for subsequent experiments.

[0063] (3) Phenotype and biomass analysis of control plants and SiS1Fa silenced plants under salt treatment: Select foxtail millet seeds with uniform size and full grains, first rinse with tap water for 1-1.5 h, then sterilize with 10% NaClO for 5 min, 75% alcohol for 3 min, and then wash with sterile distilled water for 5 times. The treated seeds were evenly placed in 90 mm plastic dishes lined with absorbent paper, and cultured in the tissue culture room (light 16 h / dark 8 h, 22°C). When the seeds were 1.5-3 mm long, they were infected. After infection, the seeds were evenly placed in 90 mm plastic dishes lined with absorbent paper, and cultured in the tissue culture room (light 16 h / dark 8 h, 22°C). After the seeds germinated, they were transferred to flowerpots mixed with proper water, and cultured in an artificial climate chamber (temperature 26°C, light 14 h / dark 10 h, humidity 50%). Water was added every 2 days. When the foxtail millet grew to the three-leaf-one-heart stage, foxtail millet seedlings with uniform growth were selected for salt stress treatment.

[0064] The foxtail millet seedlings prepared for salt treatment were transferred to a clean and dry tray, treated with 50 mM NaCl, 100 mM NaCl for 12 hours, and then treated with 150 mM NaCl for seven days. Photographs were taken and samples were taken for preservation in a -80°C refrigerator.

[0065] Mm NaCl and 150 mM NaCl for 7 days. It was found that the growth status of each plant was basically the same under 0 mM NaCl treatment; however, under 150 mM NaCl treatment, the pTRV:SiS1Fa silenced line was shorter than the pTRV:00 line (Fig. 1A). Figure 13 Biomass index of pTRV:00 and pTRV:SiS1Fa plants was determined, and it was found that there was no significant difference in the aboveground fresh weight, root fresh weight and plant height of pTRV:00 and pTRV:SiS1Fa plants under 0 mM NaCl condition; however, under 150 mM NaCl stress, the aboveground dry fresh weight, root dry fresh weight, root length and plant height of the pTRV:SiS1Fa silenced line were significantly lower than those of the WT (Fig. 1B-G). Figure 13 The above results showed that SiS1Fa gene silencing significantly reduced the salt tolerance of millet.

[0066] (4) NBT and DAB staining of control plants and SiS1Fa silenced plants under salt treatment: In order to detect the change of ROS accumulation level in control plants and SiS1Fa silenced plants, NBT and DAB staining were performed on control plants and SiS1Fa silenced plants. It was found that there was no obvious difference in NBT staining of each plant under no salt stress (0 mM NaCl); however, under 150 mM NaCl treatment, the blue spots in the leaves of the pTRV:SiS1Fa silenced line were significantly more than those of the pTRV:00 control line (Fig. 2A). Figure 14 DAB staining found that the staining degree of the pTRV:SiS1Fa silenced line was significantly deeper than that of the pTRV:00 control line under 150 mM NaCl stress (Fig. 2B), which was consistent with the NBT staining result. The above results showed that the silencing of SiS1Fa gene led to a significant increase in the accumulation of reactive oxygen species in millet. Figure 14

[0067] (5) Na + , K + content determination of control plants and SiS1Fa silenced plants under salt treatment Under no salt stress (0 mM NaCl), there was no obvious difference in the Na + content of control plants and SiS1Fa silenced plants; however, under 150 mM NaCl treatment, the Na + content of the pTRV:SiS1Fa silenced line was higher than that of the pTRV:00 control line (Fig. 3A), and the K + content of the pTRV:SiS1Fa silenced line was lower than that of the pTRV:00 control line (Fig. 3B).​+ The content was basically consistent with the pTRV:00 control line Figure 15 B), the Na content of the pTRV:SiS1 Fa silenced line was higher than that of the pTRV:00 control line + / K + The ratio was higher than that of the pTRV:00 control line Figure 15 C), which indicated that the ion homeostasis of the SiS1 Fa silenced plant was damaged, thereby weakening the salt tolerance.

[0068] Example 6 In order to further explore the regulatory network of the SiS1 Fa gene in the response to salt stress, the DNA affinity purification sequencing (DAP-seq) technology was used to systematically screen the downstream target genes that may be regulated by the SiS1 Fa gene. Through this high-throughput screening method, the regulatory mechanism of SiS1 Fa at the transcriptional level and its molecular action network in the salt stress signaling pathway were revealed.

[0069] (1) Genomic region analysis Two groups of DAP-seq identified 465 and 374 genomic region data (Peaks), respectively. Through integrated analysis, 114 Peaks with consistency were identified Figure 16 A). The ratio of the statistics map ratio was greater than 98%, so these 114 related data had high data reliability.

[0070] The whole genome functional region is divided into the region from 2 kb upstream of the gene transcription start site (TSS) to the TSS, the 5' non-coding region, the 3' non-coding region, the exon region, the intron region, the region after the transcription termination position, and the intergenic region (the region defined as the intergenic region except the above). In this study, the whole genome functional region of the 114 Peaks was annotated and statistically analyzed, and the results showed that about 12.4% of the Peaks were significantly enriched in the promoter region Figure 16 B), suggesting that these regions may have important regulatory functions.

[0071] (2) GO and KEGG enrichment analysis of Peak-related genes Through GO function enrichment analysis, it was found that the s-adenosylmethionine-dependent methyltransferase activity-related genes showed obvious enrichment in the molecular function level; from the biological process, these genes were more involved in the leaf senescence process, gene expression regulatory network, and plant hypersensitive response physiological processes; and in the cell component, the plasma membrane anchor-related genes were significantly enriched Figure 17 ).

[0072] Through KEGG pathway enrichment analysis, such as Figure 18As shown in Table 2, it was found that the Peak-related genes were mainly involved in the following biosynthesis pathways: significant enrichment of stilbenoids, diarylheptanoids and gingerol biosynthesis in secondary metabolite synthesis, enrichment of flavonoid biosynthesis and phenylpropanoid biosynthesis, suggesting that plants may respond to environmental stress by synthesizing antioxidant substances. In terms of amino acid metabolism, tryptophan metabolism and phenylalanine, tyrosine and tryptophan biosynthesis were significantly enriched, and in terms of energy metabolism, carbon fixation and glycolysis / gluconeogenesis pathways were enriched in photosynthetic organisms, indicating that energy metabolism played a core role in plant response to stress. And enrichment of plant hormone signal transduction and MAPK signal pathway and other signal transduction and stress response pathways.

[0073] (3) GO and KEGG enrichment analysis of the Promoter interval of Peak-related genes: Since transcription factors mainly play a regulatory role by binding to the adjacent region of the transcription start site of downstream target genes, GO functional annotation and enrichment analysis were performed on the Promoter interval of Peak-related genes. As shown in Table 3, Figure 19 As shown in Table 3, the results showed that the related genes were significantly enriched in cell composition, mainly involving cytoplasm, nucleus and other cell components. In addition, some genes were involved in ATP binding and plant defense response, suggesting that SiS1Fa gene may play an important role in energy metabolism and stress response.

[0074] Through KEGG pathway enrichment analysis of the Promoter interval of Peak-related genes, it was found that the related genes were mainly enriched in carbon fixation pathways in photosynthetic organisms, amino sugar and nucleotide sugar metabolism pathways, and phenylpropanoid biosynthesis pathways. This analysis result provides an important clue for studying the role of SiS1Fa gene in plant metabolic regulation and stress response.

[0075] (4) Motif analysis of the Promoter interval Motif analysis of the Promoter interval was performed, as shown in Table 4, Figure 20 It was predicted that the GAAATTCDTAGAAATTMGTAG motif might be the binding element of SiS1Fa gene.

[0076] (5) Screening and verification of downstream target genes regulated by SiS1Fa transcription factor: In order to screen the downstream target genes of SiS1Fa transcription factor: 7 genes with higher credibility were selected for quantitative analysis based on DAP-seq data, including auxin-activated signal pathway SiMYBS3, SiIAA23 gene, methylation-related pathway SiBxOMT7 gene, stress-resistant SiCYS12 gene and flavonoid synthesis-related SiC4H, SiTS1, SiUGT5 / 3G genes. The quantitative analysis resultsFigure 21 It was found that the expression levels of SiMYBS3, SiIAA23, SiBxOMT7, SiCYS12, SiC4H, SiTS1, SiUGT5 / 3G changed to varying degrees under normal conditions and 150 mM NaCl stress treatment, but only the relative expression levels of SiC4H gene in SiS1Fa overexpression lines were significantly up-regulated. This expression pattern indicates that the SiC4H gene may be regulated by the SiS1Fa transcription factor, so we choose SiC4H gene as the candidate downstream target gene of SiS1Fa for further verification.

[0077] Visual analysis of the promoter of the key gene SiC4H in phenylpropanoid biosynthetic pathway, according to the DAP-seq predicted GAAATTCTAGAAATTMGTA binding sequence matched to the corresponding sequence AAAATTAATACGAAGGTATAA on the C4H promoter. To further verify whether SiS1Fa and SiC4H promoter interact with each other, we cloned the promoter region of 500 bp upstream and downstream of the predicted binding sequence and constructed it into the pGreenII 0800-LUC dual luciferase reporter vector, transformed Nicotiana benthamiana leaves, and detected luciferase activity using a live imaging system. As shown in FIG. 6, SiS1Fa transcription factor can promote the expression of SiC4H. Figure 22

[0078] KPNISiC4Hluc-F and SMALSiC4HLUC-R were used to amplify the target gene (promoter region of 500 bp upstream and downstream of the binding sequence) with homologous arms, and kpn1 and Sma1 were used to double digest pGreenII 0800-LUC, and then connected by homologous recombination; after transforming E. coli with the ligation product, the plasmid was extracted, and the recombinant expression vector pGreenII 0800-LUC was obtained after sequencing.

[0079] KPNISiC4Hluc-F: GGGCGAATTGGGTACCTCTGTGCTTCTCCTCATGTATT; SMALSiC4HLUC-R: ACTAGTGGATCCCCCGGGAAAAACTTGTAAACTGCCCAAT.

[0080] Promoter region of 500 bp upstream and downstream of the binding sequence: ​TTTATTTTGATAACAAACATCGTCCTTCTCTATATTTATATAGTTCTACTGTCATTCATTTGTCTTTCTTGTCTATTCAACGAATATAACCTATCAATTCCTTTGAGCTCTAACCGAGCAAGGGATCATGAGTTACCATCATATGGGATCAATTATTGAACATAAAGTTTCATACATCTATGTATCGTTCATGAAAAAAAAGGTAAACGGAAAAATAACAACCAAACACTTGGAACATGGACCAGAGTCAAAAGGAAGCTCTCACCTACCCACCAAAAAACCTTTTCTGTGCTACTCCAAACCCCAAAAATCATTGGCCACACATCTCCTCCACTCTGGTACACACCCTGCAAGCCCAACCAAGCGCAGCGCCCTCACTGCCGGTGGGCCCCGACCGTGGACTCACTAACGCCGCATCCACCAAACCCCCTCCGGTCCTCCCCTACGGCCCTACCTACCGCATCGCCGTCAATTGTAACGCCAACTCCTCTGTCGTCCCGC.

[0081] (6) Flavonoid content determination in wild type and SiS1Fa overexpression lines under salt treatment: Based on the DAP-seq data analysis and the results of dual-luciferase reporter gene system, it was found that SiS1Fa transcription factor might be involved in plant salt stress response by regulating the expression of SiC4H, a gene related to phenylpropanoid biosynthesis pathway. The phenylpropanoid pathway can provide key precursors for the biosynthesis of flavonoids, and flavonoids also occupy a core position in the plant secondary metabolic network. Therefore, the flavonoid content in WT and SiS1Fa overexpression lines under salt treatment was determined to verify whether SiS1Fa gene could regulate the synthesis of flavonoids. The results showed that there was little difference in the flavonoid content between WT and SiS1Fa overexpression lines under normal growth conditions (0 mM NaCl); the flavonoid content of plants increased significantly after 7 days of 150 mM NaCl treatment, and the increase in flavonoid content of SiS1Fa overexpression lines was significantly higher than that of WT ( Figure 23 ). The above results suggest that SiS1Fa gene may regulate the expression of SiC4H, a gene related to phenylpropanoid biosynthesis, to affect the content of flavonoids to cope with salt stress.

[0082] The above merely provides the preferred embodiments of the present application, and is not used to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the principles and technical scope of the present application shall fall into the scope of the present application.

Claims

1. Use of foxtail millet transcription factor SiS1 Fa and biological material related thereto in any of the following: a1) regulating plant salt tolerance; a2) cultivating transgenic plants with improved salt tolerance; said foxtail millet transcription factor SiS1 Fa is a protein as shown in b1), b2), b3) or b4) below: b1) a protein with an amino acid sequence as shown in SEQ ID NO: 2; b2) a fusion protein with a tag linked to the N-terminus and / or C-terminus of the protein as shown in SEQ ID NO: 2; b3) a protein with the same function obtained by substitution, deletion or addition of one or more amino acid residues of the amino acid sequence as shown in SEQ ID NO: 2; b4) a protein with the same function having 75% or more homology with the amino acid sequence as shown in SEQ ID NO:

2.

2. Use according to claim 1, wherein The biological material related to the foxtail millet transcription factor SiS1 Fa is any of the following c1) to c9): c1) a nucleic acid molecule encoding the foxtail millet transcription factor SiS1 Fa; the sequence of said nucleic acid molecule is as shown in SEQ ID NO: 1; c2) an expression cassette containing the nucleic acid molecule of c1); c3) a recombinant vector containing the nucleic acid molecule of c1) or the expression cassette of c2); c4) a recombinant microorganism containing the nucleic acid molecule of c1) or the expression cassette of c2) or the recombinant vector of c3); c5) a transgenic plant cell line containing the nucleic acid molecule of c1) or the expression cassette of c2); c6) a transgenic plant tissue containing the nucleic acid molecule of c1) or the expression cassette of c2); c7) a transgenic plant organ containing the nucleic acid molecule of c1) or the expression cassette of c2); c8) a nucleic acid molecule for increasing the expression of the foxtail millet transcription factor SiS1 Fa; c9) an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ containing the nucleic acid molecule of c8).

3. The use according to claim 1, wherein the compound is ###0002### The regulation is promotion.

4. The use according to claim 1, wherein The plant salt tolerance is manifested in any of the following, d1) improved root system of the plant; d2) improved biomass of the plant; d3) reduced Na+ content and Na+ / K+ ratio in the plant; d4) reduced accumulation of reactive oxygen species; d5) improved POD enzyme activity; d6) improved expression of genes related to phenylpropanoid biosynthesis; Preferably, the biomass in d2) includes total fresh weight, underground part fresh weight, total dry weight and underground part dry weight. Preferably, in d4) the active oxygen comprises: O2 - , H2O2 and ROS; Preferably, the genes related to phenylpropanoid biosynthesis in d6) include SiC4H.

5. The use according to claim 1, wherein The plant is a monocotyledon or a dicotyledon; preferably, it is foxtail millet.

6. A method for increasing salt tolerance in plants, characterized by, It comprises: overexpressing the foxtail millet transcription factor SiS1 Fa gene in plants by genetic engineering means, the nucleotide sequence of said foxtail millet transcription factor SiS1 Fa gene being as shown in SEQ ID NO:

1.

7. The method of claim 6, wherein, The plant is a monocotyledon or a dicotyledon; preferably, it is foxtail millet.

8. The method of claim 6, wherein, The overexpression is achieved by any of the following means: e1 ) by introducing a plasmid having said gene; e2) by increasing the copy number of said gene on the plant chromosome; e3) by changing the promoter sequence of said gene on the plant chromosome; e4) by operably linking a strong promoter to said gene; e5) by introducing an enhancer.

9. Use of a transgenic plant obtained by the method of any one of claims 6 to 8 in plant breeding.

10. Use according to claim 9, wherein The breeding method comprises transgenesis, crossing, backcrossing, selfing or clonal propagation.