Application of OsRTD1 gene in improving drought resistance of rice

Abstract

The invention provides application of an OsRTD1 gene in improving drought resistance of rice, and belongs to the technical field of gene engineering and rice drought resistance. The nucleotide sequence of the OsRTD1 gene is as shown in SEQ ID NO: 1, and the amino acid sequence of the protein coded by the OsRTD1 gene is as shown in SEQ ID NO: 2. Compared with a wild plant, the survival rate of the OsRTD1 gene mutant plant osrtd1 under the drought stress of PEG induction and soil dehydration is remarkably improved, the survival rate of the OsRTD1 gene overexpression plant OsRTD1-OE under the drought stress is remarkably reduced, the relative water loss rate of dehydrated leaves is higher, and the survival rate of the OsRTD1 gene overexpression plant OsRTD1-OE under the drought stress is remarkably reduced. The total grain number, the solid grain number, the total grain weight and the like of the OsRTD1 gene mutant plant osrtd1 under the stress of field drought are obviously higher than those of a wild plant. The OsRTD1 gene is a potential candidate new target for regulating and controlling a rice drought resistance mechanism.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and drought-resistant rice technology, and particularly to... OsRTD1 Application of genes in improving drought resistance in rice. Background Technology

[0002] rice( Oryza sativa Rice (L.) is one of the most important food crops for humankind, meeting the food needs of more than 50% of the world's population. As a staple food for the world's population, it provides up to 80% of the daily calorie intake for the vast majority, especially in Asia (Sahebi, 2018). However, in recent years, with global warming, rice production has been significantly reduced due to drought, resulting in losses amounting to hundreds of millions of dollars (Gutpa, 2020). Drought is a major environmental stressor affecting the growth and productivity of most field crops, especially rice. It is estimated that by 2050, more than 50% of the world's arable land will be affected by drought. Plant drought resistance mechanisms are often accompanied by reduced yields, and drought resistance is a complex trait composed of multiple mechanisms such as drought avoidance, drought tolerance, and drought recovery, as well as hundreds of genes with relatively minor impacts (Fang and Xiong, 2015). Interactions with the environment also have a significant impact on drought resistance (Farooq et al., 2009, Hu and Xiong, 2014). Therefore, the molecular mechanisms of drought resistance in rice and its evolutionary process in rice remain unknown. Therefore, elucidating the drought resistance mechanisms of rice and exploring new germplasm resources to achieve both drought resistance and yield reduction is particularly necessary. Drought stress induces the production of reactive oxygen species (ROS) and may lead to growth retardation or even cell death. Under normal conditions, ROS production and scavenging maintain a delicate balance. However, under drought stress, this balance may be disrupted, leading to a sharp increase in ROS production. When ROS levels exceed a certain threshold, it can cause slowed growth and even programmed cell death (PCD). To resist drought stress, plants must scavenge excess ROS and restore ROS homeostasis. Several ROS scavenging-related genes have been reported to positively regulate dehydration tolerance, such as... DMS1 , SNAC3 and OsLG3 However, the complex molecular network controlling ROS scavenging in plants remains to be elucidated.

[0003] Autophagy, as a highly conserved degradation mechanism in eukaryotic organisms, can degrade oxidized proteins or organelles damaged by ROS caused by drought to maintain cellular homeostasis and provide nutrients, while protecting plants from stress damage. However, the mechanism of autophagy regulating drought resistance in rice is still unclear. The expression of autophagy-related genes in rice is induced by drought, and the core protein OsATG8 can interact with the flavonoid glycosyltransferase RTD1. Antioxidants such as flavonoids are considered another effective way to respond to drought stress. Glycosylation of glycosyltransferase on substrates such as flavonoids can enhance their stability, biological activity, water solubility, etc., but RTD1 The role of the gene in the response of rice to drought stress is not clear. SUMMARY

[0004] To overcome the problems in the related art, the purpose of the present application is to provide OsRTD1 The gene has important significance for improving drought resistance of rice and can be used as a new target for improving drought resistance of rice. OsRTD1 The gene has important significance for improving drought resistance of rice and can be used as a new target for improving drought resistance of rice.

[0005] OsRTD1 The gene has important significance for improving drought resistance of rice and can be used as a new target for improving drought resistance of rice. OsRTD1 The nucleotide sequence of the gene is shown as SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO: 2. OsRTD1 The gene negatively regulates drought tolerance of rice.

[0006] In the preferred technical solution of the present application, the OsRTD1 The amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO: 2.

[0007] In the preferred technical solution of the present application, the OsRTD1 The gene is mutated or knocked out to obtain a mutant plant osrtd1.

[0008] In the preferred technical solution of the present application, the OsRTD1 The gene is knocked out by gene editing technology to cause a deletion-type frameshift mutation of the OsRTD1 gene to obtain the mutant plant osrtd1 ; or one or more deoxynucleotides are inserted into the coding region of the OsRTD1 gene by gene editing technology to cause an insertion-type frameshift mutation of the OsRTD1 gene to obtain the mutant plant osrtd1 .

[0009] In the preferred technical solution of the present application, the drought resistance of the mutant plant osrtd1 is improved, that is, the survival rate of the mutant plant osrtd1 is improved under soil dehydration or drought stress caused by PEG.

[0010] In a preferred embodiment of the present invention, the mutant plant osrtd1 The total number of grains, the number of filled grains, and the total weight of grains under drought stress were all significantly higher than those of wild-type plants.

[0011] In a preferred embodiment of the present invention, the mutant plant osrtd1 The improved drought resistance of mutant plants under PEG-induced drought stress enhances their ability to withstand drought. osrtd1 It increases the proline content while reducing the malondialdehyde content.

[0012] In a preferred embodiment of the present invention, the rice is japonica rice.

[0013] In a preferred embodiment of the present invention, the variety of japonica rice is Zhonghua 11.

[0014] A breeding method for drought-resistant rice involves knocking out or mutating [various organisms] in rice. OsRTD1 Gene, the method includes: Design target sequences and primer sequences; Based on the primer sequence, the target sequence was amplified using overlapping PCR to obtain the sgRNA expression cassette; The sgRNA expression cassette was cloned into the pYLCRISPR / Cas9 vector to obtain the CRISPR / Cas9-OsRTD1 vector. The CRISPR / Cas9-OsRTD1 vector was transferred into plant cells for genetic transformation to obtain transgenic plant T0. Homozygous mutant plants were screened from transgenic plant T0. osrtd1 .

[0015] The beneficial effects of this invention are as follows: (1) This invention uses PCR to clone from rice OsRTD1 Gene (the corresponding gene locus number corresponds to LOC_Os02g11110 published in the RiceGenome Annotation Project). OsRTD1 Genes are of great significance in improving the drought resistance of rice and can serve as new targets for improving the drought resistance of rice.

[0016] (2) Compared with wild-type plants, OsRTD1 Mutant plants osrtd1 Survival rates were significantly improved after soil drought stress and PEG-simulated drought stress. OsRTD1 Gene overexpression plants OsRTD1-OE The survival rate was significantly reduced. Therefore, it can be inferred that... OsRTD1 Genes negatively regulate drought resistance in rice.

[0017] (3) OsRTD1 Genetic mutant plants osrtd1 can improve the resistance to field drought stress, OsRTD1 Genetic mutant plants osrtd1 The total grain number, filled grain number and total grain weight are increased.

[0018] It can be seen that, OsRTD1 Gene is a potential new target for negative regulation of rice drought resistance mechanism. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Wild type plants (WT), mutant plants osrtd1 and overexpression plants OE-OsRTD1 Under PEG simulated drought treatment, wherein, Figure 1 a Wild type plants (WT), overexpression plants OE-OsRTD1 ( OE-OsRTD1-1 and OE- OsRTD1-2 ) and mutant plants osrtd1 ( osrtd1-1 and osrtd1-2 ) Drought treatment phenotype diagram, Figure 1 b Survival rate statistics results diagram of wild type plants (WT), overexpression plants OE-OsRTD1 and mutant plants osrtd1 after drought treatment; Figure 2 Wild type plants (WT), mutant plants osrtd1 and overexpression plants OE-OsRTD1 Under field drought treatment, wherein, Figure 2 Left is the phenotype diagram of panicles of wild type plants (WT), overexpression plants OE-OsRTD1 ( OE-OsRTD1-1 and OE- OsRTD1-2 ) and mutant plants osrtd1 ( osrtd1-1 and osrtd1-2 ) Under drought treatment, Figure 2 a- Figure 2 f Yield data of wild type plants (WT), overexpression plants OE-OsRTD1 and mutant plants osrtd1 Under field drought treatment, such as total grain number, filled grain number, seed setting rate, total grain weight, thousand grain weight and panicle length; Figure 3 Mutant plants osrtd1 and overexpression plants OE-OsRTD1 Under soil drought treatment, wherein, Figure 3 a and Figure 3 b Wild type plants (WT), overexpression plants OE-OsRTD1 (OE-OsRTD1-1 and OE-OsRTD1-2 ) and mutant plants osrtd1 ( osrtd1-1 and osrtd1-2 Phenotypic diagram of drought treatment, Figure 3 c represents wild-type plants (WT) and overexpression plants. OE-OsRTD1 and mutant plants osrtd1 Statistical results of survival rate after drought treatment; Figure 4 Wild-type plants (WT) and overexpression plants OE-OsRTD1 ( OE-OsRTD1-1 ) and mutant plants osrtd1 ( osrtd1-1 Physiological indicators were detected after simulated drought treatment, among which, Figure 4 'a' represents the proline content. Figure 4 b represents the malondialdehyde content; Figure 5 To overexpress plants OE-OsRTD1 ( OE-OsRTD1-1 The expression levels of RTD1 protein after drought treatment at 0h, 2h, 4h, 6h, 10h, 12h, and 24h; Figure 6 Wild-type plants (WT) and mutant plants osrtd1 and overexpressing plants OE-OsRTD1 The differences, among which Figure 6 a represents a mutant plant. osrtd1-1 and osrtd1-2 Two different mutation types, Figure 6 b represents overexpressing plants. OE- OsRTD1-1 , OE-OsRTD1-2 and OE-OsRTD1-3 middle RTD1 Differences in gene expression. Detailed Implementation

[0020] Preferred embodiments of the invention will now be described in more detail with reference to the accompanying drawings. While preferred embodiments of the invention are shown in the drawings, it should be understood that the invention can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that the invention will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

[0021] Plant materials: The test material used in this study was japonica rice (background). Oryza sativaL. ). Wild type plant (WT) is Zhonghua 11 (ZH11) (publicly available rice variety, commercially available). Plant overexpression vector pRHV was provided by the Wang Guoliang research group of Chinese Academy of Agricultural Sciences (plant overexpression vector pRHVcGFP was disclosed in the supplementary data of He F, Zhang F, Sun W, et al. A Versatile Vector Toolkit for Functional Analysis of Rice Genes [J]. Rice, 2018, 11(1): 27.); the genetic transformation of the above genetic material was constructed by Baige Gene Technology (Jiangsu) Co., Ltd.

[0022] Chemical reagents: polyethylene glycol 6000 (PEG6000) was purchased from Shengong Bioengineering (Shanghai) Co., Ltd., restriction endonuclease was purchased from New England Biolabs Co., Ltd.; high-fidelity enzyme KOD FX was purchased from TOYOBO Co., Ltd.; abm reverse transcription kit was purchased from abm Biotechnology Co., Ltd.; gel recovery kit and plasmid extraction kit were purchased from Jifan Biotechnology (Beijing) Co., Ltd.; 2 × Taq PCR StarMix was purchased from Beijing Kangrunchengye Biotechnology Co., Ltd.

[0023] Example 1 Overexpression plant OE-OsRTD1 Obtaining Plant overexpression vector pRHVcGFP was provided by the Wang Guoliang research group of Chinese Academy of Agricultural Sciences (plant overexpression vector pRHVcGFP has been disclosed in the supplementary data of He F, Zhang F, Sun W, et al. A Versatile Vector Toolkit for Functional Analysis of Rice Genes [J]. Rice, 2018, 11(1): 27.).

[0024] 1. Construction of pRHVcGFP-OsRTD1 overexpression vector (1) Amplification of target gene Take the cDNA of wild type plant (WT) leaf as template (according to the operation manual of abm reverse transcription kit), design primers according to the target gene, the primer sequences are shown in Table 1, and the target gene is obtained by PCR amplification, and the PCR system is shown in Table 2.

[0025] Table 1: Primer for PCR amplification of target fragment

[0026] Table 2: PCR reaction system of target gene

[0027] The amplification procedure is: 94°C pre-denaturation for 5 min; 98°C denaturation for 10 s, 55°C annealing for 30 s, 68°C extension for 90 s, 32 cycles; 68°C total extension for 5 min, 16°C for 1 min. After the reaction, 50 μL of the amplification product is added to 1% agarose gel containing nucleic acid dye for electrophoresis. After electrophoresis, the gel is imaged on a UV imaging instrument to detect whether the band is amplified. If the target band is amplified, it indicates that the amplification fragment may contain the target gene. The target band is cut off for further gel recovery and purification of the product (according to the gel recovery kit instructions) and concentration determination.

[0028] (2) Preparation of linearized vector Each 3 μg of overexpression vector pRHVcGFP and target gene (according to the plasmid extraction kit instructions) is taken, and the corresponding restriction endonuclease is added to each reaction system for double enzyme digestion at 37°C for 20 min. The overexpression vector pRHVcGFP and the target gene reaction system are shown in Table 3.

[0029] Table 3: Enzyme digestion reaction system

[0030] 50 μL of the reaction product is added to 1% agarose gel containing nucleic acid dye for electrophoresis. After electrophoresis, the gel is imaged on a UV imaging instrument, and after the target band is separated, the target band is cut off for further gel recovery and purification of the product and concentration determination.

[0031] (3) Recombination reaction The insert fragment and the vector are recombined by the homologous recombination enzyme 2xHieff Clone® MultiS Enzyme Premix (derived from a multi-fragment one-step rapid cloning kit, purchased from Shanghai Yisen Biotechnology Co., Ltd.) in a certain proportion to obtain the pRHVcGFP-OsRTD1 overexpression vector. The optimal molar ratio of the vector to the insert fragment is 1:(2-3). The DNA mass corresponding to these molar numbers can be roughly calculated by the following formula: optimal vector usage X = [0.02xvector base pair number] ng (0.03 pmol). Optimal insert fragment usage Y = [0.04xinsert fragment base pair number] ng (0.06 pmol) or = [0.06xinsert fragment base pair number] ng (0.09 pmol). The recombination reaction system is shown in Table 4.

[0032] Table 4: Recombination reaction system

[0033] After the system is prepared, use a pipette to gently pipette the mixed components, and centrifuge briefly to collect the reaction solution at the bottom of the tube. Place it at 50°C for 20 min. The reaction product can be directly converted or stored at -20°C and thawed for conversion when needed.

[0034] (4) Recombination product conversion and plating Refrigerate the clonal competent cells DH5a on ice. Take 10 μL of the cooled recombination product (containing pRHVcGFP-OsRTD1 overexpression vector), add it to 100 μL of competent cells, mix gently by flicking the tube wall, and place it on ice for 30 min; heat shock at 42°C for 60 s, incubate on ice for 2 min, add 900 μL of LB medium, shake at 37°C and 200 rpm for 30 min, centrifuge at 5000 rpm for 3 min, and discard the supernatant. Resuspend the bacterial cells with the remaining medium, and gently spread them on a plate containing kan resistance using a sterile spreader. After the bacterial solution is absorbed, invert the plate and incubate it at 37°C overnight.

[0035] (5) Clonal identification The most convenient and fastest method is colony PCR. Use a sterile gun or toothpick to pick a single colony into 500 μL of LB medium and mix it, and directly take 1 μL as the PCR template. The remaining bacterial solution is used for subsequent sequencing identification. The PCR reaction system is shown in Table 5.

[0036] Table 5: Colony PCR reaction system

[0037] The amplification program is as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 30 s, 25 cycles; 72°C total extension for 5 min, and 16°C for 1 min. After the reaction is completed, take 20 μL of the amplified product and add it to a 1% agarose gel containing nucleic acid dye for electrophoresis; after electrophoresis, take a photo of the gel on an ultraviolet imaging instrument to detect whether a band is amplified. If a band is amplified, the clone is sent to a sequencing company for sequencing (sequencing is completed by Guangzhou Qikeli Biological Technology Co., Ltd.).

[0038] The primer sequence for sequencing is as follows: UbiP-seq: TTTTAGCCCTGCCTTCATACGC; GFP-seqR: AACTTGTGGCCGTTTACGTCG.

[0039] 2. Genetic transformation and identification of transgenic plants The constructed pRHVcGFP-OsRTD1 overexpression vector was sent to Baige Gene Technology Co., Ltd. for genetic transformation, resulting in T0 generation plants. The transgenic plants were then identified. Since the pRHVcGFP-OsRTD1 overexpression vector carries a HYG hygromycin tag, the presence or absence of the hygromycin tag was sufficient to determine if a plant was transgenic. Total genomic DNA was extracted from the leaves of the plants to be tested, and PCR amplification was performed using primers HYG (Table 6). Agarose gel electrophoresis was used to determine if the band sizes of the PCR products met the requirements. Plants meeting the requirements were identified as transgenic plants containing the target gene (i.e., transgenic plants). OsRTD1 (Gene overexpression plants). The PCR amplification method refers to the steps (1) cloning identification PCR reaction system and PCR amplification program in the construction method of plant pRHVcGFP-OsRTD1 overexpression vector. After the reaction, 5 μL of amplification product was added to a 1% agarose gel containing nucleic acid dye for electrophoresis. After electrophoresis, the gel was irradiated with a UV imager to observe whether there was a target band. T0 generation plants were self-pollinated to obtain T1 generation plants. T1 generation plants were self-pollinated to obtain T2 generation homozygous plants. OsRTD1 Gene overexpression plant (OE-OsRTD1).

[0040] Table 6: HYG Identification Primers

[0041] This embodiment utilizes PCR to clone [a specific organism] from rice. OsRTD1 Gene, OsRTD1 Genes play a crucial role in regulating rice grain development and can serve as novel targets for improving rice grain traits. Genetic transformation can be used to... OsRTD1 The gene was transferred into rice, and a series of overexpression lines were obtained through screening. The phenotypes of the overexpression lines were analyzed in detail.

[0042] Example 2: Mutant Plants osrtd1 Acquisition mutant plants osrtd1 It was constructed based on the CRISPR / Cas9 technology described in Zeng D, Ma X, Xie X, et al. A protocol for CRISPR / Cas9-based multi-gene editing and sequence decoding of mutant sites inplants[J]. Scientia Sinica Vitae, 2018, 48(7): 783-794.

[0043] 1. Target sequence selection and primer design Wild-type plants (WT) OsRTD1The target site is 20 bp GAGCTGCATCATCTCCGACT.

[0044] The primer sequences are as follows: gRT2: GTCGGAGATGATGCAGCTC gttttagagctagaaat; OsU3T2: GAGCTGCATCATCTCCGACT gccacggatcatctgc; gRT1: CTCGTTCTCCGAGAGCTTGT gttttagagctagaaat; OsU6aT1: ACAAGCTCTCGGAGAACGAGC ggcagccaagccagca.

[0045] 2. Overlapping PCR (1) First round PCR. The purpose of this step is to introduce the target sequence into the downstream of U3 / U6 promoter and the upstream of sgRNA sequence, respectively.

[0046] 2x Phanta Max Buffer 7.5 µl; 10 mM dNTPs Mix 0.25 µl; Phanta Max Polymerase 0.2 µl; YLgRNA-U6 / U3 2-5 ng; 10 µM U-F and U-T 0.3 µl each (reaction 1); 10 µM gR-T and gR-R 0.3 µl each (reaction 2); ddH2O up to 15 µl; 25-26 PCR cycles: 95℃ 10 s, 58℃ 15 s, 72℃ 15 s. Take 3-5 µl PCR product for 1.5% agarose gel electrophoresis (reaction 2 product length is about 140 bp). If the amplification product is weak, the second round of PCR can also be continued.

[0047] (2) Second round PCR. The purpose of this step is to construct the complete expression cassette of the promoter, target and sgRNA. When using, according to the two target sites, synthesize the two pairs of primers Pps-R / Pgs-2, Pps-2 / Pgs-L, and mix the universal primer pair into working solution (10 µM each) in advance. In the second round of PCR, each expression cassette selects 30 µl system, takes 1 µl of the products of reaction 1 and reaction 2 in the first round PCR and mixes them in 8 µl of ddH2O to dilute 10 times, takes 1 µl as the template of the second round of PCR. Take 3 µl PCR product for electrophoresis, and estimate the approximate concentration of the sample. According to the concentration of each expression cassette PCR fragment in the second round, mix all the expression cassette fragments approximately equally, and purify with a PCR product purification kit.

[0048] Pps-R: TTCAGAggtctcTaccgACTAGTCACGCGTATGGAATCGGCAGCAAA; Pgs-2: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC; Pps-2: TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG; Pgs-L: AGCGTGggtctcGctcgACGCGTATCCATCCACTCCAAGC.

[0049] 3. Clone sgRNA expression cassette into pYLCRISPR / Cas9 vector This step uses "Golden Gate" cloning method based on Bsal enzyme digestion and ligation to assemble sgRNA expression cassette into pYLCRISPR / Cas9 vector by "cut and paste" method. Prepare 15 μΐ reaction system: 10x CutSmart Buffer 1.5 μΐ; 10 mM ATP 1.5 μΐ (1.5 μΐ 10x T4 DNA ligase buffer can also be added instead of ATP); pYLCRISPR / Cas9 plasmid 60-80 ng; purified mixed sgRNA expression cassette 10-15 ng per expression cassette, a total of 20-30 ng for 2 target points; Bsal-HF 10 U; T4 DNA ligase 35 U; ddH20 to 15 μΐ. Use variable temperature cycle (PCR instrument can be used) to perform cut and paste reaction for 10-15 cycles (37°C 5 min, 10°C 5 min, 20°C 5 min); finally 37°C 5 min.

[0050] 4. Recombination reaction and transformation Method same as overexpression vector construction.

[0051] 5. Genetic transformation and identification of transgenic plants The constructed CRISPR / Cas9-OsRTD1 vector is sent to the Biogiga Gene Technology Co., Ltd. for genetic transformation to obtain T0 generation plants. The obtained transgenic plants are identified. Since the CRISPR / Cas9-OsRTD1 vector carries a HYG hygromycin tag, it is only necessary to determine whether it is a transgenic plant by identifying whether there is a hygromycin marker. The detection method is the same as that of the overexpression material identification in the above. After the PCR amplification program is completed, 5 μL of the amplification product is added to a 1% agarose gel containing a nucleic acid dye for electrophoresis. After electrophoresis, the gel is imaged on an ultraviolet imager to observe whether there is a target band. The remaining PCR stock solution is sent to a sequencing company for sequencing and compared with the wild type nucleotide sequence to determine the mutation type of the mutant. The T0 generation plants are selfed to obtain T1 generation plants. At this time, it is necessary to detect whether the plants carry the CRISPR / Cas9 vector. The T1 generation seeds are harvested from the plant lines that do not contain the vector. The T1 generation plants are selfed again to obtain T2 generation homozygous mutant plants osrtd1 .

[0052] Example 3: PEG drought stress phenotype analysis The present application sows wild type plants (WT), mutant plants osrtd1 and overexpression plants of japonica rice varieties in the Guangzhou South China Agricultural University Farm in Guangdong Province OE-OsRTD1 , and performs polyethylene glycol 6000 (PEG6000) simulated drought stress after harvesting seeds.

[0053] The mutant plants osrtd1 are obtained by knocking out the OsRTD1 gene of rice through gene editing technology, or using gene editing technology to generate one or more deoxynucleotide mutations at the coding region of the OsRTD1 gene.

[0054] The rice to be tested: wild type plants (WT), mutant plants osrtd1 and overexpression plants OE-OsRTD1 The specific steps are as follows: the just-emerged wild type plants (WT), mutant plants osrtd1 , overexpression plants OE-Osrtd1 seeds are placed in a 96-well plate with holes at the bottom, one seed is placed in each hole, and three lines of each variety are placed in the plate. Then, the plate is placed in a culture box containing rice nutrient solution and cultured at 28°C under light (16 hours of light / 8 hours of darkness). After the rice seedlings grow to 2 weeks old, they are treated with 20% polyethylene glycol 6000 (PEG6000) for 5 days to simulate drought, and then rice nutrient solution is added for 7 days of recovery. The survival and death of seedlings of each variety are counted, and the survival rate is calculated. Each rice variety is repeated three times.

[0055] The results are shown in Figure 1 , Figure 1The scale is 5 cm. Each rice variety is repeated three times, and p <0.0001, n =3. Through phenotypic analysis, it can be seen that the growth states of wild type plants (WT), mutant plants osrtd1 and overexpression plants OE-OsRTD1 are consistent before treatment. After rehydration, wild type plants (WT), mutant plants osrtd1 and overexpression plants OE-OsRTD1 all show different degrees of damage. As shown in Figure 1 a, compared with wild type plants (WT), mutant plants osrtd1 suffered less damage, and overexpression plants OE-OsRTD1 suffered more damage. As shown in Figure 1 b, by counting the survival rate, the survival rate of wild type plants (WT) is 35%-45%, the survival rate of mutant plants osrtd1 is 80%-90%, which is significantly higher than that of wild type plants (WT), and the survival rate of overexpression plants OE-OsRTD1 is about 20%, which is significantly lower than that of wild type plants (WT). It shows that mutant plants osrtd1 improve the tolerance of rice under drought stress, and overexpression plants OE- OsRTD1 reduce the tolerance of rice under drought stress. Therefore, it is inferred that OsRTD1 the gene negatively regulates the drought resistance of rice.

[0056] Example 4: Field drought stress phenotype analysis The present application sows japonica rice varieties wild type plants (WT), mutant plants osrtd1 , overexpression plants OE-OsRTD1 in the scientific research center of Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences, Menglun Town, Mengla County, Xishuangbanna Dai Autonomous Prefecture, Yunnan Province, and then selects similar growth seedlings for field drought stress and analyzes the related phenotypes.

[0057] Tested rice: wild type plants (WT), mutant plants osrtd1 and overexpression plants OE-OsRTD1 The specific steps are as follows: just after the wild type plants (WT), mutant plants osrtd1 and overexpression plants OE-OsRTD1The seeds were sown in the field, with the soil just covering the germinating seeds. A plastic film was used to keep the seeds warm and moist, and the seedlings were nurtured for about 15 days. When the seedlings reached about 10 cm in height, they were transplanted. The land was leveled, and furrows were dug about 5 cm deep, 1 m wide, and 25 cm apart. About 40 seeds were sown evenly in each row and covered with soil. Each variety was numbered twice, with three replicates. The soil was evenly moistened using sprinkler irrigation. After germination, the seedlings were thinned to about 25 plants per row. Thinning is an important field management technique in agricultural production, referring to the process of removing overly dense, weak, or diseased seedlings manually or mechanically after emergence, allowing the remaining healthy seedlings sufficient growing space and nutrients. Sprinkler irrigation was applied again after 21 days to allow the seedlings to grow normally. No further watering was done until maturity, at which point phenotypic analysis was conducted. Each rice variety was repeated three times.

[0058] The results are as follows Figure 2 As shown, Figure 2 The scale bar is 3 cm. Each rice variety is repeated three times, with different letters representing different varieties. p <0.05, n = 3. Phenotypic analysis revealed that after drought treatment and rehydration, wild-type plants (WT) and mutant plants... osrtd1 and overexpressing plants OE-OsRTD1 All showed varying degrees of damage. For example... Figure 2 As shown, compared with wild-type plants (WT), overexpressing plants OE-OsRTD1 The ears of the mutant plants were more severely damaged. osrtd1 The ears of grain were less damaged. For example... Figure 2 As shown in figure a, statistical yield phenotype analysis revealed that the total number of grains in wild-type plants (WT) was approximately 100, while that in mutant plants... osrtd1 The total number of grains was 125-135, significantly higher than that of wild-type plants (WT), and the overexpressing plants... OE-OsRTD1 The total number of grains was approximately 100, which was not significantly different from the wild-type plant (WT). For example... Figure 2 As shown in b, the wild-type plant (WT) has approximately 75 grains, while the mutant plant... osrtd1 The number of grains was 95-105, significantly higher than that of the wild type. OE-OsRTD1 The overexpressing plants had approximately 45 grains, significantly lower than the wild type. For example... Figure 2 As shown in c, the seed setting rate of wild-type plants (WT) is approximately 0.75%, while that of mutant plants is... osrtd1 The fruit set rate was approximately 0.75%, which was not significantly different from that of wild-type plants (WT). Overexpression plants... OE-OsRTD1 The fruit set rate was 0.4-0.5%, significantly lower than that of the wild type. For example... Figure 2 As shown in d, the total grain weight of the wild-type plant (WT) is about 1.5 g, while that of the mutant plant is... osrtd1The total particle weight was 2-2.5 g, significantly higher than that of the wild type, and the overexpressing plants... OE-OsRTD1 The total grain weight is 0.9-1.1g, which is significantly lower than that of the wild type.

[0059] Explanation of mutant plants osrtd1 Increased rice yield under drought stress, overexpressing the plant OE-OsRTD1 This reduced rice yield under drought stress. Therefore, it can be inferred that... OsRTD1 Genes negatively regulate rice yield under drought stress.

[0060] Example 5 Phenotypic Analysis of Soil Drought Stress This invention involves sowing wild-type (WT) and mutant plants of japonica rice varieties at the farm of South China Agricultural University in Guangzhou, Guangdong Province. osrtd1 and overexpression plants OE-OsRTD1 After harvesting, the seeds are planted in pots to undergo soil drought stress.

[0061] Rice samples tested: wild-type plants (WT) and mutant plants osrtd1 and overexpression plants OE-OsRTD1 The specific steps are as follows: Place the newly sprouting wild-type plants (WT) and mutant plants... osrtd1 and overexpression plants OE-OsRTD1 Seeds were planted in moist soil, with 21 seedlings per strain. The seedlings were cultured at 28°C under light (16 hours light / 8 hours darkness). After 4 weeks of growth, watering was stopped, and the seedlings were allowed to dry for 7 days before being replenished with rice nutrient solution for another 7 days. The number of surviving and dead seedlings for each strain was counted to calculate the survival rate. Each rice variety was replicated three times.

[0062] The results are as follows Figure 3 As shown, Figure 3 The scale bar is 10 cm. Each rice variety was repeated three times, ** indicating... p <0.001 indicates extremely significant. n = 3. Phenotypic analysis revealed that after drought treatment and rehydration, wild-type plants (WT) and mutant plants... osrtd1 and overexpression plants OE-OsRTD1 All showed varying degrees of damage. For example... Figure 3 a and Figure 3 As shown in b, compared with wild-type plants (WT), the overexpressing plants OE-OsRTD1 The mutant plants suffered severe damage. osrtd1 The damage was relatively minor. For example... Figure 3 As shown in Figure c, statistical survival rate analysis revealed that the survival rate of wild-type plants (WT) was approximately 35%, while that of mutant plants was much higher. osrtd1 The survival rate was approximately 65%, significantly higher than that of the wild type, and the overexpressing plants...OE-OsRTD1 The survival rate was approximately 16%, significantly lower than that of the wild type. This indicates that the mutant plants... osrtd1 It improved the tolerance of rice to drought stress and overexpressed the plant OE-OsRTD1 This reduces the tolerance of rice to drought stress. Therefore, it can be inferred that... OsRTD1 Genes negatively regulate the drought resistance of rice.

[0063] Example 6: Measurement of physiological indicators after PEG treatment This invention involves sowing wild-type (WT) and mutant plants of japonica rice varieties at the farm of South China Agricultural University in Guangzhou, Guangdong Province. osrtd1 and overexpressing plants OE-OsRTD1 After harvesting, polyethylene glycol 6000 (PEG6000) was used to simulate the phenotype under drought stress.

[0064] Rice samples tested: wild-type plants (WT) and mutant plants osrtd1 and overexpressing plants OE-OsRTD1 The specific steps are as follows: Place the newly sprouting wild-type plants (WT) and mutant plants... osrtd1 and overexpressing plants OE-OsRTD1 Seeds were placed in 96-well plates with holes at the bottom, one seed per well, with three rows for each of the three varieties. The plates were then placed in culture boxes containing rice nutrient solution and cultured at 28°C under light (16 hours light / 8 hours dark). After the rice seedlings had grown for two weeks, they were treated with 20% polyethylene glycol 6000 (PEG6000) to simulate drought for 6 hours before sampling. Proline (PRO) test kits and plant malondialdehyde (MDA) test kits (proline (PRO) test kit (catalog number A107-1-1) and plant malondialdehyde (MDA) test kit (catalog number A003-3-1) were both purchased from Nanjing Jiancheng Biotechnology Research Institute), with three replicates for each rice variety.

[0065] Proline (Pro) is a component of plant proteins and can exist widely in a free state within plants. Under stress conditions such as drought and salinity, many plants accumulate large amounts of proline. Besides acting as an osmotic regulator in plant cytoplasm, accumulated proline plays important roles in stabilizing the structure of biomolecules, reducing cell acidity, detoxifying ammonia, and regulating cellular redox potential as an energy reservoir. Under adverse conditions such as drought, salinity, heat, cold, and freezing, the proline content in plants increases significantly. The proline content in plants reflects their stress resistance to some extent; drought-resistant varieties tend to accumulate more proline. Therefore, measuring proline content can serve as a physiological indicator for drought-resistant breeding. Malondialdehyde (MDA) can be used to measure the degree of damage to plant cell membranes caused by abiotic stress. This indicator is related to membrane damage; a higher MDA value indicates greater damage to the cell membrane.

[0066] The results are as follows Figure 4 As shown, each rice variety is repeated three times. Different letters represent... p < 0.05, n = 3. Overexpressing plants after drought treatment OE-OsRTD1 In the middle, proline was significantly downregulated; while in the mutant plants osrtd1 Proline was significantly upregulated. Meanwhile, compared to wild-type plants (WT), the mutant plants... osrtd1 The significantly reduced MDA accumulation in the overexpressing plants indicates that the damage they suffered was less than that in the wild-type plants (WT); OE-OsRTD1 The significantly increased MDA accumulation in the medium indicates that the damage it suffered was greater than that in the wild-type plant (WT).

[0067] The above results indicate that the mutant plant osrtd1 The higher proline content and lower MDA accumulation in the middle confirm that OsRTD1 Genes negatively regulate drought resistance in rice at the physiological level. The results of this example verify the mutant plants. osrtd1 It can improve the resistance of plants, especially rice, to drought stress induced by PEG, increase proline content, and decrease malondialdehyde content. Overexpressing plants OE-OsRTD1 Include OE-OsRTD1-1 , OE-OsRTD1-2 and OE-OsRTD1-3 Three types, such as Figure 6 As shown in b. OsRTD1 The relative expression levels of genes, from highest to lowest, are as follows: OE-OsRTD1-1 > OE-OsRTD1-2 > OE- OsRTD1-3 >WT. Mutant plant osrtd1 include osrtd1-1 and osrtd1-2 Two types, such as Figure 6 As shown in a, osrtd1-1 The mutant plant is in OsRTD1 An insertion of an A base at a location in a gene segment, specifically an adenine-induced frameshift mutation, is an insertional mutation. osrtd1-2 Type mutant plants are knockout OsRTD1 Deletion-type frameshift mutations caused by partial base pairs in a gene fragment.

[0068] Example 7: Immunoblot analysis of protein in leaves of plants treated with PEG Rice samples to be tested: overexpression plants OE-OsRTD1 The specific steps are as follows: Overexpressing plants OE-OsRTD1Rice seedlings were normally cultured for 2 weeks, then treated with 20% polyethylene glycol 6000 (PEG6000) for 24 h to simulate drought, and samples were taken at 0, 2, 4, 6, 10, 12, and 24 h after drought treatment, and proteins were extracted for western blot analysis using specific antibodies. Different letters indicate p <0.05, n =3.

[0069] Results are shown in Figure 6. Compared with normal growth conditions, PEG treatment promoted degradation of OsRTD1 protein in the leaves of overexpression plants. More RTD1 protein was degraded as drought time increased compared with before drought treatment. According to the above results, we preliminarily speculate that RTD1 protein is degraded in response to drought stress under drought conditions, and thus mutant plants have higher drought resistance. Figure 5 OE-OsRTD1 osrtd1

[0070] The foregoing merely illustrates the principles of the application. It will be apparent to those skilled in the art that the application can be practiced with modifications and alterations, and that the application abides by the law of the principles. Thus, the foregoing description is not intended to limit the scope of the application but is merely meant to provide a description of embodiments of the application. Therefore, the examples of the exemplary embodiments are to be considered as illustrative and not restrictive, and the scope of the application is to be determined by the appended claims and their equivalents. The examples of the exemplary embodiments can have different values. It is noted that like numbers and letters indicate like elements throughout the several views of the drawings. Once an element is defined in one drawing, it need not be further discussed in the subsequent drawings.

[0071] The preferred embodiments of the present application have been described above with the specific expression. The present application can, however, be carried out in various ways and is not limited to the embodiments described above. It will be apparent to those skilled in the art that any modifications and changes can be made without departing from the spirit and scope of the present application. Accordingly, the scope of the present application should be construed to include all such modifications and changes.​​​

Claims

1. OsRTD1 The use of a gene to improve drought resistance in rice, characterized in that, The OsRTD1 The nucleotide sequence of the gene is shown as SEQ ID NO: 1, and the OsRTD1 The gene negatively regulates drought tolerance of rice.

2. The method of claim 1, OsRTD1 Use of the gene in improving drought resistance of rice, characterized in that, The OsRTD1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:

2.

3. The method of claim 1, OsRTD1 Use of the gene in improving drought resistance of rice, characterized in that, By mutating or knocking out the gene, mutant plants are obtained OsRTD1 osrtd1 .​ 4. The method of claim 3, wherein the at least one gene is selected from the group consisting of SEQ ID NOs: 1- 12. OsRTD1 The application of the genes in improving drought resistance of rice, characterized in that, knockout the gene by using gene editing technology OsRTD1 so that the gene of the plant is deleted OsRTD1 osrtd1 ; or insert one or more than one deoxynucleotide in the coding region of the gene by using gene editing technology OsRTD1 so that the gene of the plant is inserted OsRTD1 osrtd1 .​​ 5. The method of claim 1, OsRTD1 The application of the gene to improving drought resistance of rice is characterized in that, Mutant plants osrtd1 The increased drought tolerance of the mutant plants is an increased survival rate of the mutant plants when subjected to soil dehydration or PEG-induced drought stress. osrtd1 The increased drought tolerance of the mutant plants is an increased survival rate of the mutant plants when subjected to soil dehydration or PEG-induced drought stress.

6. The method of claim 1, OsRTD1 The application of the gene to improving drought resistance of rice is characterized in that, Mutant plants osrtd1 The total grain number, filled grain number and total grain weight under drought stress were significantly higher than those of wild type plants.

7. The method of claim 5, wherein the at least one gene is selected from the group consisting of SEQ ID NOs: 1- 12. OsRTD1 The application of the gene in improving drought resistance of rice, characterized in that, The mutant plant osrtd1 The drought resistance of the mutant plant is improved by increasing the proline content and decreasing the malondialdehyde content of the mutant plant under PEG-induced drought stress. osrtd1 The drought resistance of the mutant plant is improved by increasing the proline content and decreasing the malondialdehyde content of the mutant plant under PEG-induced drought stress.

8. The method of any one of claims 1-7 OsRTD1 The application of the gene in improving drought resistance of rice is characterized in that, The rice is japonica rice.

9. The method of claim 8, OsRTD1 The application of the gene to improving drought resistance of rice is characterized in that, The variety of the japonica rice is Zhonghua 11.

10. A method of breeding drought tolerant rice, characterized by, Knocking out or mutating a gene in rice as in any of claims 1-9 OsRTD1 the method comprising: Designing a target sequence and a primer sequence; Amplifying the target sequence by Overlapping PCR according to the primer sequence to obtain an sgRNA expression cassette; Cloning the sgRNA expression cassette into a pYLCRISPR / Cas9 vector to obtain a CRISPR / Cas9-OsRTD1 vector; Transferring the CRISPR / Cas9-OsRTD1 vector into a plant cell for genetic transformation to obtain a transgenic plant T0; Screening of homozygous mutant plants from transgenic plants T0 osrtd1 .

Images