Genetic transformation method taking mature sorghum seeds as receptor material and independent of genotype

By using mature sorghum seeds as recipient material and genetic transformation with Agrobacterium tumefaciens infection solution, the problem of genotype limitation in sorghum genetic transformation has been solved, realizing a highly efficient genetic transformation method applicable to various sorghum seeds, simplifying the operation process and improving transformation efficiency.

CN121065264AInactive Publication Date: 2025-12-05郝得厚
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511249403.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-03
Publication Date
2025-12-05
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Genetic transformation of sorghum is limited by the genotype of the recipient material. There are few types of recipient materials suitable for genetic transformation, and traditional methods are difficult to obtain and are subject to seasonal limitations. The transformation process is long and the transformation efficiency is low.

Method used

Using mature sorghum seeds as recipient material, after disinfection, germination and bud tip removal, co-culture was carried out using Agrobacterium tumefaciens infection solution carrying reporter gene and target gene, simplifying it into a genotype-independent genetic transformation method.

Benefits of technology

The genetic transformation cycle of sorghum was shortened to two weeks, and the positive rate of transformed plants reached 88.4%. This solved the problems of difficulty in obtaining recipient materials and genotype limitations, simplified the operation, and reduced the technical difficulty.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065264A_ABST
    Figure CN121065264A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of genetic engineering breeding, in particular to a genotype-independent genetic transformation method taking mature sorghum seeds as receptor materials. According to the invention, a genetic transformation method is constructed by using various sorghum seeds including grain sorghum, sweet sorghum and wild sorghum as acceptor materials, and comprises the following steps: disinfecting the sorghum seeds, accelerating germination, and cutting off shoot tips; a target gene is transformed into a genome of sorghum by a method of cutting off shoot tips of sorghum seeds and soaking the sorghum seeds with the shoot tips cut off in agrobacterium liquid, transgenic sorghum is obtained through screening, the transformation period can be shortened to two weeks, and the positive rate of transformed plants can reach 88.4%; the problems that in a traditional sorghum genetic transformation method needing to use immature embryos or calluses, receptor materials are not easy to obtain, the receptor materials are limited by genotypes, the transformation period is long and the like are solved, the genetic transformation method in which experimental materials are easy to obtain, the receptor materials are not limited by the genotypes and the transformation period is short is constructed, and a foundation is laid for sorghum research.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering breeding, and particularly relates to a genetic transformation method using mature seeds of sorghum as a receptor material and not dependent on genotypes. BACKGROUND

[0002] Sorghum is an important crop that can be used for food, feed, building materials and bioenergy, etc. At the same time, sorghum is a crop that can adapt to marginal soils, can grow under a wide range of temperature and climate conditions, and is relatively tolerant to drought and soil toxicity compared to other cereal crops.

[0003] Genetic transformation is an important technology for gene function research and molecular breeding. However, for a long time, the genetic transformation of sorghum is restricted by the genotypes of the receptor material, and the types of receptor materials suitable for genetic transformation are few, which cannot fully utilize the rich genetic diversity of sorghum. Moreover, the sites used in traditional genetic transformation methods, such as young embryos and calli, are generally difficult to obtain and are seasonally limited, resulting in a long transformation process and low transformation efficiency. Therefore, it is of great significance to create a transgenic technology that is not dependent on the genotypes of the receptor material for modern sorghum variety breeding. SUMMARY

[0004] The purpose of the present application is to provide a genetic transformation method using mature seeds of sorghum as a receptor material and not dependent on genotypes to solve the problems existing in the prior art.

[0005] To achieve the above purpose, the present application provides the following solutions.

[0006] The present application provides a genetic transformation method using mature seeds of sorghum as a receptor material and not dependent on genotypes, comprising the following steps:

[0007] The mature seeds of sorghum are subjected to disinfection treatment, germination treatment and bud tip removal treatment to obtain explants;

[0008] The explants are infected with Agrobacterium tumefaciens carrying a reporter gene and a target gene, and the infected explants are co-cultured and transplanted.

[0009] Preferably, the bud tip removal treatment comprises the step of removing 1 / 2 bud tips of the sorghum seedlings obtained by germination.

[0010] Preferably, the Agrobacterium tumefaciens is Agrobacterium tumefaciens EHA105.

[0011] Preferably, the co-culture uses MS solid medium.

[0012] Preferably, the culture condition parameters are 28℃ for 2-6 days.

[0013] Preferably, the culture medium used for the germination treatment is 1 / 2MS solid culture medium.

[0014] Preferably, the germination treatment conditions are: dark incubation at 37°C for 2-4 days.

[0015] Preferably, the disinfection process includes the steps of sequentially disinfecting with an ethanol solution and a sodium hypochlorite solution;

[0016] The ethanol solution contains 75% ethanol by volume; the sodium hypochlorite solution is a 4 wt% sodium hypochlorite solution.

[0017] Preferably, the infection time is 20 minutes.

[0018] This invention provides the application of the above-mentioned genetic transformation method in sorghum breeding.

[0019] The present invention discloses the following technical effects:

[0020] This invention utilizes various sorghum seeds, including grain sorghum, sweet sorghum, and wild sorghum, as recipient materials to construct a genetic transformation method. The method involves disinfecting and germinating sorghum seeds, removing the bud tips, and then soaking the bud-tipped seeds in Agrobacterium-based bacterial solution to transform the target gene into the sorghum genome. Transgenic sorghum was obtained through screening, shortening the transformation cycle to two weeks and achieving a positive rate of 88.4%. This invention uses mature sorghum seeds as recipient materials, solving the problems of traditional sorghum genetic transformation methods that require immature embryos or callus tissue, such as difficulty in obtaining recipient materials, genotype and seasonal limitations, and long transformation cycles. It constructs a genetic transformation system with readily available experimental materials, recipient materials not limited by genotype, and a short transformation cycle, laying the foundation for sorghum research. Furthermore, this genetic transformation method is not limited by recipient material genotype, enabling the use of wild sorghum as a recipient for genetic transformation, and does not involve callus induction or culture, offering advantages such as simple operation and low technical difficulty. This invention contributes to sorghum gene function research and molecular breeding. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 The sorghum seeds that germinated in Example 1 are wild sorghum 348, sweet sorghum E-tian, and grain sorghum Tx430.

[0023] Figure 2 These are the seeds after the bud tips were removed in Example 2; among them, wild sorghum is wild sorghum 348, sweet sorghum is sweet sorghum E-tian, and grain sorghum is grain sorghum Tx430.

[0024] Figure 3 This is a map of the recombinant plasmid pCAMBIA3300-Ubi-GUS-Hyg in Example 3;

[0025] Figure 4 This is the identification result of the wild sorghum transformation material (wild sorghum transgenic seedlings) in Example 6; where the left and right lanes are DNA Markers (Bomaide DNA Marker IV; MD110), the target band size is 1026bp, lanes 1-69 are wild sorghum transformation materials, - is the negative control, + is the positive control; wild sorghum is wild sorghum 348;

[0026] Figure 5 The results show the identification of sweet sorghum transformation material (transgenic sweet sorghum seedlings) in Example 6; where the left and right lanes are DNA Markers (Bomaide DNA Marker IV; MD110), the target band size is 1026bp, lanes 1-70 are sweet sorghum transformation material, - is negative control, + is positive control; the sweet sorghum is sweet sorghum E-tian;

[0027] Figure 6 The results of the identification of grain sorghum transformation material (grain sorghum transgenic seedlings) in Example 6 are shown. The left lane is the DNA Marker (Bomaide DNA Marker IV; MD110), with a target band size of 1026 bp. Lanes 1-71 are grain sorghum transformation materials, - is the negative control, and + is the positive control. The grain sorghum is grain sorghum Tx430.

[0028] Figure 7 This is a flowchart of the experiment. Detailed Implementation

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included within the scope of this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0031] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0032] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0033] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0034] Example 1

[0035] The test procedure is as follows Figure 7 As shown, the details are as follows:

[0036] I. Sorghum Seed Disinfection and Germination

[0037] (1) Seed disinfection

[0038] Wild sorghum (wild sorghum 348, which is publicly available on the webpage https: / / ngdc.cncb.ac.cn / sorgsd / phenotype_r / 9 / 1) seeds, sweet sorghum (sweet sorghum E-tian) seeds, and grain sorghum (grain sorghum Tx430) seeds were rinsed with sterile water, then soaked in 75% (v / v) ethanol for 2 minutes. After discarding the waste liquid, they were disinfected with 4wt% sodium hypochlorite solution for 15 minutes. After discarding the waste liquid, they were rinsed 4 times with sterile water and then thoroughly dried.

[0039] (2) Seed germination

[0040] Place the seeds, scutellum facing upwards, on 1 / 2 MS solid medium (PhytoTech Labs; Prod No: M519) and incubate in the dark at 37°C for 2-4 days to obtain germinated seeds. See the images of the germinated seeds. Figure 1 No additional treatment is required during the germination process.

[0041] II. Removal of part of the bud tip

[0042] Carefully identify the germination site, cut off half of the sprout, and set aside. See the cut seeds. Figure 2 .

[0043] III. Preparation of Agrobacterium tumefaciens infection solution

[0044] Agrobacterium tumefaciens EHA105-pCAMBIA3300-Ubi-GUS-Hyg, containing the recombinant plasmid pCAMBIA3300-Ubi-GUS-Hyg (a selection marker plasmid for the resistance gene), was cultured overnight in LB liquid medium. The bacterial cells were collected and used to infect seeds after treatment, allowing the target gene to integrate into the sorghum genome, thus achieving genetic transformation and facilitating screening and identification. The map of the recombinant plasmid pCAMBIA3300-Ubi-GUS-Hyg is shown below. Figure 3 As shown.

[0045]

[0046] (2) Construction of Agrobacterium tumefaciens EHA105-pCAMBIA3300-Ubi-GUS-Hyg containing a plasmid with a resistance gene selection marker: Agrobacterium tumefaciens EHA105 competent cells (BC303-01) from Bomeide Company were transformed according to the instructions and the pCAMBIA3300-Ubi-GUS-Hyg plasmid was introduced to obtain Agrobacterium tumefaciens EHA105-pCAMBIA3300-Ubi-GUS-Hyg containing a plasmid with a resistance gene selection marker.

[0047] (3) Inoculate Agrobacterium tumefaciens EHA105-pCAMBIA3300-Ubi-GUS-Hyg containing the selection marker plasmid with the resistance gene into LB liquid medium containing the corresponding resistance gene (rifampicin at a concentration of 50 μg / mL and kanamycin at a volume ratio of 1:50, and incubate overnight at 28°C and 200 rpm.

[0048] (4) Centrifuge at 5000 rpm for 2 min to collect bacterial cells.

[0049] (5) Prepare the infiltration solution. The composition of the infiltration solution is shown in Table 1.

[0050] Table 1 Composition of Infection Solution

[0051] Ingredients Volume 1 / 2MS medium 10 mL Acetyl eugenitol 10 μL Bacterial cells X * ]]> Tween 80 1 μL

[0052] Note: * indicates OD after resuspension 600 The value is 0.6, which is the OD value of the infection solution obtained after Agrobacterium resuspension. 600 The value is 0.6.

[0053] IV. Seed soaking in infection solution

[0054] The seeds, with their buds removed, are completely immersed in the inoculation solution and left to stand for 20 minutes. The inoculation process of this invention is simple to operate and requires no vacuum treatment.

[0055] V. Joint Training

[0056] Seeds soaked in the infection solution were removed, dried, and placed on MS solid medium (PhytoTech Labs; Prod No: M519) and cultured at 28°C for 2-6 days to obtain transgenic sorghum plants. In this example, the plants were cultured for 3 days.

[0057] VI. Screening of transgenic plants

[0058] The specific steps for detecting marker genes in transgenic sorghum plants by PCR are as follows:

[0059] (1) Transplant the seedlings into the soil and manage them with regular water and fertilizer.

[0060] (2) Take a small amount of newly grown leaves and extract DNA.

[0061] (3) The marker gene was detected by PCR. Specific PCR amplification of the marker gene was performed using 2×Phanta Max Master Mix (Dye Plus) and specific primers (HYGF / R) for the screening gene to identify transgenic plants. The specific primers are shown in Table 2. The PCR amplification method followed the instructions for use of the high-fidelity enzyme from Novizan. The reaction solution composition is shown in Table 3, and the reaction procedure is shown in Table 4. The recombinant plasmid pCAMBIA3300-Ubi-GUS-Hyg was used as a positive control, and the corresponding background material DNA was used as a negative control.

[0062] Table 2. Marker Gene-Specific Primers

[0063] Primer name Primer sequence (5'-3') HYGF ATGAAAAAGCCTGAACTCACC, SEQ ID NO. 2 HYGR CTATTTCTTTGCCCTCGGAC, SEQ ID NO. 3

[0064] Table 3 PCR System

[0065] Ingredients Volume / μL DNA template 1 HYGF 1 HYGR 1 2x PhantaMax Master Mix (Dye Plus) 10 ddH2O 7 Total volume 20

[0066] Table 4 PCR Procedure

[0067]

[0068] The PCR system was subjected to agarose gel electrophoresis. A single, bright band indicated that the corresponding sorghum plant was a transgenic material. The results are shown below. Figure 4 - Figure 6 The results showed that: after screening 69 transgenic wild sorghum plants, 61 positive transgenic wild sorghum plants were obtained (all except lanes 35, 45, 48, 49, 55, 57, 59, and 65 showed positive bands), with a positive rate of 88.4%; after screening 70 transgenic sweet sorghum plants, 58 positive transgenic sweet sorghum plants were obtained (all except lanes 15, 25, 33, 43, 47, 52, 58, 59, 64, 68, 69, and 70 showed positive bands), with a positive rate of 82.9%; after screening 71 transgenic grain sorghum plants, 60 positive transgenic grain sorghum plants were obtained (all except lanes 9, 23, 45, 49, 51, 55, 57, 60, 65, 68, and 69 showed positive bands), with a positive rate of 84.5%. Therefore, the genetic transformation method provided by this invention can achieve a positive rate of up to 88.4% in transformed plants, and the transformation cycle can be shortened to two weeks.

[0069] In summary, this invention utilizes various sorghum seeds, including grain sorghum, sweet sorghum, and wild sorghum, as recipient materials to construct a genetic transformation method. This method involves disinfecting and germinating sorghum seeds, removing the bud tips, and then soaking the bud-tipped seeds in Agrobacterium tumefaciens solution to transform the target gene into the sorghum genome. Transgenic sorghum was obtained through screening, and the transformation cycle was shortened to two weeks, with a positive rate of 75%. This invention uses mature sorghum seeds as recipient materials, solving the problems of difficult-to-obtain recipient materials, genotype and seasonal limitations, and long transformation cycles in traditional sorghum genetic transformation methods that require the use of immature embryos or callus tissue. It constructs a genetic transformation system with readily available experimental materials, recipient materials not limited by genotype, and a short transformation cycle, laying the foundation for sorghum research. Furthermore, this invention's genetic transformation method is not limited by recipient material genotype, enabling the use of wild sorghum as a recipient for genetic transformation. It does not involve callus induction or culture, offering advantages such as simple operation and low technical difficulty. This invention contributes to sorghum gene function research and molecular breeding.

[0070] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A genetic transformation method of sorghum mature seeds as a recipient material and independent of genotypes, characterized by, The method comprises the following steps: sterilizing, germinating and cutting the mature seeds of Sorghum bicolor to obtain explants; infesting the explants with Agrobacterium tumefaciens carrying a reporter gene and a target gene, co-culturing the infested explants and transplanting them.

2. The genetic transformation method according to claim 1, characterized by, The cutting step comprises cutting 1 / 2 of the sprout tip of the germinated Sorghum bicolor seedlings.

3. The genetic transformation method according to claim 1, wherein, The Agrobacterium tumefaciens is Agrobacterium tumefaciens EHA105.

4. The genetic transformation method according to claim 1, wherein, The co-culturing medium is MS solid medium.

5. The genetic transformation method according to claim 1 or 4, characterized by, The co-culturing condition is 28℃ for 2-6 days.

6. The genetic transformation method according to claim 1, wherein, The germination medium is 1 / 2MS solid medium.

7. The genetic transformation method according to claim 1 or 6, wherein The germination condition is 37℃ for 2-4 days in the dark.

8. The genetic transformation method of claim 1, wherein, The sterilization step comprises sequentially using ethanol solution and sodium hypochlorite solution. The volume percentage of ethanol in the ethanol solution is 75%, and the sodium hypochlorite solution is 4wt% sodium hypochlorite solution.

9. The genetic transformation method of claim 1, wherein, The infestation time is 20 minutes.

10. The use of the genetic transformation method of any one of claims 1-9 in the breeding of Sorghum bicolor.