Willow whole genome 40K SNP liquid phase chip and application thereof
By developing a 40K SNP liquid-phase chip for the whole genome of willow and combining it with targeted capture sequencing technology, we have achieved efficient and low-cost genotyping of willow, solving the problem of the lack of genotyping chips in willow breeding and improving the efficiency of scientific research and breeding.
Patent Information
- Application Number
- CN202511008678.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-08-12
- Filing Date
- 2025-07-22
- Publication Date
- 2025-12-05
AI Technical Summary
The lack of efficient and low-cost genotyping chips suitable for willows in existing technologies leads to low breeding efficiency for willows, making it difficult to meet the needs of industrialization.
A liquid-phase chip for the whole genome of willow was developed, comprising a mixture of willow 40K site probes and hybridization capture reagents. By combining targeted capture sequencing technology, high-density probes were designed and liquid-phase hybridization was performed to achieve high-throughput genotyping.
It enables high-throughput detection of willow genotyping, reduces costs, shortens sample testing service cycles, provides higher detection accuracy and data consistency, supports willow research and breeding needs, and avoids imported equipment and trade frictions.
Smart Images

Figure CN121065374A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of whole genome gene chip technology, and relates to a willow whole genome gene chip, specifically a willow whole genome 40K SNP liquid phase chip and its application. Background Technology
[0002] Genetic variations in the genome sequence, i.e., genetic markers, mainly include single nucleotide polymorphisms (SNPs), microsatellites (Short Tandem Repeats, STRs), copy number variations (CNVs), insertions / deletions (INDELs), and structural variations (SVS). Among these, SNPs are the most numerous (millions to tens of millions), widely distributed, essential, and commonly used genetic markers. SNP markers can cover the genome at high density and are inexpensive. SNP markers are heritable single-base pair changes occurring in the DNA sequence of an organism's genome. They occur very frequently in the human genome and are one of the most common genetic variations in organisms. In genetic research, SNPs are often used as markers for genomic regions, most of which have a small impact on biological systems. However, SNPs can be functional, causing changes in amino acid content, RNA transcriptional stability, and transcription factor binding affinity. Therefore, SNPs are widely used in the genetic breeding of agricultural crops and fruit trees due to their high density, high specificity, good stability, and ease of analysis.
[0003] SNP microarray technology is a high-throughput genotyping technique based on the principle of DNA hybridization. It detects the genotype of SNP loci by immobilizing specific probes on the chip surface and allowing them to hybridize with DNA fragments in the sample. Currently, the main microarray technologies used for SNP genotyping include solid-phase microarrays and liquid-phase microarrays. Solid-phase microarrays are based on the principle of solid-phase hybridization. They involve immobilizing a series of specific DNA probes on the chip surface and then hybridizing DNA fragments in the sample with these probes to detect SNP loci. Liquid-phase microarrays are based on the principle of liquid-phase hybridization. They involve dissolving a series of specific DNA probes in a liquid phase and then hybridizing DNA fragments in the sample with these probes to detect SNP loci.
[0004] Liquid-phase SNP microarrays offer advantages such as low cost, high throughput, high sensitivity, and high specificity, while also having a wider range of applications, including marker-assisted selection and genome-wide selection. Based on resequencing technology, liquid-phase microarrays specifically capture each target locus and perform high-depth resequencing, offering advantages such as high accuracy, high throughput, and low cost. This overcomes the technical bottlenecks of current solid-phase custom microarray platforms, such as high cost, poor flexibility, and difficulty in large-scale application, providing non-model organisms with a highly efficient and flexible targeted genotyping technology compatible with different throughput levels and marker types. Liquid-phase microarrays generally include a biotin-labeled probe covering the target SNP, designed based on the principle of DNA complementarity. These probes hybridize with the target genomic region in a liquid state to form a double strand. The adsorption of biotin-coated magnetic beads onto the biotin-containing molecules is utilized, followed by elution, amplification, library construction, and next-generation sequencing to ultimately reconstruct the genotypic status of the target locus and its surrounding SNPs. Liquid-phase chips have already found relatively mature applications in species evolution analysis, germplasm resource evaluation and DNA fingerprinting, molecular genetic map construction, gene / QTL localization and gene cloning, molecular marker-assisted selection, and whole-genome selection.
[0005] Willow is an important economic forest tree species with significant ecological and economic value. In recent years, with the rapid development of molecular biology technology, willow breeding has gradually entered the era of molecular breeding. SNP chip technology, as a highly efficient genotyping tool, can provide precise genetic information for willow breeding and accelerate the selection of superior varieties. However, to date, no mature willow genotyping chip has been developed in China. Therefore, to improve the efficiency of willow breeding, accelerate the willow breeding process, and better serve the industrial application of willow trees, there is an urgent need to develop an economical and suitable genotyping product for willows. Summary of the Invention
[0006] The technical problem to be solved by this invention is how to apply molecular biology techniques for improving germplasm resources to willow trees to obtain genotyping chips, so as to solve the problem of willow breeding in a low-cost, efficient and simple way.
[0007] The purpose of this invention is to provide a 40K SNP liquid phase chip for the whole genome of willow, which provides an important technical means for the study of economic traits of willow, variety identification, whole genome selection breeding and marker-assisted breeding, and meets the needs of large-scale commercial breeding of willow and the promotion of varieties into forests in different regions.
[0008] To achieve the above objectives, the present invention provides a 40K SNP liquid-phase chip for the whole genome of willow, comprising a mixture of willow 40K site probes and a hybridization capture reagent. The willow 40K site probe mixture includes willow SNP background site probes and willow SNP associated site probes, with at least two capture probes present at each site.
[0009] Furthermore, the hybridization capture reagent is the GenoBaits DNA-seqLibrary Prep kit from Novogene Corporation, comprising individually packaged GenoBaits Block I, GenoBaits Block II, GenoBaits 2×Hyb Buffer, GenoBaits Hyb Buffer Enhancer, GenoBaits 2×BeadsWashBuffer, GenoBaits 10×Wash Buffer I, GenoBaits 10X Wash Buffer II, GenoBaits 10×Wash Buffer III, and GenoBaits 10X Stringent Wash Buffer.
[0010] Furthermore, the background SNP information of the willow tree and the base pairs of the reference gene at that site are shown in Table 1:
[0011] Table 1. Background SNP information of willow trees and base pairs of the reference gene for each SNP.
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083] In the table, the numbers / letters before the underline represent chromosome numbers, the following groups of numbers represent the position on that chromosome, and the last letter represents the bases of the reference gene at that site and the mutated bases.
[0084] Furthermore, the design process of the willow whole genome 40K site probe described in this invention includes:
[0085] (1) The probe length is 110bp, the probe GC content is between 30% and 70%, the number of homology regions is ≤5, and the selected regions do not contain SSR repetitive sequence regions and genomic GAP (deletion) regions to the greatest extent possible;
[0086] (2) Design two nucleotide sequences with 60% to 70% overlap and covering the SNP sites based on the SNP sites obtained by screening;
[0087] (3) Single-stranded nucleotides were synthesized according to the designed nucleotide sequence. The two synthesized DNA nucleotide sequences with a length of 110 bp and biotinylate group at the 5' end were called the willow whole genome 40K site probe.
[0088] (4) The two synthesized willow whole genome 40K site probes were mixed in equimolar mass and then diluted to a 3pmol / mL willow whole genome 40K site probe mixture using a mixture of EDTA and Tris HCl.
[0089] In addition, the present invention also provides the application of the willow whole genome 40K SNP liquid phase chip in willow breeding.
[0090] Furthermore, the willow whole genome 40K SNP liquid phase chip provided by this invention can be applied to willow genetic diversity analysis, molecular genetic map construction, whole genome association analysis, variety authenticity identification, molecular marker-assisted selection breeding, and whole genome selection breeding.
[0091] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0092] 1. A high-throughput whole-genome 40K SNP liquid-phase chip for willow genotyping was developed based on targeted capture sequencing technology. Combined with the addition of associated site probes, it overcomes the high cost of willow genetic diversity analysis, QTL mapping, and GWAS analysis in scientific research. It enables willow genotyping and effectively saves the sample testing service cycle, providing technical support for willow scientific research. The scientific research here includes, but is not limited to, willow genetic diversity analysis, molecular genetic map construction, genome-wide association analysis, variety authenticity identification, molecular marker-assisted selection breeding, and whole-genome selection breeding, etc.
[0093] 2. The 40K SNP liquid-phase chip for the whole genome of willow trees enables the complete localization of probe synthesis, sample detection, and detection reagents, thereby effectively avoiding the high costs of importing related equipment and reagents, reducing the risk of leakage of core material data, and avoiding trade frictions and other inconveniences caused by sample detection.
[0094] 3. This willow whole-genome 40K SNP liquid-phase chip overcomes the shortcomings of resequencing, such as large data volume, a lot of useless information, and high analysis difficulty. Under the premise of achieving the same results, it achieves rapid detection, reduced costs, and simple data analysis, which are beneficial to industrial development. In addition, compared with simplified genome sequencing (GBS), the willow whole-genome 40K SNP liquid-phase chip avoids the excessive data volume and the difficulty in comparing and accumulating GBS marker data obtained from different materials, laboratories, and platforms when obtaining high-density molecular markers representing the whole genome. This avoids the shortcomings of GBS data, such as the large data volume and the difficulty in comparing and accumulating GBS marker data obtained from different materials, laboratories, and platforms, which makes it difficult to preserve and comprehensively utilize GBS data for a long time. The willow whole-genome 40K SNP liquid-phase chip has many advantages, such as high data output consistency, long-term use of data from the same material, and relatively simple data analysis.
[0095] 4. A high-throughput whole-genome 40K SNP liquid-phase chip for willow genotyping based on targeted capture sequencing technology was developed. The probe design considered the uniform distribution of captured SNP sites across the entire genome and the polymorphism of these sites. The minimum allele frequency (MAF) of selected sites was chosen to be as high as possible (greater than 0.05). Simultaneously, the detection rate was considered, and SNP sites with high deletion rates were removed. Furthermore, by adding SNP functional markers, genotyping can be achieved using the designed chip, which has significant application value in willow breeding.
[0096] 5. Based on targeted capture sequencing technology, its probe has good tolerance to flanking sequences. Even when the flanking sequence variation is no higher than 10%, it can still stably capture the target sequence. In addition to obtaining target SNP information, it can also obtain 100bp of sequence information upstream and downstream, providing more information support for willow research and molecular breeding.
[0097] 6. Compared with traditional solid-phase chip technology, the liquid-phase chip technology has no requirement for the number of samples to be detected. A small number of samples can be detected. There is no need to collect samples or limit the number of samples during detection, which greatly saves the service cycle of sample detection and improves scientific research efficiency and breeding efficiency. The density of the developed SNP chip can be flexibly adjusted to form different product application scenarios such as 40K, 20K, and 10K. New sites can be added to the product as needed.
[0098] 7. It fills the awkward situation of having no products available when my country's willows are moving from traditional breeding to molecular breeding. It uses targeted capture sequencing technology to design a high-throughput SNP liquid phase probe chip for willows, and promotes GBTS technology to basic research and molecular breeding applications of willows, so as to better apply it to scientific research and breeding processes. Attached Figure Description
[0099] Figure 1 This is a flowchart illustrating the design of the 40K liquid-phase chip for the whole genome of willow trees in this invention.
[0100] Figure 2 This is a distribution diagram of the willow SNP sites on chromosomes according to the present invention;
[0101] Figure 3 This is a population structure diagram of the willow screening population at the site of this invention;
[0102] Figure 4 This is a genome-wide association study (GWAS) diagram of the SNP sites in this invention;
[0103] Figure 5 This is a statistical diagram of the MAF distribution of the SNP sites in this invention;
[0104] Figure 6 This is a statistical diagram showing the distribution of SNP sites in the willow gene structure according to the present invention;
[0105] Figure 7 This is an example diagram of multi-omics joint analysis of SNP sites in this invention;
[0106] Figure 8 This is a schematic diagram of the mutation screening pipeline used in probe design according to the present invention;
[0107] Figure 9 This is a flowchart of the willow library construction and sequencing process of this invention;
[0108] Figure 10 This is a flowchart of the library construction process for this invention;
[0109] Figure 11 Image showing the detection results of loci in 16 willow samples using a 40K liquid phase chip for the whole genome of willow. Figure 12 Validation of the efficiency of the 40k Willow Chip, including (A) the detection rate of the 40k chip in 16 selected samples, where the color of each bar represents the population, and... Figure 3 (A) Consistency; (B) Coverage of the 40k array in 550 new samples, with the red line representing the median; (C) Distribution of the median sequence depth of the 40k array in 550 new samples at 400 bp (blue), with a distance of 0 representing the selected SNP position, negative values upstream and positive values downstream, the red line above the blue line representing 25% depth per base, and the red line below the blue line representing 25% depth per base; (D) Sample recall rate of the 40k chip in 550 new samples, with the red line representing the median; (E) Site recall rate of each 40k array probe, with the red line representing the median.
[0110] Figure 13 GWAS analysis and functional enrichment analysis of potential sites were performed using a 40K liquid-phase microarray of the entire genome of willow.
[0111] Figure 14 The GS analysis and BLUP value calculation of the whole genome of willow were used to estimate the value.
[0112] Figure 15 Population structure capture ability test of S. suchowensis using 40k chip: (A) and (B) PCA plots of 598 S. suchowensis individuals based on whole-genome SNPs and 40k selected SNPs, with each color representing a family; (C) Estimated heritability of growth traits based on whole-genome SNPs and 40k selected SNPs, with different colors and shapes of dots used to indicate the source of phenotypic data in previous studies, and red lines representing diagonals; (D) Box diagram of heritability of all traits in Pengzhou. Detailed Implementation
[0113] The technical solution of the present invention will be further explained below with reference to specific embodiments. However, the present invention is not limited to the following embodiments.
[0114] Example 1
[0115] Basic information on the 40K SNP liquid-phase microarray of the whole genome of willow.
[0116] This invention provides a 40K SNP liquid-phase chip for the whole genome of willow, comprising a willow 40K site probe mixture and a hybridization capture reagent. The willow 40K site probe mixture includes willow SNP background site probes and willow SNP associated site probes, with at least two capture probes for each site. The probe sequences are shown in Table 2. These probes are TaqMan probe information, consisting of two probes with different labels located at the 5' end of the TaqMan probes. The design flowchart is shown below. Figure 1 As shown.
[0117] Table 2. Sequence List of Genotype Probes for Gene Chips
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
[0176]
[0177]
[0178]
[0179]
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210]
[0211]
[0212]
[0213]
[0214]
[0215]
[0216]
[0217]
[0218]
[0219]
[0220]
[0221]
[0222]
[0223]
[0224]
[0225]
[0226]
[0227]
[0228]
[0229]
[0230]
[0231]
[0232]
[0233]
[0234]
[0235]
[0236]
[0237]
[0238]
[0239]
[0240]
[0241]
[0242]
[0243]
[0244]
[0245]
[0246]
[0247]
[0248]
[0249]
[0250]
[0251]
[0252]
[0253]
[0254]
[0255]
[0256]
[0257]
[0258]
[0259]
[0260]
[0261]
[0262]
[0263]
[0264]
[0265]
[0266]
[0267]
[0268]
[0269]
[0270]
[0271]
[0272]
[0273]
[0274]
[0275]
[0276]
[0277]
[0278]
[0279]
[0280]
[0281]
[0282]
[0283]
[0284]
[0285]
[0286]
[0287]
[0288]
[0289]
[0290]
[0291]
[0292]
[0293]
[0294]
[0295]
[0296]
[0297]
[0298]
[0299]
[0300]
[0301]
[0302]
[0303]
[0304]
[0305]
[0306]
[0307]
[0308]
[0309]
[0310]
[0311]
[0312]
[0313]
[0314]
[0315]
[0316]
[0317]
[0318]
[0319]
[0320]
[0321]
[0322]
[0323]
[0324]
[0325]
[0326]
[0327]
[0328]
[0329]
[0330]
[0331]
[0332]
[0333]
[0334]
[0335]
[0336]
[0337]
[0338]
[0339]
[0340]
[0341]
[0342]
[0343]
[0344]
[0345]
[0346]
[0347]
[0348]
[0349]
[0350]
[0351]
[0352]
[0353]
[0354]
[0355]
[0356]
[0357]
[0358]
[0359]
[0360]
[0361]
[0362] A high-throughput whole-genome 40K liquid-phase chip for willow genotyping, developed based on targeted capture sequencing technology, combined with added associated sites, enables willow genotyping and effectively reduces the sample testing service cycle, providing technical support for willow research.
[0363] The hybridization capture reagent was the GenoBaits DNA-seq Library Prep kit from Novogene, Inc., including individually packaged GenoBaits Block I, GenoBaits Block II, GenoBaits 2×HybBuffer, GenoBaits Hyb Buffer Enhancer, GenoBaits 2×BeadsWashBuffer, GenoBaits 10×Wash Buffer I, GenoBaits 10×Wash Buffer II, GenoBaits 10×Wash Buffer III, and GenoBaits 10×Stringent Wash Buffer. The distribution of the willow SNP background site probes on the chromosome is shown below. Figure 2 As shown.
[0364] Example 2
[0365] The 40K locus in the willow genome provided by this invention was obtained through the following method, such as... Figure 8 As shown, each box represents the number of SNPs after each screening step. The areas around the arrows indicate simplified screening steps in the materials and methods:
[0366] (1) Based on the high-depth resequencing data of 1000 willow germplasm resources, after comparing the willow reference genome with BWA2, the genome version of the willow reference genome is the version published by Nanjing Forestry University in the internationally renowned journal "Horticulture Research". Specifically, it can be obtained from Genome assembly ASM1755242v1 in the Salixsuchowensis section of the international database NCBI, at the following URL: https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_017552425.1 / . Furthermore, to make this invention more easily understood by those skilled in the art, the chromosome numbers in the genome were renumbered sequentially; GATK4 was used to detect background SNP sites in all samples and quality-filtered the sites; several sites were selected for target site selection associated with traits using other multi-dimensional analyses; the site selection was performed again according to the site selection and filtering criteria, and the probe success rate of the final set was evaluated.
[0367] (2) Willow whole genome 40K liquid phase chip, willow SNP associated sites were obtained by the following method: After comparing the willow reference genome with BWA, the union of all sample SNP sites was detected by GATK, and whole genome association analysis was performed in combination with 69 willow traits. Significantly associated SNPs were obtained by using the mixed linear model of GenoABEL software. The formula was calculated as: y=Xα+Qβ+Kμ+e; The sample population structure Q was calculated and the population structure diagram was drawn by PLINK v1.9 software. Then, the kinship K between samples was calculated by PLINK v1.9 software, where X is the genotype and y is the phenotype. Each SNP site in each metabolite phenotype was given an association value; the significantly associated SNP sites were obtained by filtering with a threshold after Bonferroni correction and selecting sites with a distance greater than 50bp.
[0368] (3) Compare the willow SNP functional markers with the total set of markers obtained in step (1) to remove duplicates. After removing duplicates, merge the remaining markers to obtain the markers used for probe evaluation and development.
[0369] (4) When evaluating probes, select sites: discard sites whose sequences in the genome are repetitive regions within 50 bp upstream and downstream of the remaining sites, calculate the GC content of each of the remaining sites within 50 bp upstream and downstream, retain target sites with a content greater than 30% and less than 70% as candidate sites, and screen out several sites containing willow SNP-related sites.
[0370] (5) Divide the chromosome into segments of equal length. For all designed loci, select candidate loci with MAF > 0.05 for each segment. According to the even distribution of chromosomes and the high MAF value, add all associated loci to obtain a total of several loci. Add functional markers to them to form a set of 50K loci for testing.
[0371] (6) Through product testing, about 10K sites with poor genotyping performance were removed to form a product set that meets the evaluation requirements and contains core sites with related sites, and a whole genome 40K liquid phase chip was formed, and the best experimental procedure for the willow whole genome 40K liquid phase chip was formed.
[0372] The detection views of the 40K liquid-phase chip for the whole genome of willow obtained through Examples 1 and 2 are as follows: Figures 3 to 7 As shown.
[0373] Example 3
[0374] The willow whole genome 40K SNP liquid phase chip provided by this invention includes the following design process for the willow whole genome 40K site probes:
[0375] (1) The probe length is 110bp, the probe GC content is between 30% and 70%, the number of homology regions is ≤5, and the selected regions do not contain SSR repetitive sequence regions and genomic GAP (deletion) regions to the greatest extent possible;
[0376] (2) Design two nucleotide sequences with 60% to 70% overlap and covering the SNP sites based on the SNP sites obtained by screening;
[0377] (3) Single-stranded nucleotides were synthesized according to the designed nucleotide sequence. The two synthesized DNA nucleotide sequences with a length of 110 bp and biotinylate group at the 5' end were called the willow whole genome 40K site probe.
[0378] (4) The two synthesized willow whole genome 40K site probes were mixed in equimolar mass and then diluted to a 3pmol / mL willow whole genome 40K site probe mixture using a mixture of EDTA and Tris HCl.
[0379] Example 4
[0380] The application process of the 40K SNP liquid-phase chip of the willow whole genome obtained by Examples 1 to 3 is as follows.
[0381] (1) Take 10 willow leaf samples and let them air dry in the laboratory for DNA extraction; the gene sequence extraction process is as follows. Figure 9 As shown;
[0382] (2) DNA extraction, library construction, sequencing, and final SNP data were performed according to the experimental procedures for the 40K SNP liquid-phase chip of the willow whole genome. The library construction process is as follows: Figure 10 As shown
[0383] (3) Product detection rate is an important indicator for measuring chip quality. In plants, the detection rate is generally measured by the ratio of the number of detected sites to the number of developed sites; therefore, the detection situation was statistically analyzed (e.g., Figure 11 As shown in the figure, the chip contains a total of 40,188 sites. The average detection rate of the original SNP sites in 16 samples was 97.39%. After merging the data of the 16 samples, the site detection rate reached 99.9%.
[0384] Example 5
[0385] Chip accuracy testing.
[0386] Before using the chip in *S. suchowensis*, this project selected two individuals from each family for final testing to verify the capture capability of the synthetic DNA probe. Figure 12As shown in Figure A, the array exhibited a high recall rate across all selected samples, with a minimum of 96.95%. We then applied the array to a new population: 550 new samples were collected from 8 new families for GBTS and genotyping. The raw sequencing volume per person was approximately 2 Gb, and 50% of the samples witnessed an average coverage of 219.70 times for all designed probe sites. Figure 12 B). High sequencing depth ensures robust data generation with minimal fluctuations in target probe region coverage. The sequencing depth of each probe follows a normal distribution, with a median depth of 88.49-fold at the selected SNP locations, gradually decreasing with increasing upstream / downstream flanking distances. Figure 12 C). These results demonstrate that the optimized probes bind normally to DNA, and the data can be used for variant detection. After genotyping, the array showed a high recall rate (median 97.05%) across all samples. Figure 12 D). Furthermore, for the designed probes, 50% of the probes showed a high recall rate at all sites (median 99.99%). Figure 12 E). These validations demonstrate that the array is highly efficient on new samples.
[0387] Example 6
[0388] Application of identification and analysis of potential breeding sites for willow.
[0389] The pH and GD phenotypes of 550 new samples from Yibin (YB) and Pengzhou (PZ) were measured every 15 days, starting one month after planting. A GWAS analysis was then performed. The GWAS analysis identified 72 SNPs significantly associated with growth traits. Figure 13 AD). Of these, 63 SNPs were distributed across 50 gene regions, and 9 SNPs were located in intergenetic regions (AD). Figure 13E). Three clearly related SNPs were located in the TES regions of three genes. These variations may induce changes in gene expression and further affect growth traits, highlighting the importance and significance of incorporating functional SNPs into array design. For example, SNP 4:16980574(T→C) is located on the second stop codon of IMY05_004G0170200 (Ref: https: / / pmc.ncbi.nlm.nih.gov / articles / PMC9664647 / ), and may affect the accuracy of gene translocations through stop codon transitions. Since the annotation function of IMY05_004G0170200 is a vacuolar sorting receptor, which can recognize specific sorting signals of proteins, this variation may affect plant growth by mediating protein sorting and transport to vacuoles (Masclaux et al.). A total of 169 genes were detected within 10kb flanking all SNPs. GO enrichment analysis showed that these genes are enriched in biological processes such as cell division, cell development, and growth. Figure 13 F), which provides promising candidate genes for the growth traits of S. suchowensis.
[0390] Reference: Masclaux, FG, Galaud, JP, and Pont-Lezica, R. (2005). Theriddle of the plant vacuolar sorting receptors. Protoplasma 226, 103–108. doi:10.1007 / s00709-005-0117-3
[0391] Example 7
[0392] Application of estimation of genome-wide selection breeding value (BLUP) in willow populations.
[0393] Genomic selection (GS) is a promising technique in agronomic breeding that improves breeding efficiency by selecting elites with high breeding value, rather than by measuring actual phenotypes. We can evaluate the accuracy of GS by applying the G matrix calculated from 40k SNPS microarray loci to the GBLUP model. After splitting the training and test sets using five-fold cross-validation, the Pearson correlation between breeding values and predicted breeding values calculated in the five test sets is used as the standard. Figure 14 As shown, breeding values for all traits across different planting locations and measurement times exhibited high correlations, with a median correlation of 0.90. This high correlation demonstrates the feasibility of this chip in S. suchowensis genome selection and highlights its potential to accelerate future breeding processes.
[0394] Example 8
[0395] Application of willow community structure detection.
[0396] This chip, through PCA analysis of 598 samples from 8 hybrid families in two locations, showed that it could effectively divide these 8 hybrid families into 8 distinct clusters, demonstrating its value in detecting willow population structure. Figure 15 (AB). In the PCA plot, clear separation along the principal components revealed unique genetic signals for each family, with clusters showing consistent internal distribution and minimal overlap. Consistent with 598 individuals from 8 families, individuals in the 8 populations were clearly observable in the PCA scatter plot, whether for whole-genome SNPs or 40k selected SNPs. Furthermore, we compared the estimated heritability of growth traits (plant height-pH and diameter at breast height-GD) measured in the three cities of Leshan-LS, Pengzhou-PZ, and Yibin-YB to assess the suitability of the selected SNPs for future genetic studies. This comparative analysis spanned multiple environments and traits, ensuring that the assessment covered a wide range of genetic influences on the phenotype. Similarly, the estimated heritability of growth traits was highly correlated between genome-wide SNPs and 40k selected SNPs (Pearson correlation coefficient = 0.99, p-value = 2.82e-93). For example, the median difference in heritability between genome-wide SNPs and 40k selected SNPs was only 5.68e-3 across all phenotypes in Pengzhou. This small difference highlights the precision of the 40k SNP array in capturing the genetic structure of traits. These results demonstrate the feasibility of this chip in practical production activities.
[0397] Example 9
[0398] Detection of variant sites in willow populations.
[0399] The 40k willow chip also includes the probe shown below, with the specific nucleotide sequence as follows: TAATTTGGAGATGCTGCTTATTTACTCGATGCCGCAATCTCACTAGCTCACTT TCAGGTGTCCCCACGGGGAGCATGATGAACAGGGATGTCTGCTTGAC. The probe, with the nucleotide sequence shown above, is liquid-phase hybridized with genomic DNA. After capturing and enriching the target region sequence, high-throughput sequencing is performed using a sequencing platform. The candidate region SNP 4:16980574 (T→C) can be detected. If this fragment is present, it indicates that the plant has a variant site that contributes to traits such as plant height and diameter at breast height, and has the potential to become a parent plant for hybridization. Otherwise, it does not.
[0400] In summary, the willow whole genome 40K SNP liquid phase chip disclosed in this invention has high density and high site capture efficiency. The willow whole genome 40K SNP liquid phase chip disclosed in this invention can be applied to willow genetic diversity analysis, molecular genetic map construction, genome-wide association analysis, variety authenticity identification, molecular marker-assisted selection breeding, and genome-wide selection breeding.
Claims
1. A willow full genome 40K SNP liquid chip, characterized in that, The hybridization capture reagent is GenoBaits DNA-seq Library Prep kit of Novogene Co., Ltd., including independently packaged GenoBaits Block I, GenoBaits Block II, GenoBaits 2xHyb Buffer, GenoBaits HybBuffer Enhancer, GenoBaits 2xBeadsWashBuffer, GenoBaits 10xWash Buffer I, GenoBaits 10X Wash Buffer II, GenoBaits 10xWash Buffer III and GenoBaits 10XStringent Wash Buffer. 2.The willow full-genome 40K SNP liquid chip of claim 1, wherein, The SNP background site information of the willow and the base of the site reference gene are shown in the following table: 3.The willow full-genome 40K SNP liquid chip of claim 1, wherein, The underlined number / letter in the table represents the chromosome label, the following number group represents the position on the chromosome, and the last letter represents the base of the site reference gene and the mutated base. The design process of the willow full genome 40K site probe includes: 4.The willow full-genome 40K SNP liquid chip of claim 1, wherein, (1) The probe length is 110 bp, the probe GC content is between 30% and 70%, and the number of homologous regions is ≤5, and the selected region maximally does not contain SSR repeat sequence region and genomic GAP (missing) region; (2) Design two nucleotide sequences with 60% to 70% overlap and covering SNP sites according to the obtained SNP sites; (3) According to the designed nucleotide sequence, single-stranded nucleotide synthesis is carried out, and the synthesized two DNA nucleotide sequences with a length of 110 bp and a 5' end with a biotin group modification are called willow full genome 40K site probes; (4) The above two synthesized willow full genome 40K site probes are mixed in equal molar amount, and the mixture is made into 3 pmol / mL of willow full genome 40K site probe mixture by using EDTA and Tris HCl mixture.
5. The application of the willow full genome 40K SNP liquid chip in willow breeding according to any one of claims 1 to 4. The willow full genome 40K SNP liquid chip is applied to willow genetic diversity analysis, molecular genetic map construction, whole genome association analysis, variety authenticity identification, molecular marker assisted selection breeding, and whole genome selection breeding.
6. Use according to claim 5, characterized in that,