A molecular marker closely linked to soybean seed protein content qtl qpro12 and application thereof

By using genome-wide association analysis and the development of PARMS markers, the problem of insufficient QTL mapping for soybean seed protein content was solved, enabling efficient and low-cost large-scale breeding screening.

CN121065383BActive Publication Date: 2026-04-17INST OF FOOD CROPS HUBEI ACAD OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511249763.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-03
Publication Date
2026-04-17
Estimated Expiration
2045-09-03

AI Technical Summary

Technical Problem

In existing technologies, there are few fine mappings and candidate gene validations for soybean seed protein content QTLs, and there is a lack of efficient and low-cost screening methods in large-scale breeding.

Method used

By constructing an association population based on 768 core soybean germplasm resources, genome-wide association analysis was used to identify the QTL site qPro12 at position 7,757,075 of chromosome 12, and a closely linked PARMS marker was developed for screening and breeding of soybean seed protein content.

Benefits of technology

This method enables efficient screening of soybean seed protein content, explaining 0.51% of phenotypic variation. It is simple to operate and low in cost, making it suitable for high-throughput screening of large-scale breeding populations.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

This invention belongs to the field of molecular biology and genetic breeding technology, and discloses a QTL related to soybean seed protein content. qPro12 Tightly linked molecular markers and their applications. A genome-wide association study (GWAS) was used to identify a seed protein content QTL on soybean chromosome 12. qPro12 The significantly associated SNP is located at position 7,757,075 on chromosome 12 of the reference genome Glycine_max_v2.1, and can explain 0.51% of the phenotypic variation in the associated population. PARMS markers developed using this SNP were used to detect genotyping in 256 soybean varieties, demonstrating clear typing and ease of operation, making it suitable for molecular breeding of soybean grain protein content.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and genetic breeding technology, specifically relating to a molecular marker closely linked to soybean seed protein content QTL qPro12 and its application. Background Technology

[0002] Soybean (Glycine max(L)Merr.) is one of the most important sources of high-quality plant protein and edible oil in my country, playing an irreplaceable role in improving people's dietary structure and promoting the development of animal husbandry. The protein content of soybean seeds exhibits wide variation. In recent years, forward genetic studies of soybean seed protein have identified many quantitative trait loci (QTLs) that regulate variation in seed protein content. Soybean seed protein content is a quantitative trait controlled by multiple genes, influenced by genotype, environment, and the interaction between genotype and environment (Patil et al 2018). Most QTL mapping studies on soybean seed protein content are based on biparental mapping populations constructed from two soybean materials. As of June 2024, the Soybase database (https: / / www.soybase.org) published 241 QTLs related to soybean seed protein content, distributed across 20 chromosomes; however, few QTLs have been finely mapped and their candidate gene functions have been validated. Among all identified QTLs for seed protein content in soybean, two loci, qPRO20 and qPRO15, on chromosomes 20 and 15, have been widely detected due to their large additive effects and strong stability (Warrington et al. 2015). The fine mapping of these two loci and the identification of key candidate genes have been a hot topic in the genetic anatomy of soybean seed proteins. Thirty years after their initial detection, Fliege et al. (2022) successfully fine-mapped qPRO20 within a ~77.8 kb region and discovered insertions / deletions highly correlated with seed protein content in the CCT domain of Glyma.20G085100. They further validated the function of the CCT domain using RNA interference (RNAi) transgenic soybeans. Almost simultaneously, Goettel et al. (2022) also revealed Glyma.20G085100 as a candidate gene for qPRO20 using GWAS. For another major-effect probable locus, qPRO15, Zhang et al. (2020) located qPRO15 within a 4 Mbp region using linkage mapping. Subsequently, they conducted association analysis of candidate regions within this region in a natural population, further identifying GmSWEET39 (Glyma.15G049200) as a key candidate gene for qPRO15. Meanwhile, two GWAS studies analyzing soybean seed protein and oil content also revealed the crucial role of Glyma.15G049200 (Miao et al 2020; Wang et al 2020).

[0003] With the development of next-generation sequencing technology and the high-quality assembly of the soybean reference genome, GWAS has become a powerful method for mining protein QTLs in the past decade, greatly improving the efficiency and accuracy of QTL mapping (Gupta et al. 2017; Patil et al. 2017). Hwang et al. (2014) conducted association analysis on 55,159 SNPs in 298 soybean germplasm resources, and found 40 significantly associated SNPs in 17 genomic regions highly associated with seed protein content. Zhang et al. (2014) used GWAS to find significant SNP clusters associated with seed protein on chromosomes 4, 10, 15, and 19 in 192 soybean germplasm resources. Multiple GWAS studies have detected significantly associated sites with soybean seed protein content on chromosomes 20 and 15, and have used the advantage of high mapping accuracy to help identify candidate genes for these two sites in later stages (Vaughn et al. 2014, Bandillo et al. 2015, Sonah 2015). Besides the two major loci on chromosomes 20 and 15, other frequently mapped important QTLs have also yielded new insights through genome-wide association studies. Many GWAS studies have shown significant associations between soybean seed protein content and SNPs near qPRO8 on chromosome 8 (Li et al. 2018; Shook et al. 2021). Another repeatedly mapped QTL, qPRO5 on chromosome 5, has also been identified multiple times by GWAS over the past decade (Hwang et al. 2014; Vaughn et al. 2014; Sonah et al. 2015; Li et al. 2018). Duan et al. (2022) conducted a GWAS study on soybean seed thickness and found that GmST05 (Glyma.05G244100), in addition to controlling seed size, also affects seed protein and oil content. In addition, a recent GWAS study on seed thickness found that ST1 (Glyma.08G109100) is located near a known protein QTL on chromosome 8 and has an impact on seed morphology and seed oil content (Li et al 2022).

[0004] This invention is based on an associated population constructed from 768 core soybean germplasm resources from home and abroad. Combining population genotype data and seed protein content phenotypic data, genome-wide association analysis was used to identify a major QTL site qPro12 that regulates variation in soybean seed protein content. A PARMS marker closely linked to qPro12 was also developed, which can be used to assist in soybean plant type breeding. Summary of the Invention

[0005] The purpose of this invention is to provide a reagent for detecting the base at position 7,757,075 of soybean chromosome 12 and its application in soybean seed protein content screening breeding.

[0006] Another object of the present invention is to provide the application of a reagent for detecting the base at position 7,757,075 of soybean chromosome 12 in the preparation of a soybean seed protein content screening kit.

[0007] The final objective of this invention is to provide a method for screening and breeding soybean seed protein content.

[0008] To achieve the above objectives, the present invention adopts the following technical measures:

[0009] Obtaining a molecular marker tightly linked to soybean seed protein content QTL qPro12:

[0010] (1) Population Construction and Phenotypic Identification: 768 soybean accessions with broad genetic diversity from 23 provinces in my country were selected as core resources to construct soybean-related populations. The 2023 soybeans were planted at the Guizhou Nanfan Base (2023LD) in Ledong County, Hainan Province. The field trial employed a randomized block design with three replicates; two-row planting was used, with each family planted in one row of 20 plants, 2m long and 0.5m apart. After maturity, the grains were harvested, and the protein content (%) was determined using near-infrared spectroscopy. The average of the three replicates under this environment was taken as the phenotypic value of the material.

[0011] (2) Genotyping analysis: Using the BGI T7 sequencing platform, whole-genome resequencing was performed on 768 materials from the associated population. Genotyping was performed on the 768 materials using resequencing technology. The average sequencing depth was ~20×, and SNPs with a deletion rate >10% and a minimum allele frequency <0.05 were filtered out. Finally, 6,339,330 high-quality SNPs were retained for whole-genome association analysis.

[0012] (3) Genome-wide association analysis: A mixed linear model (MLM) was used in GEMMAX software for association analysis, with a significance threshold set at P ≤ 1 / n (n being the number of SNPs, 6,339,330). The results showed a stable associated QTL locus, qPro12, on chromosome 12, explaining 0.51% of the phenotypic variation in the associated population. Its peak SNP marker was named S12_7757075, located at base 7757075 on chromosome 12 of the soybean genome reference genome Glycine_max_v2.1, with an allele of G / T. Materials containing the high seed protein content allele had an average seed protein content 2.53% higher than materials containing the low seed protein content allele.

[0013] (4) PARMS marker development: Specific primers were designed based on the upstream and downstream sequences of the S12_7757075 site to construct a PARMS detection system. The primer sequences are as follows:

[0014] PARMS12:CACTGTCCACAACCGCGTGAG,

[0015] PARMS12P1:GAAGGTGACCAAGTTCATGCTAAGCATGCCTTGTGAAAGCAT, PARMS12P2:GAAGGTCGGAGTCAACGGATTAAGCATGCCTTGTGAAAGCAG.

[0016] The scope of protection of this invention includes:

[0017] Application of reagents for detecting the genotype of the 7,757,075th base on soybean chromosome 12 in soybean seed protein content breeding.

[0018] Application of reagent for detecting base position 7,757,075 on soybean chromosome 12 in the preparation of a soybean seed protein content screening kit.

[0019] In the above-described applications, if the base at position 7,757,075 of soybean chromosome 12 is detected to be T, then the soybean is determined to be a high-seed protein content material.

[0020] In the above-described applications, if the base at position 7,757,075 of soybean chromosome 12 is detected to be G, then the soybean is determined to be a low-seed protein content material.

[0021] In the above applications, the preferred reagent is a primer.

[0022] The primers described above are preferably PARMS detection primers, and more preferably the primers provided by the present invention: PARMS12: CACTGTCCACACCGCGTGAG, PARMS12P1: GAAGGTGACCAAGTTCATGCTAAGCATGCCTTGTGAAAGCAT and PARMS12P2: GAAGGTCGGAGTCAACGGATTAAGCATGCCTTGT GAAAGCAG.

[0023] A method for screening soybean seed protein content in breeding includes detecting the 7,757,075th base of soybean chromosome 12 using conventional methods in the art. The conventional methods include, but are not limited to: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry.

[0024] The version number of the soybean reference genome used in this invention is Glycine_max_v2.1, and the URL is https: / / ensembl.gr amene.org / Glycine_max / .

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] (1) The QTL qPro12 identified in this invention can explain 0.51% of the phenotypic variation in grain protein content in the associated population, and has high breeding application value.

[0027] (2) The developed PARMS markers are easy to operate, low in cost, and have clear typing, making them suitable for high-throughput screening of large-scale breeding populations. Detailed Implementation

[0028] Unless otherwise specified, the technical solutions described in this invention are all conventional techniques in the field; the reagents or materials described, unless otherwise specified, are all from commercial sources. The version number of the soybean reference genome used in this invention is Glycine_max_v2.1, and the URL is https: / / ensembl.gramene.org / Glycine_max / .

[0029] Example 1:

[0030] SNP molecular markers significantly associated with soybean seed protein content QTL qPro12:

[0031] Test materials: 768 soybean accessions with broad genetic diversity from 23 provinces in my country were used as core resources to construct a soybean-related population.

[0032] (1) Identification of soybean seed protein content: 2023 soybeans were planted at the Guizhou Nanfan Base (2023LD) in Ledong County, Hainan Province. The field trial adopted a randomized block design with three replicates. The plants were planted in two rows, with 20 plants per family per row, 2m long and 0.5m apart. After maturity, the seeds were harvested, and the seed protein content (%) was determined by near-infrared spectroscopy. The average value of the three replicates under this environment was taken as the phenotypic value of the material.

[0033] (2) Genotyping analysis: Using the BGI T7 sequencing platform, whole-genome resequencing was performed on 768 materials from the associated population. Genotyping was performed on the 768 materials using resequencing technology. The average sequencing depth was ~20×, and SNPs with a deletion rate >10% and a minimum allele frequency <0.05 were filtered out. Finally, 6,339,330 high-quality SNPs were retained for whole-genome association analysis.

[0034] (3) Genome-wide association analysis: Combining population genotype and phenotypic data, the mixed linear model (MLM) in GEMMAX software was used for association analysis, with the significance threshold set to P≤1 / n (n is the number of SNPs, 6339330).

[0035] (4) Obtaining qPro12 and its significantly associated SNP markers: Association analysis results showed that a significantly associated QTL site qPro12 was found on chromosome 12, which could explain 0.51% of the phenotypic variation. Its peak SNP marker was named S12_7757075, located at base 7757075 on chromosome 12 of the soybean Glycine_max_v2.1 reference genome, with an allele of G / T, and its flanking sequence is: 5'-CTCTGCTTTATTTACCAACTTTATGAAAGCAAGCATGCCTTGTGAAAGCA

G / T

[0036] Example 2:

[0037] Development of a PARMS marker closely linked to soybean seed protein content:

[0038] Based on the nucleotide sequences preceding and following the peak SNP marker S12_7757075, which is significantly associated with qPro12, the PARMS marker detection primer sequences were obtained according to primer design principles as follows:

[0039] PARMS12:CACTGTCCACAACCGCGTGAG,

[0040] PARMS12P1: GAAGGTGACCAAGTTCATGCT AAGCATGCCTTGTGAAAGCAT, PARMS12P2: GAAGG TCGGAGTCAACGGATT AAGCATGCCTTGTGAAAGCAG.

[0041] The underlined part is the fluorescent connector.

[0042] The method for detecting the genotype of the soybean qPro12 locus using the above PARMS primer set is as follows:

[0043] (1) Extract genomic DNA from the soybeans to be tested.

[0044] (2) Preparation of the reaction system. The reaction system consisted of 5 μL, including 2.5 μL of 2×PARMS PCR reaction mix (a product of Wuhan Jingtai Biotechnology Co., Ltd.), aqueous solutions of primers PARMS12, PARMS12P1, and PARMS12P2, DNA, and water. In the reaction system, the concentrations of primers PARMS12P1 and PARMS12P2 were both 150 nM, and the concentration of primer PARMS12 was 400 nM.

[0045] (3) Add 5 μL of paraffin oil to the reaction system (to prevent sample evaporation), and then perform PCR amplification.

[0046] The reaction program was as follows: 95℃ for 15 min; 95℃ for 20 s, 65℃ for 1 min, decreasing by 0.8℃ per cycle until reaching 57℃, for 10 cycles; 95℃ for 20 s, 57℃ for 1 min, for 32 cycles.

[0047] (4) After completing step (3), the signal is read on the TECAN Infinite M1000 and then the following judgment is made: if blue is displayed, the corresponding soybean is or is suspected to be a high-seed protein content soybean; if green is displayed, the corresponding soybean is or is suspected to be a low-seed protein content soybean.

[0048] Using the primers described above, the sequence amplified from the high-seed protein content material Changjiangchun 2 is:

[0049] 5'-AAGCATGCCTTGTGAAAGCA T AATACTAATACTCACGCGGTGTGGACAGTG-3'

[0050] The amplification product sequence of the low-seed protein content material Jiyu 166 is:

[0051] 5'-AAGCATGCCTTGTGAAAGCA G AATACTAATACTCACGCGGTGTGGACAGTG-3'

[0052] Example 3:

[0053] Universality of PARMS markers in the selection of soybean seed protein content traits:

[0054] The PARMS primer set designed in Example 2 was used to detect the genotype and genetic effect of the qPro12 locus in the soybean to be tested. 256 soybean varieties (lines) from both domestic and international sources were used for the test. Following the method described in Example 1, field identification was conducted in 2024 at the Guizhou Nanfan Breeding Base (2024LD) in Ledong County, Hainan Province, and the seed protein content was examined.

[0055] The results showed that among the 256 soybean materials, 19 had the TT genotype, with an average grain protein content of 47.46%; and 237 had the GG genotype, with an average grain protein content of 45.03%. The difference in grain protein content between the TT and GG genotypes was highly significant (P-value = 1.05e-2). This result indicates that the qPro12 locus is segregated in the 256 domestic and international soybean materials and has a stable and reliable genetic effect.

[0056] The above results indicate that the prepared PARMS molecular marker qPro12 has a significant genetic effect on the seed protein content of soybeans and has a good screening effect.

Claims

1. The application of a reagent for detecting the 7,757,075th base of soybean chromosome 12 in soybean seed protein content screening breeding. The determination method in the application process is as follows: if the reagent detects that the 7,757,075th base of soybean chromosome 12 is of the TT genotype, then the soybean is determined to be a high seed protein content material; if the reagent detects that the 7,757,075th base of soybean chromosome 12 is of the GG genotype, then the soybean is determined to be a low seed protein content material. The version number of the soybean reference genome used is Glycine_max_v2.

1.

2. The application of the reagent for detecting the 7,757,075th base of soybean chromosome 12 in the preparation of a soybean seed protein content screening kit. The determination method in the application process is as follows: if the reagent detects that the 7,757,075th base of soybean chromosome 12 is of the TT genotype, then the soybean is determined to be a high seed protein content material; if the reagent detects that the 7,757,075th base of soybean chromosome 12 is of the GG genotype, then the soybean is determined to be a low seed protein content material. The version number of the soybean reference genome used is Glycine_max_v2.

1.

3. The application according to claim 1 or 2, characterized in that: The reagent is a primer.

4. The application according to claim 3, characterized in that: The primers are PARMS detection primers, and the primer sequences are as follows: PARMS12: CACTGTCCACACCGCGTGAG, PARMS12P1: GAAGGTGACCAAGTTCATGCTAAGCATGCCTTGTGAAAGCAT and PARMS12P2: GAAGGTCGGAGTCAACGGATTAAGCATGCCTTGTGAAAGCAG.

5. A method for screening soybean seed protein content in breeding, comprising detecting the genotype of the 7,757,075th base on soybean chromosome 12, wherein the detection method is sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry method; the determination method is as follows: if the 7,757,075th base on soybean chromosome 12 is detected as the TT genotype, then the soybean is determined to be a high seed protein content material; if the 7,757,075th base on soybean chromosome 12 is detected as the GG genotype, then the soybean is determined to be a low seed protein content material, and the version number of the soybean reference genome used is Glycine_max_v2.1.

Citation Information

Patent Citations

  • Soybean protein content QTL (Quantitative Trait Loci) qPRO141 as well as molecular marker and application thereof

    CN116445650A

  • Soybean SNP marker combination based on KASP technology and application of soybean SNP marker combination in variety identification

    CN117363771A