Application of soybean gene GmSAMMT in resisting soybean mosaic virus disease

Abstract

The invention discloses an application of a soybean S-adenosine-L-methionine methyltransferase gene GmSAMMT in soybean resistance to soybean mosaic virus diseases. The invention also discloses application of the soybean S-adenosine-L-methionine methyltransferase gene GmSAMMT as shown in SEQ ID NO.1 and SEQ ID NO.2 in gene engineering modification of soybean mosaic virus disease resistance. The soybean S-adenosine-L-methionine methyltransferase gene GmSAMMT provided by the invention can negatively regulate the resistance of soybeans to diseased soybean mosaic virus diseases, and the antiviral reaction of the soybeans can be activated due to function deficiency of the soybean S-adenosine-L-methionine methyltransferase gene GmSAMMT. The gene is knocked out through a CRISPR / Cas9 gene editing technology, so that the resistance of soybeans to the soybean mosaic virus disease can be remarkably improved.

Description

Technical Field

[0001] This invention relates to the application of the soybean S-adenosine-L-methionine methyltransferase gene GmSAMMT in resistance to soybean mosaic virus disease, and belongs to the field of genetic engineering. Background Technology

[0002] Soybean mosaic virus (SMV) is the most threatening viral disease in the global soybean production system. This virus induces a systemic lesion by triggering a hypersensitivity response (HR) in the plant. Typical symptoms include necrotic spots on leaves, yellowing and browning of leaf veins, stunted and deformed plants, and in severe cases, browning of stems and petioles, leaf drop, and even plant death. The cellular response to SMV infection varies significantly among different resistant varieties: varieties carrying quality resistance genes maintain intact cell structure; quantitatively resistant varieties only suffer damage to some organelles (such as chloroplast lamellae and mitochondrial membrane systems); while susceptible varieties show large aggregations of viral particles and columnar inclusions in cells, with organelles exhibiting disintegrative destruction. Viral infection reduces photosynthetic assimilation efficiency in leaves by 30%-50%, leading to a sharp decrease in the number of pods per plant and resulting in yield losses of 35%-90%. Notably, the damage is exacerbated when soybean mosaic virus is co-infected with common bean pod mottle virus (BPMV), with the synergistic effect increasing yield losses to 66%-80%. The damage to seed quality caused by soybean mosaic virus (SMV) is also significant. It not only reduces protein content by 1.5-3.2% and oil content by 2.8-4.5%, but also alters the composition of essential amino acids and induces characteristic brown spots on the seed coat, significantly lowering its commercial grade. Currently, there are no effective chemical methods to control soybean mosaic virus disease; therefore, discovering disease-resistant genes and breeding disease-resistant varieties remains the most economical and environmentally friendly approach.

[0003] In plants, S-adenosyl-L-methionine methyltransferase (SAMMT) catalyzes the methyl transfer of S-adenosylmethionine (SAM), participating in chlorophyll synthesis, lignin and lignan synthesis, flavonoids, hydroxycinnamic acid and stilbene, and other aromatic and volatile fragrances and aromatic compounds. The function of the soybean gene GmSAMMT in resistance to soybean mosaic virus (SMV) has not been reported. The applicant's research found that GmSAMMT responds to SMV induction, and successfully obtained overexpressed GmSAMMT and CRISPR / Cas9 gene-edited transgenic soybean plants using genetic engineering techniques. After inoculating transgenic and control plants with SMV, it was found that GmSAMMT negatively regulates soybean resistance to SMV, and its loss of function significantly improves soybean resistance to SMV, indicating that GmSAMMT is an important gene for enhancing soybean resistance to SMV. Summary of the Invention

[0004] The purpose of this invention is to disclose the genetic engineering application of the soybean gene GmSAMMT for disease resistance. This gene can be used as a target gene. Knocking out the GmSAMMT gene in soybean can reduce the expression level of the viral CP protein gene and enhance the soybean's resistance to SMV.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] The soybean S-adenosine-L-methionine methyltransferase gene GmSAMMT has the following nucleotide sequence: SEQ ID NO.1.

[0007] The soybean S-adenosine-L-methionine methyltransferase gene GmSAMMT has the following amino acid sequence: SEQ ID NO.2.

[0008] Application of soybean S-adenosine-L-methionine methyltransferase gene GmSAMMT in regulating soybean resistance to SMV, wherein the nucleotide sequence of soybean S-adenosine-L-methionine methyltransferase gene GmSAMMT is: SEQ ID NO.1.

[0009] The preferred application is to knock out GmSAMMT in soybeans to reduce the accumulation of SMV in soybeans.

[0010] When constructing plant knockout vectors using GmSAMMT, any enhancing or inducible promoter can be added before the transcription initiation nucleotide. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector can be modified, such as by adding selective marker genes (GUS gene, luciferase gene, etc.). From a safety perspective, no selective marker genes may be added, and transformed plants can be selected through stress screening.

[0011] The soybean gene GmSAMMT described in this invention, after being transformed into soybeans through genetic engineering and knocked out by CRISPR-mediated knockout, can reduce the expression level of the viral CP protein gene and reduce the SMV content in soybeans.

[0012] The plant knockout vector carrying the GmSAMMT of this invention can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The transformed plant hosts can be monocotyledonous plants such as sorghum, rice, wheat, and corn, or dicotyledonous plants such as peanuts, soybeans, rapeseed, tomatoes, poplars, turfgrass, and alfalfa.

[0013] Beneficial effects

[0014] GmSAMMT in soybean is an S-adenosyl-L-methionine methyltransferase gene. In soybean research, we found that overexpression of this gene did not alter plant resistance to soybean mosaic virus (SMV), while knocking out the gene increased plant resistance, reduced the expression of the viral CP protein gene, and decreased the accumulation of SMV in soybeans. Therefore, the GmSAMMT gene can be used for breeding soybean varieties resistant to SMV. Attached Figure Description

[0015] Figure 1 The GmSAMMT gene responds to soybean mosaic virus SC7 induction. Kefeng No. 1: disease-resistant material; Nannong 1138-2: susceptible material. n=3, two-tailed t-test: **, ***, **** represent P<0.01, P<0.001, and P<0.0001 respectively, ns indicates no significance. Error bars represent ±SE (standard error).

[0016] Figure 2 Relative expression levels of the GmSAMMT gene in transgenic soybeans overexpressing GmSAMMT. JACK is wild-type, OE-SA-4 is a GmSAMMT overexpressing line, n=3, two-tailed t-test: **** indicates P<0.0001. Error bars represent ±SE (standard error).

[0017] Figure 3 Results of GmSAMMT gene overexpression transgenic soybean test strip detection. JACK, a wild-type control and non-transgenic plant, showed only one band. Five positive seedlings of the OE-SA-4 line were tested, showing two bands.

[0018] Figure 4 DNA sequencing results of the GmSAMMT gene in the CRISPR / Cas9 gene-edited line. JACK is wild-type, and KO-SA-1 (knock out-GmSAMMT-1) and KO-SA-5 (knock out-GmSAMMT-5) are knockout mutants. The sequencing peak results of the two mutants are single peaks.

[0019] Figure 5 Plants and leaves of GmSAMMT knockout transgenic soybean inoculated with the SMV-SC7 line 21 days after inoculation. PBS served as a control, with 0.01 mol / L phosphate buffer applied. SC7 plants were inoculated with the SMV-SC7 line.

[0020] Figure 6qRT-PCR was used to detect the expression level of the CP gene in the SMV virus SC7 strain (n=3). Jack was wild-type, KO-SA-1 and KO-SA-5 represented two GmSAMMT knockout transgenic soybean lines, and OE-SA-4 was a GmSAMMT overexpression line. Two-tailed t-tests were performed: ** and *** represent P<0.01 and P<0.001, respectively, and ns indicate no significance. Error bars represent ±SE. Detailed Implementation

[0021] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0022] Unless otherwise specified, the methods used in the following embodiments are conventional methods.

[0023] Example 1: Induction of GmSAMMT gene expression in the SMV-SC7 strain

[0024] The susceptible variety Nannong 1138-2 and the resistant variety Kefeng No. 1 were selected for planting. When the soybeans reached the true leaf stage, they were inoculated with soybean mosaic virus strain SC7. Soybean leaf tissues were collected at 0h, 2h, 8h, and 24h after inoculation, ground in a mortar, and transferred to 1.5mL EP tubes containing lysis buffer, and thoroughly vortexed. Total RNA was then extracted using the Total RNA Kit from Tiangen (Beijing, China). The quality of the total RNA was assessed by formaldehyde denaturing gel electrophoresis, and the RNA content was determined by spectrophotometry. Soybean constitutive expression of Tubulin was used as an internal reference, with primer sequences F: GGAGTTCACAGAGGCAGAG and R: CACTTACGCATCACATAGCA. Using the extracted total RNA as a template, reverse transcription was performed according to the TaKaRa Primer Script kit (Japan). TM The RT reagent kit was used for reverse transcription to obtain the first strand of cDNA. Then, quantitative real-time PCR (qRT-PCR) was performed using primers F: GAATTTGCAGCCAAGCTCCC and R: CAGGGCTTGTGCTATGGTCA to detect changes in the expression level of the GmSAMMT gene at different time points after inoculation with two soybean varieties. Figure 1 The results showed that the GmSAMMT gene responded to mosaic virus induction in both materials, with an earlier response in the resistant material Kefeng 1.

[0025] Example 2: Genetic Engineering Application of the Soybean Gene GmSAMMT

[0026] 1) Construction of overexpression and knockout vectors for the gene GmSAMMT

[0027] Primers were designed based on the mRNA (Glyma.03G129300) sequence of GmSAMMT in the soybean reference genome Williams 82v2.1. The gene was amplified from Jack's leaf cDNA via PCR. The PCR program was as follows: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 60 seconds, for a total of 35 cycles, followed by incubation at 72℃ for 5 minutes. Sequencing of the PCR product yielded the CDS sequence of the GmSAMMT gene with a complete coding region, as shown in SEQ ID NO.1, which is 786 bp in length. The amino acid sequence is shown in SEQ ID NO.2, which is 261 amino acids in length. The primer sequences for gene amplification were: F: GGATCTTCCAGAGATGTAGTCATGGTAGTCTGCACCA; R: CTGCCGTTCGACGATACTCGTCACATCTCCCACAC.

[0028] An overexpression vector was constructed using an enzyme digestion and recombination method. First, the pBA002 vector was digested with restriction endonucleases MluI and SacI. Then, the CDS fragment of the GmSAMMT gene containing the enzyme digestion linker was amplified using PCR. The expression was then processed using data from Vazyme. The Entry One Step Cloning Kit (C115) was used to ligate the target gene fragment with the cut pBA002 vector, transform, plate, pick single clones, and perform colony PCR sequencing for verification. Primer sequences: F: GGGCCCAGGCCTACGCGTATGGCAAAGCTATTTTTGAA and R: TCGGGGAAATTCGAGCTCTTAGGAATCCCCTGTTCTTC. The specific PCR procedure was the same as in step 1). The final result was the pBA002-GmSAMMT plant overexpression plasmid.

[0029] Using the CRISPR-P 2.0 website (http: / / CRISPR.hzau.edu.cn / CRISPR / ), we searched for PAM sites (identified as 5'-NGG-3') in the GmSAMMT genome sequence. Two target sites targeting the GmSAMMT gene exons were designed: sg1: ATCATGGTCAGCATATCAGA and sg2: TGGGCGGTCAAACCAATGCA. Following the knockout vector construction method described by Zhang et al. (Plant Biotechnology Journal, 2020, 18:1384–1395), the two target sites were constructed into the knockout vector pGmUbi-Cas9-4XsgR. The recombinant knockout vector was transformed into *E. coli* TOP10, and after overnight culture, single clones were picked and subjected to bacterial testing. Positive bacterial cultures were selected for sequencing. The sequencing primers were F: AGCATTGTCTCTGCCTCTTAAC R: CGTCACATCTCCCACACAGTA. Bacterial analysis revealed bands, and sequencing showed that both sgRNA sequences were correct, indicating successful construction of the GmSAMMT gene knockout vector. The vector was transformed into Agrobacterium tumefaciens strain EHA105 using the freeze-thaw method, and soybean Jack was transformed using the soybean cotyledon node transformation method.

[0030] 2) Identification of GmSAMMT gene overexpression and edited lines by inoculation with SMV phenotype

[0031] Through tissue culture, expression level analysis, and Bar test strip detection, an overexpression line of the GmSAMMT gene, OE-SA-4, was obtained. In this line, the expression level of GmSAMMT was significantly higher than that of the control. Figure 2 The Bar test strip also came back positive. Figure 3 ).

[0032] Two GmSAMMT gene knockout lines, KO-SA-1 and KO-SA-5, were obtained through tissue culture. PCR amplification and sequencing of the knockout target fragments of the two genes were performed. Analysis of the sequencing results using peak diagrams showed that the KO-SA-1 mutant had deletions of 10bp and 4bp in the coding region, while the KO-SA-5 mutant had a deletion of 317bp. Both sequencing results showed a single peak. Figure 4 This indicates that the two knockout lines are homozygous.

[0033] After the first pair of true leaves unfolded, wild-type JACK and knockout lines were inoculated with 0.5 mL of SMV-SC7 virus suspension. Phenotypic observation 21 days after inoculation revealed that wild-type JACK and overexpression lines exhibited severe leaf curling and obvious mosaic mottling, while the knockout lines showed no obvious symptoms and displayed a resistant phenotype. Figure 5Further analysis of viral CP gene expression levels showed that the viral CP content in both knockout lines was significantly lower than that in the wild type. Figure 6 The primer sequences for detecting the viral CP protein gene were F: CAGATGGGCGTGGTTATGA, R: ACAATGGGTTTCAGCGGATA. Soybean Tubulin was used as an internal reference, with primer sequences F: GGAGTTCACAGAGGCAGAG and R: CACTTACGCATCACATAGCA. These results indicate that knocking out the GmSAMMT gene reduces viral accumulation and increases soybean resistance to SMV-SC7.

Claims

1. The application of the soybean S-adenosine-L-methionine methyltransferase gene GmSAMMT in soybean resistance to soybean mosaic virus disease, characterized in that, The nucleotide sequence of the soybean GmSAMMT gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, Knocking out the soybean GmSAMMT gene can improve soybean resistance to soybean mosaic virus disease.

3. The application according to claim 1, characterized in that, Knocking out the soybean GmSAMMT gene can reduce the accumulation of soybean mosaic virus.

4. Application of vectors that knock out the soybean GmSAMMT gene in the construction of soybean varieties resistant to soybean mosaic virus.

5. The application according to claim 4, characterized in that, Vectors that knock out the soybean GmSAMMT gene can reduce the accumulation of soybean mosaic virus in soybeans.

Images