A pomt1 gene molecular marker primer related to chicken abnormal egg shape trait and application thereof

By combining POMT1 gene molecular marker primers with PCR and Sanger sequencing technology, the problem of accurate identification of deformed egg traits in chickens has been solved, enabling rapid screening of deformed egg rates and improving breeding efficiency.

CN121109617BActive Publication Date: 2026-01-09NANJING AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511678362.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-17
Publication Date
2026-01-09
Estimated Expiration
2045-11-17

AI Technical Summary

Technical Problem

Current technologies lack gene molecular markers that can accurately identify the trait of deformed eggs in chickens, resulting in low breeding selection efficiency and difficulty in early screening for superior egg-laying traits.

Method used

Primers for the POMT1 gene molecular marker associated with the trait of deformed chicken eggs were provided. Genome-wide association analysis was used to screen out the POMT1 gene molecular markers that were significantly associated with deformed chicken eggs. PCR amplification and Sanger sequencing were used to detect chicken DNA and determine the SNP molecular marker genotype.

Benefits of technology

It enables rapid and accurate detection of deformed egg rates in chickens, efficiently screening out chickens with low deformed egg rates, improving breeding efficiency, and providing a scientific basis for reducing deformed egg rates.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121109617B_ABST
    Figure CN121109617B_ABST
Patent Text Reader

Abstract

The present application relates to a POMT1 gene molecular marker related to chicken abnormal egg trait and application thereof, and belongs to the technical field of biology.The POMT1 gene molecular marker of the present application is located at the 6831149th base of chromosome 17 of chicken reference genome GRCg7b version 17, and the base mutation is G or T, and the genotype is G / G, G / T and T / T.The abnormal egg rate of the chicken with G / G genotype is lower than that of the individuals with G / T and T / T genotypes, and the abnormal egg rate of the chicken with G / T genotype is lower than that of the individual with T / T genotype.The present application amplifies the fragment containing the above-mentioned molecular marker site by using forward and reverse primers, and performs Sanger sequencing on the amplification product, so that the genotype of the individual can be quickly and accurately identified.The molecular marker can be used as a genetic marker for chicken breeding, and the chicken with low abnormal egg rate can be selected and bred, the chicken abnormal egg trait can be efficiently and accurately detected, the population abnormal egg rate is reduced, and the chicken breeding and production have important value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a POMT1 gene molecular marker primer related to the chicken abnormal egg trait and an application thereof, and belongs to the technical field of biotechnology. BACKGROUND

[0002] The eggshell quality of a chicken is one of the important indicators for measuring the quality of an egg. The abnormal egg of a chicken refers to an egg with an abnormal shape, i.e., not conforming to the normal oval shape, and common types include gourd-shaped, flat-shaped, long-shaped, and irregular-shaped eggs. In a group of initial laying hens, the reproductive system has not yet developed perfectly, the hormone secretion is unstable, and the oviduct peristalsis is irregular, which causes the eggs to be frequently subjected to physical extrusion during the formation process, and the hardened eggs are prone to a certain proportion of abnormal eggs. With the group of chickens entering the peak egg-laying period, the function of the reproductive system gradually becomes perfect, and the incidence of abnormal eggs significantly decreases. At the end of the egg-laying period, the function of the ovaries and oviducts of the hens begins to decline, the coordination of the reproductive system decreases, and the incidence of abnormal eggs increases again. The abnormal egg rate not only reflects the health status of the reproductive system of a hen, but also provides an important reference for evaluating the end-stage egg-laying performance of a group of chickens and formulating breeding strategies. Therefore, by analyzing the genetic variation of the abnormal egg rate and combining molecular marker-assisted selection, the efficiency of selection can be improved, and early identification and precise utilization of excellent egg-laying traits can be achieved. At present, there is a lack of gene molecular markers that can accurately identify the chicken abnormal egg trait, and the gene molecular markers are not applied to breeding selection to quickly identify the corresponding traits for early screening. SUMMARY

[0003] The purpose of the present application is to provide a POMT1 gene molecular marker primer related to the chicken abnormal egg trait and an application thereof, which can quickly detect and screen the abnormal egg rate of a chicken, in view of the defects in the prior art.

[0004] The present application measures the abnormal egg rate of a hen, performs whole genome SNP genotyping by using a second-generation sequencing technology, and screens a POMT1 gene molecular marker significantly related to the chicken abnormal egg trait by whole genome association analysis, thereby providing a new gene and molecular marker resource for the selection of the chicken abnormal egg trait.

[0005] The chicken POMT1 gene encodes protein O-glycosyltransferase 1, cooperates with POMT2 to be located on the endoplasmic reticulum membrane, participates in the protein-O-mannosylation reaction chain, and is a key enzyme for the glycosylation modification of alpha-dystroglycan (alpha-DG). It has been shown by research that the chicken is a good model for studying the O-mannosylation of POMT1 in the embryonic development process, and POMT1 is expressed in tissues such as muscle, eye, and brain. Since O-mannosylation is a common post-translational modification mode of eukaryotes, it plays an important role in the maintenance of ovary function, follicle development, and embryo survival.

[0006] The application solves the technical problems by the following technical solutions: first, a POMT1 gene molecular marker primer related to the chicken abnormal egg trait is provided, the molecular marker is located at the 6831149th base of chicken chromosome 17, the base mutation is G or T, the sequence of the 218th base is shown in SEQ ID NO: 3 or SEQ ID NO: 4, and the nucleotide sequence of the chicken DNA specific primer pair required for molecular marker detection is shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0007] The application further provides the application of the specific primer, including the detection of the SNP genotype related to the chicken abnormal egg rate.

[0008] The first step is to provide a chicken DNA sample to be tested, and the DNA specific primer pair is used for PCR amplification to obtain an amplification product.

[0009] The second step is to perform Sanger sequencing on the PCR product.

[0010] The third step is to determine the SNP molecular marker genotype of the 6831149th base of chicken chromosome 17 according to the sequencing result of the second step.

[0011] The deoxyribonucleotide sequence of the chicken DNA specific primer pair in the first step is as follows:

[0012] The upstream primer is 5'-AGAAGGGAGATAGCGTTTGGT-3' (SEQ ID NO: 1)

[0013] The downstream primer is 5'-ACTACAGCACAGACCAACGT-3' (SEQ ID NO: 2)

[0014] The amplification product in the first step has a length of 319bp and contains the 6831149th base of chicken chromosome 17.

[0015] The final volume (25μl) of the reaction system is:

[0016] The chicken DNA to be tested is 50ng

[0017] 2 x Accurate Taq Master Mix 12.5μl

[0018] The upstream primer is 1μl

[0019] The downstream primer is 1μl

[0020] Sterile water is supplemented to 25μl.

[0021] The reaction conditions of the PCR amplification are as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 60 sec, for 30 cycles; 72℃ extension for 2 min; and 4℃ preservation.

[0022] The nucleotide sequence of the amplification product is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0023] In the third step, the judging standard is that the rate of abnormal eggs of the chicken with G / G genotype is lower than that of the individuals with G / T and T / T genotypes, and the rate of abnormal eggs of the chicken with G / T genotype is lower than that of the individual with T / T genotype.

[0024] The present application finds that the rate of abnormal eggs of the chicken with G / G genotype is lower than that of the individuals with G / T and T / T genotypes, and the rate of abnormal eggs of the chicken with G / T genotype is lower than that of the individual with T / T genotype by detecting the genotype of the chicken abnormal egg trait through the POMT1 gene molecular marker. The genotype of the chicken abnormal egg trait can be realized by taking the genomic DNA of the chicken to be detected as a template, performing PCR amplification on the genomic DNA by using specific primers, then performing Sanger sequencing and SNP molecular marker genotyping on the PCR amplification product. In breeding, according to the breeding target, the individuals with G / T and T / T genotypes are eliminated, and the individuals with G / G genotype are reserved. The beneficial effects are that the molecular marker can be used as a genetic marker for chicken breeding, and the chicken with low abnormal egg rate is selected; the chicken abnormal egg trait can be efficiently and rapidly identified, and the abnormal egg rate of the chicken population is reduced, which provides a scientific basis for early selection of the chicken, and has important value for the breeding of the chicken. In addition, the detection method disclosed by the present application is simple and easy to operate, and can be carried out in a laboratory. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 is a Manhattan plot of chicken abnormal egg whole genome association analysis.

[0026] Figure 2 is the Sanger sequencing result of the PCR amplification product of three genotypes. DETAILED DESCRIPTION

[0027] The following examples are suitable for the breeding of the chicken.

[0028] Example 1

[0029] In this example, the rate of abnormal eggs of the recessive white Loke hen from the onset of laying to 63 weeks of age is counted, the second-generation sequencing technology is used for whole genome SNP genotyping, the POMT1 gene molecular marker significantly related to the rate of abnormal eggs is screened through whole genome association analysis, and the result is shown in Figure 1

[0030] ​The present example identifies and applies a POMT1 gene molecular marker related to the rate of abnormal eggs in chickens through the following experiments.

[0031] 1. Phenotype determination and genotype detection

[0032] (1) Experimental materials and phenotype determination

[0033] Select 1149 recessive white Loke hens as test animals, raise them under the same feeding conditions, and use free feeding and drinking water throughout the process. Record the number of abnormal eggs laid by each chicken from the first egg, and count the cumulative number of eggs and abnormal eggs at 63 weeks of age as the phenotype data of the rate of abnormal eggs.

[0034] (2) Extraction of genomic DNA

[0035] Blood was collected from the subclavian vein of the test individual, anticoagulated, lysed, digested with proteinase K, extracted with saturated sodium chloride, dissolved in TE, and stored at -20°C.

[0036] (3) PCR amplification

[0037] The above extracted genomic DNA was used as a template to amplify the fragment containing the 6831149th base site on chromosome 17.

[0038] Upstream primer: 5'- AGAAGGGAGATAGCGTTTGGT-3' (SEQ ID NO: 1)

[0039] Downstream primer: 5'- ACTACAGCACAGACCAACGT-3' (SEQ ID NO: 2)

[0040] The final volume of the reaction system (25 μl) is:

[0041] Test DNA 50 ng

[0042] 2 x Accurate Taq Master Mix 12.5 μl

[0043] Upstream primer 1 μl

[0044] Downstream primer 1 μl

[0045] Sterile water supplemented to 25 μl.

[0046] The reaction conditions of PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 60 sec, for 30 cycles; extension at 72°C for 2 min; preservation at 4°C; 10 μl was taken for agarose detection, and the length of the single band of the amplification product was 319 bp, and the SNP molecular marker at the 6831149 base site of chicken chromosome 17 was obtained, and the sequence was as follows:

[0047] SEQ ID NO: 3

[0048] AGAAGGGAGATAGCGTTTGGTATTGCTTTTCAGAAAACAGGGAGGTACATTTGAGAACATCCTGTAGATCAGAGTTTGTGGTTTGGGAGGTTCAGAATGAGATACCTCTGAGTAGAATAAGGAATAGCAGATTTGTTTTGAAGTCAAATGCCTGAATTCAGGATCTTGAGAGTGTGCTCAGATGTCACTGTAACATTGTTCCCTTTGTCCTTTTATTGAAGTTCCTTCTCCGGAGGGTGGTGGTTTTGGCTTCTGTTGACTGGAGTAGCTTGTTCTTGTGCTGTTGGGTAAGTGGTGGCACGTTGGTCTGTGCTGTAGT

[0049] SEQ ID NO: 4

[0050] AGAAGGGAGATAGCGTTTGGTATTGCTTTTCAGAAAACAGGGAGGTACATTTGAGAACATCCTGTAGATCAGAGTTTGTGGTTTGGGAGGTTCAGAATGAGATACCTCTGAGTAGAATAAGGAATAGCAGATTTGTTTTGAAGTCAAATGCCTGAATTCAGGATCTTGAGAGTGTGCTCAGATGTCACTGTAACATTGTTCCCTTTGTCCTTTTATTTAAGTTCCTTCTCCGGAGGGTGGTGGTTTTGGCTTCTGTTGACTGGAGTAGCTTGTTCTTGTGCTGTTGGGTAAGTGGTGGCACGTTGGTCTGTGCTGTAGT.

[0051] (4) Sanger sequencing and genotyping

[0052] The PCR products of each sample were respectively subjected to Sanger sequencing, and the sequencing peak charts of different genotypes are shown in Figure 2

[0053] 2. Correlation analysis

[0054] Select 1149 individuals of recessive white Lohmann hens with clear phenotype records of deformity egg rate for correlation analysis. The ANOVA test function of R4.2 statistical plotting software was used for statistical test, and the pairwise comparison mode was selected for statistical test of genotypes and deformity egg traits of the test chicken population. P<0.05 indicates significant difference. The results are shown in Table 1. The deformity egg rates of the three genotypes of chickens are significantly different (P<0.05). The deformity egg rate of G / G genotype individuals is 11.89%, which is lower than that of G / T genotype individuals (13.33%) (P<0.05) and T / T genotype individuals (16.26%) (P<0.05). The deformity egg rate of G / T genotype individuals is lower than that of T / T genotype individuals (P<0.05). The results show that the site at position 6831149 of chicken chromosome 17 is significantly associated with the phenotype of chicken deformity egg traits. According to the actual breeding goal, G / G genotype individuals can be selected to breed chickens with smaller deformity egg rate, reduce the number of deformity eggs in the chicken population, and improve the breeding efficiency.

[0055] Table 1 Correlation analysis of POMT1 gene molecular markers and deformity egg number

[0056] Note: The same letter in the same column indicates that there is no significant difference, and different letters indicate that there is a significant difference (P<0.05).

[0057] Example 2

[0058] Genotype frequencies of different breeds

[0059] 1. Blood sample collection

[0060] The blood samples of 10 breeds of Tibetan chicken, Dagu chicken, Mustache chicken, Jingxing yellow chicken, Gong chicken, Daweishan miniature chicken, Wuding chicken, Beijing oil chicken, Wenchang chicken and Bailaihang laying hen were collected by subclavian vein blood collection method and stored at -20℃ for standby.

[0061] 2. Extraction of genomic DNA

[0062] The tissue samples obtained in step 1 were used to extract genomic DNA using the tissue genomic DNA extraction kit of Omega, and the specific method was referred to the standard operation procedure provided by Omega.

[0063] 3. Genotype detection

[0064] ​The genomic DNA obtained in the second step is used as a template, a primer pair composed of F nucleotide sequence (SEQ ID NO: 1) and R nucleotide sequence (SEQ ID NO: 2) is used for PCR amplification and Sanger sequencing to obtain individual G / G genotype, G / T genotype and T / T genotype.

[0065] Results analysis

[0066] Tibetan chicken, big bone chicken, mustache chicken, gourd chicken, Daweishan miniature chicken, Wuding chicken, Beijing oil chicken and Wenchang chicken are well-known local chicken breeds in China, and the breeding degree is low, and the original breed characteristics are retained. Beijingxing yellow chicken is a yellow-feathered broiler matching line bred in China, which is a matching line with meat quality characteristics selected from Chinese local breeds. The reproductive performance is similar to that of Chinese local breeds. Bailaihang laying hen is a common commercial laying hen breed, which has been selected for egg-laying performance for a long time, has high egg-laying rate, low deformity egg rate, and higher G allele frequency than Chinese local breeds. The SNP site has polymorphism in different types of breeds, and can be used for deformity egg rate selection. These results can confirm that the SNP site can be used as a molecular marker for chicken deformity egg traits. See Table 2.

[0067] Table 2. Allele frequency distribution of POMT1 gene molecular marker in different breeds

[0068] In addition to the above implementations, the present application can have other implementations. Any technical solutions formed by equivalent replacement or equivalent transformation fall within the protection scope required by the present application.

Claims

1. The use of a POMT1 gene molecular marker primer associated with the chicken egg deformity trait, characterized in that: The nucleotide sequence of the molecular marker primer is shown as SEQ ID NO: 1 and SEQ ID NO: 2, the molecular marker site is located at the 6831149th base on chromosome 17 of chicken reference genome GRCg7b version 17, the base is G or T, the genotype is G / G, G / T and T / T, and the molecular marker primer is used for detecting the chicken abnormal egg trait, and the detection method comprises the following steps, In the first step, the DNA sample of the chicken to be detected is subjected to PCR amplification by using the molecular marker primer shown as SEQ ID NO: 1-2, and an amplification product is obtained, the length of the amplification product is 319 bp, and the amplification product contains the 6831149th base on chromosome 17 of chicken reference genome GRCg7b version 17; In the second step, Sanger sequencing is performed on the PCR product; In the third step, the SNP molecular marker genotype of the 6831149th base on chromosome 17 of chicken reference genome GRCg7b version 17 is judged according to the sequencing result in the second step, and the judgment standard is that the abnormal egg rate of the chicken with G / G genotype at the SNP site is lower than that of the individuals with G / T and T / T genotypes, and the abnormal egg rate of the chicken with G / T genotype is lower than that of the individual with T / T genotype.

2. The application of the POMT1 gene molecular marker primer related to the chicken deformity egg trait according to claim 1, characterized in that: The PCR reaction system is 25 μl, and the system is as follows: DNA of the chicken to be detected 50 ng 2x Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Sterilized water is supplemented to 25 μl; The reaction conditions of the PCR amplification are pre-denaturation at 94℃ for 5 min, denaturation at 94℃ for 30 sec, annealing at 60℃ for 30 sec, extension at 72℃ for 60 sec, a total of 30 cycles, extension at 72℃ for 2 min, and preservation at 4℃; and the nucleotide sequence of the amplification product is shown as SEQ ID NO: 3 or SEQ ID NO: 4.

Citation Information

Patent Citations

  • SNP (single nucleotide polymorphism) molecular marker related to egg shape index, and application of SNP molecular marker

    CN110551827A

  • Screening method and application of SNP molecular markers associated with egg shell thickness, eggshell strength and egg shape index of Nandanyao chickens

    CN111518920A