Multiple qPCR (quantitative polymerase chain reaction) detection reagent for detecting superficial fungal disease pathogens

Abstract

The invention discloses a multiple qPCR (quantitative polymerase chain reaction) detection reagent for detecting pathogens of a superficial fungal disease. The multiple qPCR detection reagent comprises specific primers and probes for detecting trichophyton rubrum, epidermophyton flocculent, microsporum canine, trichophyton beard, candida parapsilosis, candida albicans, malassezia furfur and gliocladium breviculare, wherein the specific primers and the probes are used for detecting trichophyton rubrum, epidermophyton flocculent, microsporum canine, trichophyton beard, candida parapsilosis; according to the invention, different fluorescently-labeled probes are utilized to add specific primers and probes of multiple pathogens into a reaction system to detect multiple targets at the same time, and the method has the advantages of good specificity, high sensitivity, high detection speed, capability of detecting multiple pathogens at the same time, rapidness, simplicity, convenience and economy; a convenient method is provided for rapid detection of superficial fungal disease pathogens, and the kit has important significance in epidemiological research, clinical early molecular diagnosis and the like.

Description

Technical Field

[0001] This invention belongs to the field of pathogen detection technology and relates to a multiplex qPCR primer combination for detecting superficial fungal pathogens in patients with type 2 diabetes. This invention utilizes multiplex real-time quantitative PCR technology to detect superficial fungal pathogens. Background Technology

[0002] Superficial fungal infections are the most common fungal diseases worldwide, constituting the main pathogen group for skin and nail plate infections. Epidemiological studies show that the cumulative risk of developing superficial fungal infections in an individual's lifetime is about 10%-20%, with foot fungal infections (commonly known as "athlete's foot") having the highest incidence and becoming the most common type of infection in clinical practice. This high incidence not only significantly affects the quality of life of patients but also brings a heavy economic burden. The clinical manifestations of superficial fungal infections vary greatly, and their specific symptoms are influenced by a variety of factors, including the type of fungus, the degree of keratinization of the lesion site, and the host's own immune status. Traditionally, the classification of superficial fungal infections is mainly based on the different sites of infection, and can usually be divided into the following categories: (1) infections occurring in hairless skin areas, such as tinea corporis, tinea cruris, and tinea faciens; (2) infections involving highly keratinized skin, such as tinea manuum and tinea pedis; (3) infections affecting areas rich in terminal hair follicles, such as tinea capitis and tinea barbae; (4) infections affecting the fingernails (toenails), i.e., onychomycosis. This classification method helps to more accurately identify disease types, thereby guiding the selection of clinical diagnosis and treatment strategies.

[0003] As a common systemic complication of diabetes, skin lesions are often overlooked or underestimated in clinical practice. Epidemiological studies confirm that approximately 30% of diabetic patients develop skin manifestations to varying degrees during the course of their disease. These lesions are prevalent in both type 1 and type 2 diabetes, presenting with diverse clinical manifestations, including infectious lesions, dry skin, and itching. Their occurrence is closely related to chronic hyperglycemia and the accumulation of advanced glycation end products (AGEs). A persistent hyperglycemic environment can lead to damage to various cells, affecting not only endothelial cells, neurons, and kidney cells, but also impairing the function of keratinocytes and fibroblasts in the skin. Globally, the prevalence of diabetes-related skin lesions varies geographically, ranging from 51% to 97%, while most studies report an incidence rate between 30% and 71%. Notably, skin lesions may appear as the first symptom of diabetes or occur at any stage of disease progression. Currently, diabetes-related skin lesions are classified into four main categories: the first category consists of specific skin lesions with a strong to weak correlation to diabetes (such as lipoid necrosis, diabetic dermatitis, and diabetic bullae); the second category consists of infectious lesions (including bacterial and fungal infections); the third category consists of skin manifestations of diabetic complications (such as microvascular disease, macrovascular disease, and neuropathy); and the fourth category consists of skin reactions to diabetes medications (such as skin changes caused by sulfonylureas or insulin). Some scholars have also proposed a fifth category: endocrine syndrome-related diabetes accompanied by skin changes.

[0004] There are various methods for detecting pathogens causing superficial fungal infections. Traditional direct microscopic examination in clinical settings, while rapid, lacks specificity and its results are highly dependent on the operator's skill level. Fungal culture identification is time-consuming, typically requiring 1-3 weeks, and has a high false-negative rate (approximately 30% of microscopically positive results in nail samples cannot be verified through culture), resulting in a low overall detection rate. Commercially available antigen-antibody reaction-based test strips (kits) are simple and quick to use, but their application is limited due to insufficient sensitivity and false-positive issues. In recent years, molecular biology detection technologies have developed rapidly, including PCR-first-generation sequencing, LAMP, gene chips, digital PCR, and NGS, which are widely used in clinical pathogen detection. However, these technologies still suffer from drawbacks such as high cost, complex operation, and long processing times. Summary of the Invention

[0005] This invention provides a multiplex qPCR detection reagent for superficial fungal pathogens, comprising specific primers and probes for detecting eight superficial fungal pathogens. The multiplex qPCR detection also involves other conventional detection reagents. This method uses the human β-actin gene (β-Actin) as an internal control. This method enables high-throughput detection of superficial skin samples and is characterized by its simplicity, speed, accuracy, and economy, providing a new approach for the early clinical diagnosis and detection of superficial fungal pathogens.

[0006] The multiplex qPCR detection primer set of this invention includes specific primers and probes for detecting Trichophyton rubrum, Epidermophyton floccosum, Microsporum canis, Trichophyton mentagrophytes, Candida parapsilosis, Candida albicans, Malassezia furfur, and Cladosporium breve. The specific primers for Trichophyton rubrum are GCCGTACGCCCCCATTCTTG and TTGGTGTCTGTCCT. CCGGCG, probe is TCCCCTGCCAGGGAGAGCCGT; The specific primers for *Epidermophyton floccosum* are CAGCATCAGTTTCGACGGC and ATTGCACCCCCGGCTATAAG, and the probe is AGGCCCCCGGAATGTGTCGT. The specific primers for Microsporum canis are TGACTACGACCTCTCCCCCAG and GATGCCATGGGGAGTACGAG, and the probe is TGGCTCCAAGGTTGCTGAGCC. The specific primers for Trichophyton mentagrophytes are GGAAGAGAACCTGTGCCCTC and GGCCCGATTGAAGTGACAGA, and the probe is AGACCAGACCCGGAGACACCT. The specific primers for Candida parapsilosis are TTGAAGCAAAGAAGGCGGGA and GGGGAGGCAGCAAAGAGTTT, and the probe is TCAAATGCTGCTATTCCACACTTGGA. The specific primers for Candida albicans are AAAGCTCGTAGTTGAACC and CCTGGTTCGCCATAAATG, and the probe is TTTGATGCGTACTGGACCCA. The specific primers for Malassezia furfur are AGGCGAAATCACCCCATGTT and TGGTCCATGCTGCGAGATTT, and the probe is GGCTGCTTGCGCAAACTGCA. The specific primers for *Brachystomum brevis* are TCCTGGAGCAGATCGAGACA and ACCTTATCCCTCCTGCTCGT, and the probe is GAGACTATGCGTGCGGGGGC.

[0007] The method for using the above-mentioned multiplex qPCR detection primer combination is as follows: 1. Nucleic acid (DNA) extraction from samples, which may be skin swabs or secretions; A. Place the collected skin swab or secretion samples into a storage tube containing nucleic acid preservation solution and shake thoroughly to promote the release of pathogens; B. Place the pathogen preservation solution from step A into a centrifuge tube, and then add cell lysis buffer to lyse the cells; C. Take the lysis buffer from step B and extract nucleic acid using the Tiangen Virus DNA / RNA Genome Extraction Kit; 2. Using the nucleic acid from step 1 as a template, specific primers and probes targeting eight pathogens were used for detection via multiplex real-time quantitative PCR. Results were determined based on Ct values. Specific primers and probes for *Trichophyton rubrum*, *Candida albicans*, *Cladosporium breve*, and *Microsporum canis* were used together in the detection. Specific primers and probes for *Trichophyton mentagrophytes*, *Candida parapsilosis*, *Malassezia*, and *Epidermophyton floccosum* were also used together in the detection. The human β-actin gene was used as an internal control. 3. Interpretation of test results (1) The internal control (human β-actin gene, β-Actin gene) Ct value ≤ 36, and the negative control group and template-free control group have no Ct value; if they do not meet the requirements, multiplex real-time quantitative PCR detection must be performed again, or nucleic acid must be extracted again for multiplex real-time quantitative PCR detection. (2) The pathogen's Ct value is ≤36.0. If the Ct value is >36.0, single-strand real-time quantitative PCR verification is required for the pathogen. (3) The amplification curve is a standard “S” shape and there are no abnormal fluctuations.

[0008] Compared with the prior art, the present invention has the following advantages and technical effects: 1. The primer and probe set provided by this invention for detecting eight superficial fungal pathogens has high detection efficiency and accurate detection results, and can complete pathogen diagnosis quickly and at low cost. 2. This invention is based on the real-time fluorescence quantitative PCR technology platform to qualitatively detect pathogen-specific target genes. Multiple samples can be tested in one experiment. It has the characteristics of being rapid, specific and economical, which greatly reduces the detection cost of superficial fungal infection samples from diabetic patients. Attached Figure Description

[0009] Figure 1The results are for the specific detection of Candida albicans (A) and Trichophyton rubrum (B) by singlet real-time quantitative PCR. Figure 2 The results show the specific detection results of single-particle real-time quantitative PCR for Microsporum canis (C) and Broomella breviculatum (D). Figure 3 The results are for the specific detection of Epidermophyton floccosum (E) and Malassezia (F) by single-particle real-time quantitative PCR. Figure 4 The results show the specific detection results of singleton real-time quantitative PCR for Trichophyton mentagrophytes (G) and Candida parapsilosis (H). Figure 5 This is the result of specific detection of the internal reference gene β-Actin by singlet real-time quantitative PCR. Figure 6 The results are from multiplex qPCR specificity tests for Trichophyton rubrum, Candida albicans, Cladosporium breve, and Microsporum canis. Figure 7 The results of multiplex qPCR specificity tests for Trichophyton mentagrophytes, Candida parapsilosis, Malassezia, and Epidermophyton floccosum; Figure 8 The results are from a multiplex qPCR sensitivity test for Trichophyton rubrum. Figure 9 The results are from a multiplex qPCR sensitivity test of Epidermophyton floccosum. Figure 10 The results are from a multiplex qPCR sensitivity test of Microsporum canis. Figure 11 The results of a multiplex qPCR sensitivity test for Trichophyton mentagrophytes; Figure 12 The results are from a multiplex qPCR sensitivity assay of Candida glabrata. Figure 13 The results are from a multiplex qPCR sensitivity test for Candida albicans. Figure 14 The results of a multiplex qPCR sensitivity test for Malassezia furfur; Figure 15 The results are from a multiplex qPCR sensitivity test of *Brachystomata*. Figure 16 The results are from a multiplex qPCR sensitivity assay of the internal reference β-Actin gene. Detailed Implementation

[0010] To further illustrate the technical means and effects of this invention, the following specific embodiments are provided to further explain the technical solution of this invention. However, this invention is not limited to the scope of these embodiments. The materials used in the following embodiments are not limited to those listed above and may be replaced by other similar materials. Unless otherwise specified, the instruments shall be used under conventional conditions or as recommended by the manufacturer. Those skilled in the art should have relevant knowledge of the use of conventional materials and instruments.

[0011] Example 1: Primer and probe design 1. Download the following pathogen gene sequences from the NCBI website: ITS-coding genes for Trichophyton rubrum, Epidermophyton floccosum, Microsporum canis, Trichophyton mentagrophytes, SSU rRNA-coding gene for Candida albicans, ITS1-coding gene for Candida parapsilosis, LSU rRNA-coding gene for Malassezia furfur, ITS1-coding gene for Koplikia brevis, and human β-Actin-coding gene (as an internal reference gene). To ensure broad applicability of primers and probes, download at least 20 representative sequences for each target gene, covering different geographical origins and clinical isolates, to comprehensively evaluate the species specificity of primers and probes. Use SnapGene software (version 6.0.2) to align nucleotide sequences, then design primers and probes, meeting the following conditions: (1) Tm value: Generally, the probe Tm value is 8-10℃ higher than the primer Tm, and the probe Tm value is generally above 60℃; (2) GC content: generally not less than 40%; (3) No primer dimers are generated, and the hairpin structure software evaluation result is OK; (4) The size of the amplified fragment is generally less than 200 bp; 2. Primer and probe BLAST evaluation: The nucleotide sequences of the initially designed primers and probes were compared again using the BLAST search function on the NCBI website to select primers and probe sequences with high specificity; the nucleotide sequences of specific primers and probes targeting 8 superficial fungal pathogens and the internal reference β-Actin gene are shown in the table below; ; 3. Plasmid construction The specific sequences of eight pathogens (as shown in SEQ ID NO:1-SEQ ID NO:8) and the sequence of the internal reference gene β-Actin (SEQ ID NO:9) were ligated into the pUC57 vector to synthesize plasmid standards. Group A synthesized Epidermophyton floccosum, Microsporum canis, Trichophyton mentagrophytes, Candida glabrata, Chlorella vulgaris, and Malassezia furfur on a single plasmid. Group B synthesized Trichophyton rubrum and Candida albicans on a single plasmid, and β-Actin on a single plasmid. The plasmid construction was completed by Chenlv (Green City) Technology Co., Ltd. The concentration was determined by ultraviolet spectrophotometer, and the copy number of each plasmid was calculated based on the length and concentration of each plasmid.

[0012] These plasmids were serially diluted 10-fold, with a total of seven gradients of 10-fold. 6 10 5 10 4 10 3 10 2 10 1 10 0 The quantity is on the order of copies / μL.

[0013] Example 2: qPCR amplification and specificity, sensitivity, and repeatability tests 1. Singleton Real-Time PCR

[0014] With a concentration of 10 6 1.6 μL of plasmid standards (copies / μL) were mixed and used as templates. Single-particle quantitative PCR was performed using the SuperReal PreMix (Probe) premixed kit from Tiangen Biotech (Beijing) Co., Ltd. Using mixed plasmids of eight pathogens as templates, single-particle quantitative PCR was performed with specific primers and probes for each pathogen. The results showed amplification curves for all eight pathogens and the internal reference gene. Figure 1-5 ).

[0015] 2. Multiplex qPCR specificity assay With a concentration of 10 3 10 μL of plasmid standards in the copy / μL range were mixed as templates and multiplex quantitative PCR was performed using the Pro Taq HS premixed probe qPCR kit from Acery Biotech. Since multiplex quantitative PCR requires the detection of 4 pathogens and 1 internal reference gene in one system, a mixed plasmid of 8 pathogens was used as a template, and PCR was performed using primers and probes for each of the 4 pathogens. The multiplex quantitative PCR reaction system is shown in the table below.

[0016] The amplification reaction program was as follows: 95℃ pre-denaturation for 30s; 95℃ denaturation for 3s; 58℃ annealing and extension for 30s; 40 cycles, with fluorescence signals collected during the annealing and extension phase of each cycle.

[0017] The results are as follows Figure 6-7 The results above show that there was no cross-reaction among the pathogens in each group, indicating that multiplex quantitative PCR has good specificity.

[0018] 3. Multiplex qPCR sensitivity test Concentration of 10 6 10 5 10 4 10 3 10 2 10 1 10 0 Take 10 μL of each copy / μL plasmid standard and mix them as templates. Perform PCR using specific primers and probes for each pathogen. The reaction system and conditions are the same as in step 2. The results are as follows Figure 8-16 As shown in the figure, the detection limits for Trichophyton rubrum, Epidermophyton floccosum, and Microsporum canis are 1.03 × 10⁻⁶. 1 1.04×10, 1.02×10 1 The detection limits for *Trichophyton mentagrophytes* and *Candida parapsilosis* were 3.33 × 10⁻⁶ copies / μL. 2 The detection limits for Candida albicans, Malassezia furfur, and Crestis brevis were 7.15 × 10⁻⁶ copies / μL, 7.30 × 10⁻⁶ copies / μL, and 7.27 × 10⁻⁶ copies / μL, respectively. The results of a multiplex qPCR sensitivity assay for the β-Actin gene showed that the detection limit for the internal reference β-Actin gene reached 10⁻⁶ copies / μL. 3 The quantity is on the order of copies / μL.

[0019] 4. Multiplex qPCR repeatability test To verify the reproducibility of the MqPCR detection method, 10 3 Plasmids at the copy / μL level were used as templates for experiments, and intra- and inter-group repeatability experiments were performed. Specific primers and probes for each pathogen were used to detect the plasmid templates. CV values ​​were calculated for intra-batch and inter-batch experiments over three consecutive weeks. The repeatability results are shown in the table below: .

[0020] Example 3: Detection of skin swabs 1. Sample collection Use a swab to collect microorganisms from the skin surface. When sampling, do not hold the swab beyond the broken edge to avoid contaminating the sample. For normal skin, a sampling area of ​​5cm x 5cm is recommended, with a minimum sampling area of ​​4cm x 4cm. Exposed skin (face, hands) has a richer microbial population, while covered areas (abdomen, lower legs) have fewer microorganisms, requiring a larger sampling area. During collection, divide the target area into four rectangular sections from top to bottom. Place a sterile cotton swab moistened with physiological saline on the sampling surface, bending it at a 45-degree angle to the surface. Wipe the sampling surface smoothly and slowly, repeating this process at least five times in each area. After wiping one area, rotate the swab 90 degrees before wiping the next area to ensure sufficient microbial sample is collected.

[0021] If a skin sample with wounds or inflammation and pus is required, it should be taken directly from the wound or purulent tissue. Skin lesions generally have a rich microbial population, but excessive pus or tissue fluid can interfere with subsequent microbial genetic testing. One collection swab is used for each sample. The patient's name and identification information are recorded on the label. The sampling tube is transported to the laboratory, stored at approximately 4°C during transport, and then stored at -80°C until analysis.

[0022] 2. Genomic DNA extraction Utilizing the principle of magnetic bead adsorption, a specially designed magnetic rod adsorbs, transfers, and releases magnetic beads, achieving the transfer of magnetic beads / nucleic acids and automatically completing the extraction and purification of nucleic acids. Nucleic acids from clinical samples were extracted using the Genomic Ex-DNA (Special Extraction) Nucleic Acid Extraction or Purification Kit from Xi'an Tianlong Technology Co., Ltd.

[0023] (1) Preparation of lysozyme solution Add 3.2 mL of lysozyme diluent to each vial and dissolve it completely before use. Store the dissolved solution at -20°C and do not freeze-thaw more than 5 times. (2) Fungal enrichment in the sample Place the collected cotton swab samples in an appropriate amount of PBS (or physiological saline), shake and wash thoroughly, and let stand at room temperature for 5-10 minutes. After large particles settle, take the supernatant and centrifuge at 7500 rpm for 10 minutes, then discard the supernatant. (3) Pre-extraction processing steps Add 180µL of lysozyme solution and 20µL of proteinase K to the enriched product of the above sample, vortex thoroughly, and then incubate at 50℃ for at least 30 minutes. After the water bath, centrifuge briefly, add 200µL of bacterial digestion solution to the centrifuge tube, mix thoroughly, and set aside for use. (4) Preparation of pre-packaged reagents Remove the pre-packaged reagent from the kit, invert and mix several times to resuspend the magnetic beads, and gently shake the well plate or reagent strip to concentrate the reagent and magnetic beads at the bottom of the well plate or reagent strip. Carefully remove the aluminum foil sealing film before use, avoiding vibration to prevent liquid splashing. Add the mixture of lysozyme solution and proteinase K to columns 1 and 7 of the pre-packaged reagent for automated instrument extraction; (5) Automated instrument extraction steps The NP968 series nucleic acid extractor performs automated extraction according to the program in the table below (Note: Before running the program, a stirring sleeve must be placed on the stirring rack. If there is no reagent in wells 7 to 12 of the deep well plate, the stirring sleeve does not need to be placed on the right side of the stirring rack. If there is no reagent on one side of a single reagent holder, the stirring sleeve does not need to be placed at the corresponding position on the stirring rack). After the automated program is completed, transfer the eluent from wells 6 and 12 (well 6 of each reagent group) to nuclease-free centrifuge tubes and store at -20°C for later use.

[0024] 3. Twenty positive skin swab and secretion samples were collected from the hospital. After nucleic acid extraction, they were subjected to first-generation sequencing (Sanger sequencing). The sequencing results were compared with NCBI Blast to determine the pathogen species. At the same time, the mqPCR method of this invention was used to test these 20 samples, and the test results were recorded as follows:

[0025] As shown in the table above, the primer and probe set designed in this invention for multiplex qPCR detection of eight pathogens of superficial fungal diseases is faster and more convenient than the first-generation sequencing detection method.

Claims

1. A multiplex qPCR detection reagent for detecting pathogens of superficial fungal diseases, characterized in that: Including specific primers and probes for detecting Trichophyton rubrum, Epidermophyton floccosum, Microsporum canis, Trichophyton mentagrophytes, Candida parapsilosis, Candida albicans, Malassezia furfur, and Cladosporium breve. The specific primers for Trichophyton rubrum are GCCGTACGCCCCCATTCTTG and TTGGTGTCTGTCCTCCGGCG; the probe is TCCCCCTGCCAGGGAGAGCCGT. The specific primers for *Epidermophyton floccosum* are CAGCATCAGTTTCGACGGC and ATTGCACCCCCGGCTATAAG, and the probe is AGGCCCCCGGAATGTGTCGT. The specific primers for Microsporum canis are TGACTACGACCTCTCCCCCAG and GATGCCATGGGGAGTACGAG, and the probe is TGGCTCCAAGGTTGCTGAGCC. The specific primers for Trichophyton mentagrophytes are GGAAGAGAACCTGTGCCCTC and GGCCCGATTGAAGTGACAGA, and the probe is AGACCAGACCCGGAGACACCT. The specific primers for Candida parapsilosis are TTGAAGCAAAGAAGGCGGGA and GGGGAGGCAGCAAAGAGTTT, and the probe is TCAAATGCTGCTATTCCACACTTGGA. The specific primers for Candida albicans are AAAGCTCGTAGTTGAACC and CCTGGTTCGCCATAAATG, and the probe is TTTGATGCGTACTGGACCCA. The specific primers for Malassezia furfur are AGGCGAAATCACCCCATGTT and TGGTCCATGCTGCGAGATTT, and the probe is GGCTGCTTGCGCAAACTGCA. The specific primers for *Brachystomum brevis* are TCCTGGAGCAGATCGAGACA and ACCTTATCCCTCCTGCTCGT, and the probe is GAGACTATGCGTGCGGGGGC.

Images