Combinations for enhancing bone growth and / or bone strength

By combining vitamins K2, A, and D with a mixture of short-chain fatty acids and oligosaccharides, and utilizing probiotics to promote the production of vitamin K2 in the gastrointestinal tract, the problem of delayed bone growth in young children has been solved, resulting in enhanced bone growth and strength.

CN121127142APending Publication Date: 2025-12-12SOCIETE DES PRODUITS NESTLE SA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202480033106.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-05-25
Filing Date
2024-05-24
Publication Date
2025-12-12

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively address bone growth and bone strength issues in young children with growth retardation and/or slowed growth, especially in groups with poor dietary quality who may experience deficiencies in various micronutrients, leading to impaired growth.

Method used

It uses a combination of vitamin K2, vitamin A and vitamin D, along with a mixture of short-chain fatty acids and oligosaccharides, and promotes the production of vitamin K2 in the gastrointestinal tract through the action of probiotics such as Lactobacillus rhamnosus, thereby enhancing bone growth and bone strength.

Benefits of technology

This composition synergistically promotes osteoblast mineralization and differentiation, enhances bone mineralization, increases bone strength, and promotes catch-up growth.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present invention provides a combination of a vitamin mixture and an oligosaccharide mixture for use in enhancing bone growth and / or bone strength, for example, in a young child suffering from and / or being suffering from a growth retardation and / or a growth retardation.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present invention relates to compositions and methods for enhancing bone growth and / or bone strength in, for example, young children suffering from and / or suffering from growth retardation and / or growth faltering. BACKGROUND

[0002] Growth and development of the human skeleton requires an adequate supply of many different nutritional factors. Classical nutritional deficiencies are associated with stunting (e.g. energy, protein, Zn), rickets (e.g. vitamin D) and other bone abnormalities (e.g. Cu, Zn, vitamin C). There is evidence that growth patterns during childhood and nutritional exposure influence peak bone mass and later fracture risk. However, it is challenging to use bone health as a criterion to define dietary reference values, and the question of what type of dietary constitutes the best support for optimal bone growth and development remains unanswered (see e.g. Prentice, A. et al. 2006. Proceedings of the Nutrition Society, 65(4), pp. 348-360).

[0003] Several approaches can be taken to improve intake of growth-limiting nutrients, including administration of micronutrient supplements, fortification of foods with micronutrients or improving dietary intake. However, in particular in populations with poor dietary quality, several micronutrient deficiencies can occur simultaneously, in which case growth can be affected by more than one growth-limiting nutrient (see e.g. Rivera, J.A. et al. 2003. The Journal of nutrition, 133(11), pp. 4010S-4020S).

[0004] Therefore, there is a need for new nutritional interventions to enhance bone growth and / or bone strength in, for example, young children suffering from growth retardation and / or growth faltering. SUMMARY

[0005] The present inventors surprisingly found that a combination of vitamin K2 (which can be produced in the gastrointestinal tract, for example from vitamin K1, as discussed below), vitamin A and vitamin D synergistically promote osteoblast mineralization. Furthermore, the present inventors surprisingly found that a combination of vitamin K2, A and D synergistically promote osteoblast differentiation with short chain fatty acids (SCFA). SCFA can be produced, for example, by oligosaccharide fermentation in the gut.

[0006] As an alternative to direct administration of vitamin K2, the present inventors surprisingly show that an oligosaccharide mixture comprising bovine milk oligosaccharides (BMOs) promotes vitamin K2 production (e.g., via conversion of vitamin Kl) in the gastrointestinal tract. The present inventors surprisingly show that vitamin K2 production (e.g., via conversion of vitamin Kl) in the gastrointestinal tract can be further promoted by administration of a probiotic (e.g., Lactobacillus rhamnosus).

[0007] In one aspect, the present application provides a combination of a vitamin mixture and an oligosaccharide mixture for use in enhancing bone growth and / or bone strength in a subject, wherein the vitamin mixture comprises or consists of vitamin Kl, vitamin A, and vitamin D.

[0008] In another aspect, the present application provides use of a combination of a vitamin mixture and an oligosaccharide mixture in the manufacture of a medical food product for enhancing bone growth and / or bone strength in a subject, wherein the vitamin mixture comprises or consists of vitamin Kl, vitamin A, and vitamin D.

[0009] In another aspect, the present application provides a method for enhancing bone growth and / or bone strength in a subject, the method comprising administering to the subject an effective amount of a combination of a vitamin mixture and an oligosaccharide mixture, wherein the vitamin mixture comprises or consists of vitamin Kl, vitamin A, and vitamin D.

[0010] The subject can be any suitable subject. In particular, the subject can be a young child or a teenager. The subject can be a young human child or a toddler. For example, the subject can be a human about 1 year of age or older. In some embodiments, the subject is a human about 1 year of age to about 3 years of age. Alternatively, the subject can be a young animal, such as a young pet. The subject can have and / or can be suffering from growth retardation and / or growth slowing. The subject can be preterm, have low birth weight, and / or experience intrauterine growth retardation.

[0011] The oligosaccharide mixture can be any suitable mixture of oligosaccharides. In preferred embodiments, the oligosaccharide mixture comprises or consists of bovine milk oligosaccharides (BMOs).

[0012] The oligosaccharide mixture can also comprise one or more human milk oligosaccharides (HMOs). Suitably, the one or more HMOs comprise or consist of at least one sialylated oligosaccharide, at least one fucosylated oligosaccharide, and / or at least one N-acetylated oligosaccharide. Suitably, the at least one sialylated oligosaccharide is selected from the group consisting of 3'-sialyllactose (3'-SL), 6'-sialyllactose (6'-SL), sialyllactose-N-tetraose b (LSTb), sialyllactose-N-tetraose c (LSTc), disialyllactose-N-tetraose, and combinations thereof. In some embodiments, the at least one sialylated oligosaccharide is selected from 3'-sialyllactose (3'-SL), 6'-sialyllactose (6'-SL), and combinations thereof. In some embodiments, the at least one sialylated oligosaccharide is 6'-sialyllactose (6'-SL). Suitably, the at least one fucosylated oligosaccharide is selected from the group consisting of 3-fucosyllactose (3FL), difucosyllactose (diFL), lacto-N-fucopentaose-I (LNFP-I), lacto-N-fucopentaose-II (LNFP-II), lacto-N-fucopentaose-III (LNFP-III), lacto-N-fucopentaose-V (LNFP-V), lacto-neofucopentaose V (LNnFP-V), lacto-N-difucohexaose-I (LNDFH-I), lacto-N-neodifucohexaose (LNnDFH), monofucosyllacto-N-hexaose-III (MFNLH-III), difucosyllacto-N-hexaose-a (DFLNHa), and combinations thereof. In some embodiments, the at least one fucosylated oligosaccharide is difucosyllactose (diFL). Suitably, the at least one N-acetylated oligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof. In some embodiments, the at least one N-acetylated oligosaccharide is selected from lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof. In some embodiments, the at least one N-acetylated oligosaccharide is lacto-N-tetraose (LNT) and lacto-N-neotetraose (LNnT). Suitably, the oligosaccharide mixture comprises: (a) about 0.5 wt% to about 2 wt% of the at least one sialylated oligosaccharide relative to the total weight of the oligosaccharide mixture; (b) about 2 wt% to about 6 wt% of the at least one fucosylated oligosaccharide relative to the total weight of the oligosaccharide mixture; and / or (c) about 1 wt% to about 4 wt% of the at least one N-acetylated oligosaccharide relative to the total weight of the oligosaccharide mixture.

[0013] The combination can also include one or more probiotic bacteria. In preferred embodiments, the one or more probiotic bacteria comprises or consists of Lactobacillus rhamnosus. In some embodiments, the one or more probiotic bacteria comprises Bifidobacterium longum.

[0014] The combination can be administered by any suitable route. Suitably, the combination is administered by oral administration. The combination can be administered separately, simultaneously or sequentially. In some embodiments, the combination is administered simultaneously.

[0015] The combination can be administered to a subject in any suitable amount. Suitably, vitamin Kl is administered to a subject in an amount of about 5 pg / day to about 200 pg / day. Suitably, vitamin A is administered to a subject in an amount of about 100 pg RE / day to about 1000 pg RE / day. Suitably, vitamin D is administered to a subject in an amount of at least about 2.5 pg / day to about 100 pg / day or about 5 pg / day to about 100 pg / day. Suitably, the oligosaccharide mixture is administered to a subject in a total amount of about 0.5 g / day to about 10 g / day. Suitably, BMO is administered to a subject in a total amount of about 0.5 g / day to about 10 g / day. Suitably, Lactobacillus rhamnosus is administered to a subject in a total amount of about 10 6 cfu / day to about 10 12 cfu / day.

[0016] The combination can be provided in any suitable form (e.g., in the form of a composition). The combination can be provided in the form of a nutritional composition. The combination can be provided in the form of a medical food product for clinical nutrition. The combination can be provided in the form of a growing-up milk.

[0017] The composition can include any suitable amount of the combination. Suitably, the composition includes vitamin Kl in an amount of about 5 pg / 100 g to about 200 pg / 100 g on a dry weight basis. Suitably, the composition includes vitamin A in an amount of about 100 pg RE / 100 g to about 1000 pg RE / 100 g on a dry weight basis. Suitably, the composition includes vitamin D in an amount of about 2.5 pg / 100 g to about 20 pg / 100 g or about 5 pg / 100 g to about 20 pg / 100 g on a dry weight basis. Suitably, the composition includes the oligosaccharide mixture in a total amount of about 0.5 wt% to about 5 wt% on a dry weight basis. Suitably, the composition includes BMO in a total amount of about 0.5 wt% to about 5 wt% on a dry weight basis. Suitably, the composition includes Lactobacillus rhamnosus in an amount of about 10 6 cfu / 100 g to about 10 12 cfu / 100 g on a dry weight basis.

[0018] The combination can synergistically enhance bone growth and / or bone strength. The combination can enhance bone mineralization. The combination can promote osteoblast mineralization and / or osteoblast differentiation. The combination can increase vitamin K2 production. The combination can promote catch-up growth. Suitably, catch-up growth is determined using height velocity.

[0019] The present inventors have also surprisingly found that an oligosaccharide mixture comprising bovine milk oligosaccharides (BMOs) promotes vitamin K2 production in the gastrointestinal tract (e.g., via conversion of vitamin K1).

[0020] In another aspect, the present application provides the use of an oligosaccharide mixture in promoting vitamin K2 production in the gut of a subject. The oligosaccharide mixture can be any of the mixtures described herein. The oligosaccharide mixture can be administered in combination with one or more probiotics.

[0021] In another aspect, the present application provides a method for promoting vitamin K2 production in the gut of a subject, the method comprising administering to the subject an effective amount of an oligosaccharide mixture. The oligosaccharide mixture can be any of the mixtures described herein. The oligosaccharide mixture can be administered in combination with one or more probiotics. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 - Vitamin K2, A, D on osteoblast alkaline phosphatase (ALP) activity and osteocalcin in pre-osteoblastic cell lines Effect on mRNA levels

[0023] (A) ALP activity after 7 days of differentiation (without ascorbic acid). (B) Osteocalcin mRNA levels after 21 days of differentiation (without ascorbic acid). (C) Osteocalcin mRNA levels after 28 days of differentiation (with ascorbic acid). Pos = positive control; Neg = negative control; MK-7 = supplemented with 3 µM menaquinone-7; Vit D = supplemented with 1 nM 1a,25-dihydroxyvitamin D3; Vit A = supplemented with 100 nM all-trans retinoic acid.

[0024] Figure 2 - Effect of vitamin K2, A, D and short chain fatty acids (SCFA) on osteoblast ALP activity in pre-osteoblastic cell lines Figure 3

[0025] ALP activity after 7 days of differentiation (without ascorbic acid). Pos = positive control; Neg = negative control; MK-7 + A + D = supplemented with 3 µM menaquinone-7, 1 nM 1a,25-dihydroxyvitamin D3 and 100 nM all-trans retinoic acid; SCFA 20 µM = supplemented with 15 µM sodium acetate, 4 µM sodium propionate and 1 µM sodium butyrate; SCFA 50 µM = supplemented with 37.5 µM sodium acetate, 10 µM sodium propionate and 2.5 µM sodium butyrate; SCFA 60 µM = supplemented with 45 µM sodium acetate, 12 µM sodium propionate and 3 µM sodium butyrate.

[0026] Figure 4 - Effect of human milk oligosaccharides (HMOs) on vitamin K2 production in an intestinal model

[0027] (A) The following groups were evaluated (in the absence of milk substrate): blank and HMO + BMO (7.2 g / L in total). (B) The following groups were evaluated (in milk substrate): without LPR (no addition of Lactobacillus rhamnosus LPR); and with LPR (4.5 x 10 7 cfu / ml of Lactobacillus rhamnosus LPR).

[0028] Figure 5 - preclinical experimental design

[0029] Growth-restricted group (vit.K1 was used): from D8 to D18, the number of pups per BALB / c mother was increased by 50% to induce food restriction. Weaning occurred at D18 in both groups (normal and growth-restricted). Male and female mice then had ad libitum access to food and daily nutritional supplementation by gavage for 30 days.

[0030] Figure 5 A and Effect of Lactobacillus rhamnosus (LPR) on trabecular BV / TV and connectivity density (Conn. D) B - Vit. K1 AD + / - Synbiotic [BMOS + rhamnose milk] assessed by micro-computed tomography Combination .

[0031] The microarchitecture of the distal metaphysis of the femur was assessed using micro computed tomography (µCT XCT35, Scanco Medical AG, Basserdorf, Switzerland) as previously described (N. Bonnet, J. Brun, J.C. Rousseau, L.T. Duong, S.L. Ferrari, Cathepsin K Controls Cortical Bone Formation by Degrading Periostin, J. Bone Miner. Res., 2017, 32(7): 1432-1441). Briefly, the trabecular bone area was evaluated using isotropic 6 pm voxels. To eliminate the main cancellous, the 30 slices under the distal growth plate were not considered. The 80 slices of secondary cancellous directly underneath were analyzed. Using a direct three-dimensional technique that does not rely on previous assumptions about the underlying structure, morphometric variables were calculated from binary images (N. Bonnet, N. Laroche, L. Vico, E. Dolleans, D. Courteix, C.L. Benhamou, Assessment of trabecular bone microarchitecture by two different x-ray microcomputed tomographs: a comparative study of the rat distal tibia using Skyscan and Scanco devices, Med. Phys., 2009, 36(4): 1286-97). The BV / TV fraction (%) and the connectivity density (Conn.D) were evaluated. DETAILED DESCRIPTION

[0032] The preferred features and embodiments of the present application will now be described by way of non-limiting examples. The skilled person will understand that they can combine all features of the present application disclosed herein without departing from the scope of the disclosed application.

[0033] No reference in this specification to any prior publication, patent, patent application or anything else posted on the internet is to be construed as an admission that such prior art is widely known or forms part of the common general knowledge in the art. All publications mentioned in this specification are herein incorporated by reference.

[0034] As used in this specification, the words "comprises", "comprising", and similar words, are not to be interpreted in an exclusive or exhaustive sense. In other words, they are intended to mean "including, but not limited to". The terms "comprises" and "comprising" and similar terms also encompass the term "consisting of".

[0035] The practice of the present application will employ, unless otherwise indicated, conventional techniques of the artisan within the capacity of a person of ordinary skill in the art. Such techniques are explained in the literature. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0036] Numerical ranges include the numbers defining the range and, unless otherwise stated, all percentages disclosed herein are based on w / w. As used herein, the term "about" means approximately, in the vicinity of, roughly, or around. When the term "about" is used in conjunction with a number or a range, it modifies that value or range by extending the boundaries of the range up to and down to the recited value. Generally, the terms "about" and "approximately" are used herein to modify numerical values that are greater than and less than the stated value by 10%.

[0037] Vitamin mixture

[0038] In one aspect, the present application provides a combination of a vitamin mixture and an oligosaccharide mixture for use in enhancing bone growth and / or bone strength in a subject.

[0039] The combination of the present application can be referred to as combination therapy. As used herein, "combination therapy" can refer to therapy comprising administration of two or more agents, mixtures (e.g., vitamin mixtures, oligosaccharide mixtures, and / or probiotic mixtures), or compositions.

[0040] The combination can be administered by any suitable route and in any suitable form. Suitably, the combination is administered by oral and / or enteral administration. In preferred embodiments, the combination is administered by oral administration. The combination can be administered separately, simultaneously or sequentially. In preferred embodiments, the combination is administered simultaneously.

[0041] Vitamin K

[0042] The combination of the present application comprises a vitamin mixture. As used herein, "vitamin mixture" can refer to a mixture of two or more vitamins. Vitamins are organic micronutrients that the body needs to perform a variety of normal functions and include vitamin Kl, vitamin A, vitamin D, vitamin C, folate, vitamin B3, vitamin B6, vitamin B12, and vitamin E.

[0043] The vitamin mixture used in the present invention comprises or consists of vitamin Kl, vitamin A and vitamin D. The present inventors have surprisingly found that the combination of vitamin K2 (which can be produced in the gastrointestinal tract from vitamin Kl, for example, as discussed below), vitamin A and vitamin D synergistically promotes osteoblast mineralization.

[0044] Vitamin A

[0045] Vitamin K represents a family of fat-soluble compounds having the common chemical structure of a 3-substituted 2-methyl-l,4-naphthoquinone. It is naturally occurring in food as phylloquinone (vitamin Kl) and menaquinone (vitamin K2).

[0046] Vitamin Kl (phylloquinone) can have the following general formula:

[0047]

[0048] Vitamin Kl has a phylloquinyl side chain and is generally the predominant dietary form of vitamin K and is found in dark green leafy vegetables (e.g., spinach, lettuce, and other salad plants) and Brassica plants.

[0049] Vitamin K2 (menaquinone) can have the following general formula:

[0050]

[0051] Vitamin K2 consists of different forms, differing in the number of isoprene units (n), where n can range from 4 to 13. The various forms are denoted by the suffix (-n), for example, menaquinone-4 (abbreviated MK-4) has four isoprene residues (n = 4). MK-4 can be formed by metabolic conversion of phylloquinone during absorption in the intestinal mucosa and other organs. Other menaquinones can be produced in the gastrointestinal tract by specific anaerobic bacteria of the colonic microbiota.

[0052] The present inventors have also surprisingly found that an oligosaccharide mixture comprising bovine milk oligosaccharides (BMOs) promotes vitamin K2 production in the gastrointestinal tract (e.g., via conversion of vitamin Kl).

[0053] In one aspect, the present invention provides the use of an oligosaccharide mixture in promoting vitamin K2 production in the gut of a subject.

[0054] In one aspect, the present invention provides a method for promoting vitamin K2 production in the gut of a subject, the method comprising administering to the subject an effective amount of an oligosaccharide mixture.

[0055] The oligosaccharide mixture can be any of the mixtures described herein. In some embodiments, the mixture of oligosaccharides comprises or consists of bovine milk oligosaccharides (BMOs). In some embodiments, the oligosaccharide mixture further comprises one or more human milk oligosaccharides (HMOs). The oligosaccharide mixture can be administered in combination with one or more probiotics (e.g., any of the probiotics described herein). In some embodiments, the one or more probiotics comprises or consists of Lactobacillus rhamnosus.

[0056] In some embodiments, the oligosaccharide mixture promotes de novo production of menaquinone-7 (e.g., by the gut microbiota) in the gut of the subject. In some embodiments, the oligosaccharide mixture promotes biotransformation of phylloquinone to menaquinone-4 (e.g., by the gut microbiota) in the gut of the subject.

[0057] Vitamin D

[0058] Vitamin A includes a family of molecules that contain a 20-carbon structure with a cyclohexenyl ring (beta-ionone ring) with a methyl substitution and a tetraene side chain with a hydroxyl group at carbon-15 (retinol), an aldehyde group (retinal), a carboxylic acid group (retinoic acid), or an ester group (retinyl ester). The term vitamin A can also include provitamin A carotenoids that are dietary precursors of retinol. Among the many carotenoids in nature, some have provitamin A nutritional activity, including alpha-carotene, beta-carotene, and beta-cryptoxanthin.

[0059] The amount of vitamin A can refer to retinol equivalents (RE) or retinol activity equivalents (RAE). For dietary provitamin A carotenoids beta-carotene, alpha-carotene, and beta-cryptoxanthin, RE is set at 6 pg, 12 pg, and 12 pg, respectively. When pg RAE is used, the vitamin A activity of a provitamin A carotenoid is half of that assumed when pg RE is used. For dietary provitamin A carotenoids beta-carotene, alpha-carotene, and beta-cryptoxanthin, RAE is set at 12 pg, 24 pg, and 24 pg, respectively. (See, e.g., Dietary Reference Intakes for Vitamin A, Vitamin K, Arsenic, Boron, Chromium, Copper, Iodine, Iron, Manganese, Molybdenum, Nickel, Silicon, Vanadium, and Zinc. Washington (DC): National Academies Press (US); 2001.4, Vitamin A).

[0060] Administration of vitamins K1, A, and D

[0061] Vitamin D is a group of fat-soluble secosteroids, including vitamin D2 (ergocalciferol) and vitamin D3 (cholecalciferol). Calcitriol (also known as 1,25-dihydroxyvitamin D) is the active form of vitamin D. Suitably, vitamin D comprises or consists of vitamin D2 and vitamin D3. Suitably, vitamin D comprises or consists of calcitriol.

[0062] Oligosaccharide mixture

[0063] Any suitable amount of vitamin K1, A and D can be administered to a subject in any suitable form and by any suitable route of administration, e.g. in any form described herein and by any route.

[0064] Suitable doses of vitamin K1 are described, e.g., in: Kozioł-Kozakowska, A. and Maresz, K., 2022. Children, 9(1), p. 78 and EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA), 2017. EFSA Journal, 15(5), p. e04780. Suitable doses of vitamin A are described, e.g., in: Ross, A.C. and Moran, N.E., 2020. Current Developments in Nutrition, 4(10), p. nzaa096 and EFSA Panel on Dietetic Products, Nutrition, and Allergies (NDA), 2015. EFSA Journal, 13(3), p. 4028. Suitable doses of vitamin D are described, e.g., in: Greer, F.R., 2004. The American journal of clinical nutrition, 80(6), pp. 1759S-1762S and EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA), 2016. EFSA Journal, 14(10), p. e04547.

[0065] Suitably, vitamin K1 is administered to the subject in an amount of at least about 0.2 pg / kg / day, at least about 0.5 pg / kg / day, or at least about 0.8 pg / kg / day. Suitably, vitamin K1 is administered to the subject in an amount of about 2 pg / kg / day or less, about 1.5 pg / kg / day or less, or about 1.2 pg / kg / day or less. Suitably, vitamin K1 is administered to the subject in an amount of about 0.2 pg / kg / day to about 2 pg / kg / day, about 0.5 pg / kg / day to about 1.5 pg / kg / day, or about 0.8 pg / kg / day to about 1.2 pg / kg / day. In some embodiments, vitamin K1 is administered to the subject in an amount of about 1 pg / kg / day.

[0066] Suitably, vitamin K1 is administered to the subject in an amount of at least about 5 pg / day, at least about 10 pg / day, at least about 15 pg / day, at least about 20 pg / day, at least about 25 pg / day, or at least about 30 pg / day. Suitably, vitamin K1 is administered to the subject in an amount of about 200 pg / day or less, about 100 pg / day or less, about 90 pg / day or less, about 80 pg / day or less, about 70 pg / day or less, or about 60 pg / day or less. Suitably, vitamin K1 is administered to the subject in an amount of about 5 pg / day to about 200 pg / day, about 10 pg / day to about 100 pg / day, about 15 pg / day to about 90 pg / day, about 20 pg / day to about 80 pg / day, about 25 pg / day to about 70 pg / day, or about 30 pg / day to about 60 pg / day.

[0067] Suitably, vitamin A is administered to the subject in an amount of at least about 100 pg RE / day, at least about 200 pg RE / day, or at least about 300 pg RE / day. Suitably, vitamin A is administered to the subject in an amount of about 1000 pg RE / day or less, about 800 pg RE / day or less, about 600 pg RE / day or less, or about 400 pg RE / day or less. Suitably, vitamin A is administered to the subject in an amount of about 100 pg RE / day to about 1000 pg RE / day, about 200 pg RE / day to about 800 pg RE / day, about 300 pg RE / day to about 600 pg RE / day, or about 300 pg RE / day to about 400 pg RE / day.

[0068] Suitably, vitamin A is administered to the subject in an amount of at least about 100 pg RE / day, at least about 200 pg RAE / day, or at least about 300 pg RAE / day. Suitably, vitamin A is administered to the subject in an amount of about 1000 pg RAE / day or less, about 800 pg RAE / day or less, about 600 pg RAE / day or less, or about 400 pg RAE / day or less. Suitably, vitamin A is administered to the subject in an amount of about 100 pg RAE / day to about 1000 pg RAE / day, about 200 pg RAE / day to about 800 pg RAE / day, about 300 pg RAE / day to about 600 pg RAE / day, or about 300 pg RAE / day to about 400 pg RAE / day.

[0069] Suitably, vitamin D is administered to the subject in an amount of at least about 2.5 pg / day, at least about 5 pg / day, at least about 10 pg / day, or at least about 15 pg / day. Suitably, vitamin D is administered to the subject in an amount of about 100 pg / day or less, about 75 pg / day or less, or about 50 pg / day or less. Suitably, vitamin D is administered to the subject in an amount of about 2.5 pg / day to about 100 pg / day, about 5 pg / day to about 100 pg / day, about 10 pg / day to about 75 pg / day, or about 15 pg / day to about 50 pg / day. Suitably, vitamin D is administered to the subject in an amount of about 15 pg / day.

[0070] Suitably, vitamin K1 is administered to the subject in an amount of about 5 pg / day to about 200 pg / day, vitamin A is administered to the subject in an amount of about 100 pg RE / day to about 1000 pg RE / day, and vitamin D is administered to the subject in an amount of about 2.5 pg / day to about 100 pg / day.

[0071] Bovine milk oligosaccharides (BMO)

[0072] The combination of the present application comprises an oligosaccharide mixture. As used herein, “oligosaccharide mixture” can refer to a mixture of two or more oligosaccharides. Oligosaccharides are sugar polymers containing a small number (usually two to ten) of monosaccharides, and are one of the most well-known prebiotics. Short-chain fatty acids (SCFAs) such as acetate, butyrate, and propionate can be produced by fermentation of the oligosaccharide mixture in the gut.

[0073] The oligosaccharide mixture can increase vitamin K2 production. The present inventors have surprisingly found that the oligosaccharide mixture can facilitate endogenous production of vitamin K2.

[0074] Human milk oligosaccharides (HMO)

[0075] The oligosaccharide mixture used in the present application can comprise or consist of bovine milk oligosaccharides (BMOs). Oligosaccharides in bovine milk are assembled in the mammary gland by combining the monosaccharides glucose (Glc), galactose (Gal), N-acetylglucosamine (GlcNAc), N-acetylgalactosamine, fucose, and the sialic acids N-acetylneuraminic acid and N-glycolylneuraminic acid. The collection of BMOs found in milk and colostrum has been extensively delineated, with typically 30 to 50 structures identified in comprehensive studies (see, e.g., Robinson, R.C., 2019. Frontiers in nutrition, 6, p. 50).

[0076] While bovine milk generally contains fewer oligosaccharide structures than human milk, both share at least ten common structures, including 3’-sialyllactose and 6’-sialyllactose, which make up a large percentage of the BMO pool (see, e.g., Robinson, R.C., 2019. Frontiers in nutrition, 6, p. 50).

[0077] Fucosylated oligosaccharides

[0078] The oligosaccharide mixture used in the present application can comprise or consist of one or more human milk oligosaccharides (HMOs). Many different kinds of HMOs are found in human milk, and are generally based on combinations of glucose, galactose, sialic acid (N-acetylneuraminic acid), fucose, and / or N-acetylglucosamine with many different linkages between them. Almost all HMOs have a lactose molecule at their reducing end, and the terminal position at the non-reducing end is occupied by sialic acid and / or fucose, if any. HMOs can be acidic (e.g., oligosaccharides containing charged sialic acid) or neutral (e.g., fucosylated oligosaccharides).

[0079] Suitably, the one or more HMOs can comprise at least one fucosylated oligosaccharide, at least one sialylated oligosaccharide, and / or at least one N-acetylated oligosaccharide. In some embodiments, the one or more HMOs comprise or consist of at least one fucosylated oligosaccharide, at least one sialylated oligosaccharide, and at least one N-acetylated oligosaccharide. In some embodiments, the one or more HMOs comprise or consist of 2’-fucosyllactose (2’FL), difucosyllactose (diFL), 6’-sialyllactose (6’-SL), lactose-N-tetraose (LNT), and lactose-N-neotetraose (LNnT). In some embodiments, the one or more HMOs comprise or consist of 2’-fucosyllactose (2’FL), difucosyllactose (diFL), 6’-sialyllactose (6’-SL), 3’-sialyllactose (3’-SL), lactose-N-tetraose (LNT), and lactose-N-neotetraose (LNnT).

[0080] In some embodiments, the mixture of oligosaccharides comprises 0.5% to about 2% by weight of at least one fucosylated oligosaccharide relative to the total weight of the oligosaccharide mixture. In some embodiments, the mixture of oligosaccharides comprises 2% to about 6% by weight of at least one sialylated oligosaccharide relative to the total weight of the oligosaccharide mixture. In some embodiments, the mixture of oligosaccharides comprises 1% to about 4% by weight of at least one N-acetylated oligosaccharide relative to the total weight of the oligosaccharide mixture.

[0081] In some embodiments, the mixture of oligosaccharides comprises 2% to about 6% by weight of at least one fucosylated oligosaccharide relative to the total weight of the oligosaccharide mixture; and about 1% to about 4% by weight of at least one N-acetylated oligosaccharide relative to the total weight of the oligosaccharide mixture.

[0082] In some embodiments, the mixture of oligosaccharides comprises 2% to about 6% by weight of at least one fucosylated oligosaccharide relative to the total weight of the oligosaccharide mixture; about 0.5% to about 2% by weight of at least one sialylated oligosaccharide relative to the total weight of the oligosaccharide mixture; and about 1% to about 4% by weight of at least one N-acetylated oligosaccharide relative to the total weight of the oligosaccharide mixture.

[0083] Oligosaccharides can be obtained by any suitable method. Suitable methods for synthesizing oligosaccharides are well known to those skilled in the art. For example, methods for preparing oligosaccharides by microbial fermentation, enzymatic methods, chemical synthesis, or a combination of these techniques have been developed (see, e.g., Zeuner et al., 2019. Molecules, 24(11), p. 2033).

[0084] Sialylated oligosaccharides

[0085] In some embodiments, the mixture of oligosaccharides comprises at least one fucosylated oligosaccharide.

[0086] Non-limiting examples of fucosylated oligosaccharides include: 2'-fucosyllactose (2'FL), 3-fucosyllactose (3FL), difucosyllactose (diFL), lacto-N-fucopentaose (such as lacto-N-fucopentaose I (LNFP-I), lacto-N-fucopentaose II (LNFP-II), lacto-N-fucopentaose III (LNFP-III), or lacto-N-fucopentaose V (LNFP-V)), lacto-N-fucohexaose, lacto-N-difucohexaose I, lacto- neofucopentaose V (LNnFP-V), lacto-N-difucohexaose-I (LNDFH-1), lacto-N-neodifucohexaose-I (LNnDFH), fucosyl lacto-N-hexaose, fucosyl lacto-N-neohexaose (such as fucosyl lacto-N- neohexaose I, fucosyl lacto-N-neohexaose II), monofucosyl lacto-N-hexaose III (MFNLH-III), difucosyl lacto-N-hexaose I, difucosyl-lacto-N-neohexaose, difucosyl lacto-N- neohexaose I, difucosyl lacto-N-neohexaose II, difucosyl lacto-N-hexaose-a (DFLNHa), fucosyl- para-lacto-N-hexaose, trifucosyl-para-lacto-N-hexaose I, and combinations thereof.

[0087] In preferred embodiments, the at least one fucosylated oligosaccharide comprises 2'-fucosyllactose (2'FL), which is typically the most prevalent HMO naturally occurring in human breast milk.

[0088] In some embodiments, the at least one fucosylated oligosaccharide is selected from the group consisting of 2'-fucosyllactose (2'FL), difucosyllactose (diFL), and combinations thereof. In some embodiments, the at least one fucosylated oligosaccharide comprises or consists of 2'-fucosyllactose (2'FL) and difucosyllactose (diFL).

[0089] Fucosylated oligosaccharides can be obtained by any suitable method. For example, 2'FL can be produced by biotechnological means using specific fucosyltransferases and / or fucosidases, by using enzyme-based (recombinant or natural enzymes) or microbial fermentation techniques. In the latter case, the microorganism can express its natural enzymes and substrates, or can be engineered to produce the corresponding substrates and enzymes. Alternatively, 2'FL can be produced by chemical synthesis from lactose and free fucose. diFL can be synthesized by enzymatic, biotechnological and / or chemical methods.

[0090] N-acetylated oligosaccharides

[0091] In some embodiments, the mixture of oligosaccharides comprises at least one sialylated oligosaccharide.

[0092] Non-limiting examples of sialylated oligosaccharides include: 3'-sialyllactose (3'-SL), 6'-sialyllactose (6'-SL), sialyllactose-N-tetraose b (LSTb), sialyllactose-N-tetraose c (LSTc), disialyllactose-N-tetraose, and combinations thereof.

[0093] In some embodiments, the at least one sialylated oligosaccharide is selected from the group consisting of 3'-sialyllactose (3'-SL), 6'-sialyllactose (6'-SL), and combinations thereof. In some embodiments, the at least one sialylated oligosaccharide comprises or consists of 6'-sialyllactose (6'-SL). In some embodiments, the at least one sialylated oligosaccharide comprises or consists of 6'-sialyllactose (6'-SL) and 3'-sialyllactose (3'-SL).

[0094] Sialylated oligosaccharides can be obtained by any suitable method. For example, 3'-sialyllactose (3'-SL) and / or 6'-sialyllactose (6'-SL) can be isolated from natural sources such as animal milk using chromatographic or filtration techniques. Alternatively, sialylated oligosaccharides can also be produced by biotechnological means using specific sialyltransferases or sialidases, neuraminidases, by enzyme-based (recombinant or natural enzymes) fermentation techniques, by chemical synthesis or by microbial fermentation techniques. In the latter case, the microorganism can express its natural enzymes and substrates or can be engineered to produce the corresponding substrates and enzymes. Single microbial cultures or mixed cultures can be used. Sialylated oligosaccharides can be formed starting with acceptor substrates of any degree of polymerization (DP), starting with DP = 1. Alternatively, sialyllactose can be produced by chemical synthesis from lactose and free N'-acetylneuraminic acid (sialic acid). Sialyllactose is also commercially available from, for example, Kyowa Hakko Kogyo, Japan or GeneChem, Republic of Korea.

[0095] If the oligosaccharide mixture comprises 3'-sialyllactose (3'-SL) and 6'-sialyllactose (6'-SL), it can be particularly advantageous if the 3'-sialyllactose (3'-SL) and 6'-sialyllactose (6'-SL) are comprised in the nutritional composition in a weight ratio of between about 10: 1 and about 1 : 10, such as between about 10: 1 and about 2: 1, between about 8: 1 and about 3: 1, between about 6: 1 and about 3: 1, between about 5: 1 and about 3: 1, between about 5: 1 and about 4: 1, or between about 1 :2 and about 1.5: 1.

[0096] Administration of oligosaccharide mixture

[0097] In some embodiments, the mixture of oligosaccharides comprises at least one N- acetylated oligosaccharide.

[0098] Suitably, the at least one N-acetylated oligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, and combinations thereof. Non-limiting examples of N-acetylated oligosaccharides include LNT (lacto-N-tetraose), para-lacto-N-neohexaose (para-LNnH), LNnT (lacto-N-neotetraose), and any combination thereof. Other examples are lacto-N-hexaose, lacto-N-neohexaose, para-lacto-N-hexaose, para-lacto-N-neohexaose, lacto-N-octaose, lacto-N-neooctaose, iso-lacto-N-octaose, para-lacto-N-octaose, and lacto-N-decaose.

[0099] In some embodiments, the at least one N-acetylated oligosaccharide is selected from the group consisting of lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof. In some embodiments, the at least one N-acetylated oligosaccharide comprises or consists of lacto-N-tetraose (LNT) and lacto-N-neotetraose (LNnT).

[0100] N-acetylated oligosaccharides can be obtained by any suitable method. For example, LNnT can be chemically synthesized by using glycosyltransferases to enzymatically transfer sugar units from a donor moiety to an acceptor moiety. Alternatively, LNnT can be prepared by chemically converting a free or bound to an oligosaccharide (e.g., lactulose) ketohexose (e.g., fructose) to an N-acetylhexosamine or an oligosaccharide comprising an N-acetylhexosamine. LNT can be synthesized by enzymatic, biotechnological, and / or chemical methods.

[0101] Probiotic

[0102] Any suitable amount of oligosaccharides can be administered to a subject in any suitable form and by any suitable route of administration (e.g., in any form described herein and by any route).

[0103] Suitable doses of human oligosaccharides are described, for example, in: EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA), 2015. EFSA Journal, 13(11), p. 4299; EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2019. EFSA Journal, 17(6), p. e05717; EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2020. EFSA Journal, 18(5), p. e06097; EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2022. EFSA Journal, 20(5), p. e07331; and EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2019. EFSA Journal, 17(12), p. e05907.

[0104] Suitably, the oligosaccharide mixture is administered to the subject in an amount of at least about 0.5 g / day, at least about 1 g / day, or at least about 2 g / day. Suitably, the oligosaccharide mixture is administered to the subject in an amount of about 10 g / day or less, about 8 g / day or less, or about 5 g / day or less. Suitably, the oligosaccharide mixture is administered to the subject in an amount of about 0.5 g / day to about 10 g / day, about 1 g / day to about 8 g / day, or about 2 g / day to about 5 g / day.

[0105] Suitably, the BMO is administered to the subject in an amount of at least about 0.5 g / day, at least about 1 g / day, or at least about 2 g / day. Suitably, the BMO is administered to the subject in an amount of about 10 g / day or less, about 8 g / day or less, or about 5 g / day or less. Suitably, the BMO is administered to the subject in an amount of about 0.5 g / day to about 10 g / day, about 1 g / day to about 8 g / day, or about 2 g / day to about 5 g / day.

[0106] Suitably, the vitamin Kl is administered to the subject in an amount of about 5 pg / day to about 200 pg / day, the vitamin A is administered to the subject in an amount of about 100 pg RE / day to about 1000 pg RE / day, the vitamin D is administered to the subject in an amount of about 2.5 pg / day to about 100 pg / day, and the oligosaccharide mixture is administered to the subject in an amount of about 0.5 g / day to about 10 g / day.

[0107] Suitably, vitamin Kl is administered to the subject in an amount of about 5 pg / day to about 200 pg / day, vitamin A is administered to the subject in an amount of about 100 pg RE / day to about 1000 pg RE / day, vitamin D is administered to the subject in an amount of about 2.5 pg / day to about 100 pg / day, and BMO is administered to the subject in an amount of about 0.5 g / day to about 10 g / day.

[0108] Lactobacillus rhamnosus

[0109] The combination of the present application can also comprise one or more probiotic bacteria. As used herein, the term “probiotic bacteria” can refer to live microorganisms contained in sufficient amounts to alter the composition of the intestinal microbiota of a subject (see, e.g., Hill, C. et al. 2014. Nature reviews Gastroenterology & hepatology, 11(8), p. 506). Suitably, the probiotic bacteria comprise commercially available probiotic bacterial strains and / or strains that have been shown to have health benefits (see, e.g., Fijan, S. 2014. International journal of environmental research and public health, 11(5), p. 4745-4767). Exemplary probiotic microorganisms can include Bifidobacterium, Lactobacillus, Limosilactobacillus, Lacticaseibacillus, Saccharomyces, Enterococcus, Streptococcus, Pediococcus, Leuconostoc, Bacillus, and Escherichia coli.

[0110] The one or more probiotic bacteria can increase vitamin K2 production. The present inventors have surprisingly found that probiotic bacteria can facilitate endogenous production of vitamin K2 through the production of precursors.

[0111] In some embodiments, the one or more probiotic bacteria comprise or consist of Lacticaseibacillus paracasei, Bifidobacterium, Lactobacillus, and / or Limosilactobacillus. In some embodiments, the one or more probiotic bacteria comprise or consist of Lactobacillus rhamnosus, Bifidobacterium longum, and / or Bifidobacterium animalis.

[0112] Bifidobacterium longum

[0113] In preferred embodiments, the one or more probiotic bacteria comprise or consist of Lactobacillus rhamnosus.

[0114] Lactobacillus rhamnosus (also known as Lactobacillus rhamnosus) is a short, gram-positive homofermentative facultative anaerobic non-sporulating rod that usually occurs in chains. Lactobacillus rhamnosus GG (LGG) is one of the most widely used probiotic bacterial strains. Various health effects have been documented (see e.g. Segers, M.E. and Lebeer, S., 2014. Microbial cell factories, 13(1), pp.1-16). Lactobacillus rhamnosus can promote endogenous production of vitamin K2 through production of precursors.

[0115] In some embodiments, the one or more probiotic bacteria comprise or consist of Lactobacillus rhamnosus LPR.

[0116] Bifidobacterium animalis

[0117] In some embodiments, the one or more probiotic bacteria comprise or consist of Bifidobacterium longum.

[0118] Bifidobacterium longum is a bacterium that is present in the human digestive tract. In 2002, three formerly distinct Bifidobacterium species (Bifidobacterium infantis, Bifidobacterium longum and Bifidobacterium suis) were each merged with biotypes Bifidobacterium infantis, Bifidobacterium longum and Bifidobacterium suis, respectively, into a single species named Bifidobacterium longum (Sakata, S. et al., 2002. International journal of systematic and evolutionary microbiology, 52(6), pp.1945-1951).

[0119] In some embodiments, the one or more probiotic bacteria comprise or consist of Bifidobacterium longum ssp. infantis (also known as Bifidobacterium infantis), Bifidobacterium longum ssp. suis (also known as Bifidobacterium suis) and / or Bifidobacterium longum ssp. longum (also known as Bifidobacterium longum).

[0120] In some embodiments, the one or more probiotic bacteria comprise or consist of Bifidobacterium infantis. In some embodiments, the one or more probiotic bacteria comprise or consist of Bifidobacterium infantis LMG 11588 or a derivative thereof (e.g., R0033, which has been deemed safe (GRAS) by the US Food and Drug Administration, see, e.g., Duboux, S. et al., 2022. Microorganisms, 10(2), p. 203). Bifidobacterium infantis can promote endogenous production of vitamin K2 through production of precursors.

[0121] Administration of probiotic

[0122] In some embodiments, the one or more probiotic bacteria comprise or consist of Bifidobacterium animalis.

[0123] Bifidobacterium animalis is a bacterium of the genus Bifidobacterium that can be found in the large intestine of most mammals, including humans. Bifidobacterium animalis and Bifidobacterium lactis were previously described as two different species. Currently, both are considered, i.e., Bifidobacterium animalis with subspecies Bifidobacterium animalis animalis and Bifidobacterium animalis subspecies lactis (see Masco, L. et al., 2004. International Journal of Systematic and Evolutionary Microbiology, 54(4), pp. 1137-1143).

[0124] In some embodiments, the one or more probiotic bacteria comprise or consist of Bifidobacterium animalis lactis (also known as Bifidobacterium lactis). For example, various traits of the bacterium Bifidobacterium lactis HN019 that are important for its ability to act as a probiotic have been studied (see, e.g., Sanders, M.E., 2006. Journal of clinical gastroenterology, 40(9), pp. 776-783).

[0125] Composition

[0126] Any suitable amount of probiotic bacteria can be administered to a subject in any suitable form and by any suitable route of administration (e.g., in any form described herein and by any route).

[0127] Suitably, the one or more probiotic bacteria are administered at least about 10 5 cfu / day, at least about 10 6 cfu / day, at least about 10 7 cfu / day, at least about 10 8cfu / day, at least about 10 9 cfu / day, at least about 10 10 a total amount of about 10 12 cfu / day or less, about 10 11 cfu / day or less, or about 10 10 a total amount of about 10 6 cfu / day to about 10 12 cfu / day, about 10 7 cfu / day to about 10 11 cfu / day, or about 10 8 cfu / day to about 10 10 a total amount of about 10

[0128] Suitably, Lactobacillus rhamnosus is administered to the subject in an amount of at least about 10 5 cfu / day, at least about 10 6 cfu / day, at least about 10 7 cfu / day, at least about 10 8 cfu / day, at least about 10 9 cfu / day, or at least about 10 10 cfu / day. Suitably, Lactobacillus rhamnosus is administered to the subject in an amount of about 10 12 cfu / day or less, about 10 11 cfu / day or less, or about 10 10 cfu / day or less. Suitably, Lactobacillus rhamnosus is administered to the subject in an amount of about 10 6 cfu / day to about 10 12 cfu / day, about 10 7 cfu / day to about 10 11 cfu / day, or about 10 8 cfu / day to about 10 10 cfu / day. Suitably, Lactobacillus rhamnosus is administered to the subject in an amount of about 10

[0129] Suitably, Bifidobacterium longum (e.g., Bifidobacterium infantis) is administered to the subject in an amount of at least about 10 5 cfu / day, at least about 10 6 cfu / day, at least about 10 7 cfu / day, at least about 10 8 cfu / day, at least about 10 9 cfu / day, or at least about 10 10 cfu / day. Suitably, Bifidobacterium longum (e.g., Bifidobacterium infantis) is administered to the subject in an amount of about 10 12 cfu / day or less, about 1011 cfu / day or less or about 10 10 The Bifidobacterium animalis lactis (e.g., Bifidobacterium animalis subsp. lactis) is administered to the subject in an amount of at least about 10 6 cfu / day to about 10 12 cfu / day, about 10 7 cfu / day to about 10 11 cfu / day or about 10 8 cfu / day to about 10 10 The Bifidobacterium animalis lactis (e.g., Bifidobacterium animalis subsp. lactis) is administered to the subject in an amount of at least about 10

[0130] The Bifidobacterium animalis lactis (e.g., Bifidobacterium animalis subsp. lactis) is administered to the subject in an amount of at least about 10 5 cfu / day, at least about 10 6 cfu / day, at least about 10 7 cfu / day, at least about 10 8 cfu / day, at least about 10 9 cfu / day or at least about 10 10 The Bifidobacterium animalis lactis (e.g., Bifidobacterium animalis subsp. lactis) is administered to the subject in an amount of at least about 10 12 cfu / day or less, about 10 11 cfu / day or less or about 10 10 The Bifidobacterium animalis lactis (e.g., Bifidobacterium animalis subsp. lactis) is administered to the subject in an amount of at least about 10 6 cfu / day to about 10 12 cfu / day, about 10 7 cfu / day to about 10 11 cfu / day or about 10 8 cfu / day to about 10 10 The Bifidobacterium animalis lactis (e.g., Bifidobacterium animalis subsp. lactis) is administered to the subject in an amount of at least about 10

[0131] The Bifidobacterium animalis lactis (e.g., Bifidobacterium animalis subsp. lactis) is administered to the subject in an amount of at least about 10 6 cfu / day to about 10 12 The Bifidobacterium animalis lactis (e.g., Bifidobacterium animalis subsp. lactis) is administered to the subject in an amount of at least about 10

[0132] Suitably, Vitamin K1 is administered to the subject in an amount of about 5 pg / day to about 200 pg / day, Vitamin A is administered to the subject in an amount of about 100 pg RE / day to about 1000 pg RE / day, Vitamin D is administered to the subject in an amount of about 2.5 pg / day to about 100 pg / day, BMO is administered to the subject in an amount of about 0.5 g / day to about 10 g / day, and Lactobacillus rhamnosus is administered to the subject in a total amount of about 10 6 cfu / day to about 10 12 cfu / day.

[0133] Suitably, Vitamin K1 is administered to the subject in an amount of about 5 pg / day to about 200 pg / day, Vitamin A is administered to the subject in an amount of about 100 pg RE / day to about 1000 pg RE / day, Vitamin D is administered to the subject in an amount of about 5 pg / day to about 100 pg / day, and Lactobacillus rhamnosus is administered to the subject in an amount of about 10 6 cfu / day to about 10 12 cfu / day.

[0134] Suitably, Vitamin K1 is administered to the subject in an amount of about 5 pg / day to about 200 pg / day, Vitamin A is administered to the subject in an amount of about 100 pg RE / day to about 1000 pg RE / day, Vitamin D is administered to the subject in an amount of about 5 pg / day to about 100 pg / day, BMO is administered to the subject in an amount of about 0.5 g / day to about 10 g / day, and Lactobacillus rhamnosus is administered to the subject in a total amount of about 10 6 cfu / day to about 10 12 cfu / day.

[0135] Vitamin mixture

[0136] Suitably, the combination is in the form of a composition. The composition can comprise any therapeutically effective amount of the combination.

[0137] The composition can be any type of composition into which the combination can be incorporated, such as a food or beverage product, an animal feed product, a nutritional supplement for humans or animals, or a pharmaceutical composition. The composition can be in solid (e.g., powder), liquid, or semi-liquid form. The combination can be in the form of a food composition, a pet food composition, a beverage, a nutritional formula, a nutritional supplement, or a nutraceutical.

[0138] For the purposes of providing nutrition and / or pleasure, food and beverage products include all products intended for oral consumption by humans. For example, it can be a nutritional composition, such as for young children. Examples of food and beverage products include dairy products, such as milk products or yogurts, soups, sauces, sweet and savory snacks, powdered beverages, and cereal products.

[0139] In some embodiments, the combination is in the form of a nutritional composition, a medical food product for clinical nutrition, a growing-up milk, or a supplement.

[0140] In some embodiments, the combination is in the form of a nutritional composition. As used herein, a "nutritional composition" can mean a composition that supplies nutrients to a subject. Such nutritional compositions are typically administered orally or intravenously, and typically include a lipid or fat source and a protein source.

[0141] In some embodiments, the combination is in the form of a medical food product for clinical nutrition. As used herein, a "medical food product for clinical nutrition" can also be referred to as a "food for special medical purposes (FSMP)," and refers to a specialized food designed to help meet the nutritional or dietary needs of a subject suffering from a disease, disorder, or medical condition who is temporarily or permanently unable to obtain sufficient nutritional intake from normal foods or by modification of normal diet.

[0142] In some embodiments, the combination is in the form of an infant formula. In this case, the infant formula can be a preterm infant formula, a human milk fortifier, a starter infant formula, a larger infant formula, a baby food formula, an infant cereal formula, or a growing-up milk.

[0143] In preferred embodiments, the combination is in the form of a growing-up milk. As used herein, the term "growing-up milk" (or GUM) refers to a milk formula product provided after one year. It is typically a dairy-based beverage adapted to the specific nutritional needs of a young child (e.g., a child from about 1 to about 3 years of age). Growing-up milk can also be referred to as "toddler formula" or "junior milk."

[0144] In some embodiments, the composition (e.g., growing-up milk) is in the form of a powder and is reconstituted in an aqueous medium (e.g., water) prior to administration. In other embodiments, the composition (e.g., growing-up milk) is in a ready-to- administer liquid form (e.g., a ready-to-feed formula).

[0145] In another embodiment, the combination is in the form of a supplement. As used herein, a "supplement" or "dietary supplement" can be used to supplement the nutrition of a subject (which is its usual use, but it can also be added to any kind of composition intended to be ingested by a subject). When the composition is a supplement, it can be provided in unit dosage form. Supplements are typically present in the form of a liquid, a gel, a powder, or a tablet or capsule. Powdered supplements typically encompass supplements to be dissolved in water or milk or sprinkled on food or beverages. Such supplements are intended to provide additional nutrients and / or health benefits to the subject consuming it. Supplements can be used to provide nutrients and / or health benefits to both humans as well as animals.

[0146] In another embodiment, the combination is in the form of a fortifier. The fortifier can be a milk formula fortifier or a growing-up milk fortifier.

[0147] In another embodiment, the combination is in the form of a pharmaceutical product. Pharmaceutical products include, for example, drop, syrup, powder, tablet, or capsule products intended to treat or prevent an adverse medical condition in a subject in need thereof.

[0148] The combination can also be in the form of an animal food product or a nutritional supplement for animals. Preferably, the animal is a mammal. Examples of animals include primates (e.g., humans), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice, fish, birds, and the like.

[0149] The nutritional composition of the present application, in particular a growing-up milk, typically contains a protein source, a carbohydrate source, and a lipid source. However, in some embodiments, in particular if the nutritional composition of the present application is a supplement or fortifier, only a lipid (or lipid source) can be present.

[0150] The nutritional composition of the present application can comprise from about 100 kcal / 100 g to about 1000 kcal / 100 g, from about 200 kcal / 100 g to about 800 kcal / 100 g, or from about 400 kcal / 100 g to about 600 kcal / 100 g on a dry weight basis.

[0151] Oligosaccharide mixture

[0152] The nutritional composition according to the present application (e.g., a growing-up milk) can contain any suitable amount of vitamin K1, A, and D.

[0153] Suitably, the nutritional composition comprises vitamin K1 in an amount of at least about 5 pg / 100 g, at least about 10 pg / 100 g, at least about 15 pg / 100 g, at least about 20 pg / 100 g, at least about 25 pg / 100 g, or at least about 30 pg / 100 g on a dry weight basis. Suitably, the nutritional composition comprises vitamin K1 in an amount of about 2100 pg / 100 g or less, about 100 pg / 100 g or less, about 90 pg / 100 g or less, about 80 pg / 100 g or less, about 70 pg / 100 g or less, or about 60 pg / 100 g or less on a dry weight basis. Suitably, the nutritional composition comprises vitamin K1 in an amount of from about 5 pg / 100 g to about 200 pg / 100 g, from about 10 pg / 100 g to about 100 pg / 100 g, from about 15 pg / 100 g to about 90 pg / 100 g, from about 20 pg / 100 g to about 80 pg / 100 g, from about 25 pg / 100 g to about 70 pg / 100 g, or from about 30 pg / 100 g to about 60 pg / 100 g.

[0154] Suitably, the nutritional composition comprises vitamin A in an amount of at least about 100 pg RE / 100 g, at least about 200 pg RE / 100 g, or at least about 300 pg RE / 100 g on a dry weight basis. Suitably, the nutritional composition comprises vitamin A in an amount of about 1000 pg RE / 100 g or less, about 800 pg RE / 100 g or less, about 600 pg RE / 100 g or less, or about 400 pg RE / 100 g or less on a dry weight basis. Suitably, the nutritional composition comprises vitamin A in an amount of about 100 pg RE / 100 g to about 1000 pg RE / 100 g, about 200 pg RE / 100 g to about 800 pg RE / 100 g, about 300 pg RE / 100 g to about 600 pg RE / 100 g, or about 300 pg RE / 100 g to about 400 pg RE / 100 g on a dry weight basis.

[0155] Suitably, the nutritional composition comprises vitamin A in an amount of at least about 100 pg RAE / 100 g, at least about 200 pg RAE / 100 g, or at least about 300 pg RAE / 100 g on a dry weight basis. Suitably, the nutritional composition comprises vitamin A in an amount of about 1000 pg RAE / 100 g or less, about 800 pg RAE / 100 g or less, about 600 pg RAE / 100 g or less, or about 400 pg RAE / 100 g or less on a dry weight basis. Suitably, the nutritional composition comprises vitamin A in an amount of about 100 pg RAE / 100 g to about 1000 pg RAE / 100 g, about 200 pg RAE / 100 g to about 800 pg RAE / 100 g, about 300 pg RAE / 100 g to about 600 pg RAE / 100 g, or about 300 pg RAE / 100 g to about 400 pg RAE / 100 g on a dry weight basis.

[0156] Suitably, the nutritional composition comprises vitamin D in an amount of at least about 2.5 pg / 100 g, at least about 5 pg / 100 g, at least about 10 pg / 100 g, or at least about 15 pg / 100 g on a dry weight basis. Suitably, the nutritional composition comprises vitamin D in an amount of about 100 pg / 100 g or less, about 75 pg / 100 g or less, or about 50 pg / 100 g or less on a dry weight basis. Suitably, the nutritional composition comprises vitamin D in an amount of about 2.5 pg / 100 g to about 100 pg / 100 g, about 5 pg / 100 g to about 100 pg / 100 g, about 10 pg / 100 g to about 75 pg / 100 g, or about 15 pg / 100 g to about 50 pg / 100 g on a dry weight basis.

[0157] Probiotic

[0158] The nutritional composition (e.g., a growing-up milk) according to the present application can contain any suitable amount of oligosaccharides.

[0159] Suitably, the nutritional composition comprises a total amount of oligosaccharide mixture of at least about 0.5 wt%, at least about 1 wt%, or at least about 2 wt% on a dry weight basis. Suitably, the nutritional composition comprises a total amount of oligosaccharide mixture of about 10 wt% or less, about 8 wt% or less, or about 5 wt% or less on a dry weight basis. Suitably, the nutritional composition comprises a total amount of oligosaccharide mixture of about 0.5 wt% to about 10 wt%, about 1 wt% to about 8 wt%, or about 2 wt% to about 5 wt% on a dry weight basis.

[0160] Suitably, the nutritional composition comprises a total amount of BMO of at least about 0.5 wt%, at least about 1 wt%, or at least about 2 wt% on a dry weight basis. Suitably, the nutritional composition comprises a total amount of BMO of about 10 wt% or less, about 8 wt% or less, or about 5 wt% or less on a dry weight basis. Suitably, the nutritional composition comprises a total amount of BMO of about 0.5 wt% to about 10 wt%, about 1 wt% to about 8 wt%, or about 2 wt% to about 5 wt% on a dry weight basis.

[0161] Protein

[0162] The nutritional composition (e.g., a growing-up milk) according to the present application can contain any suitable amount of probiotic bacteria.

[0163] Suitably, the nutritional composition comprises a total amount of one or more probiotic bacteria of at least about 10 5 cfu / 100g, at least about 10 6 cfu / 100g, at least about 10 7 cfu / 100g, or at least about 10 8 cfu / 100g, at least about 10 9 cfu / 100g, or at least about 10 10 cfu / 100g on a dry weight basis. Suitably, the nutritional composition comprises a total amount of one or more probiotic bacteria of about 10 12 cfu / 100g or less, about 10 11 cfu / 100g or less, about 10 10 cfu / 100g or less on a dry weight basis. Suitably, the nutritional composition comprises a total amount of one or more probiotic bacteria of about 10 6 cfu / 100g to about 10 12 cfu / 100g, about 10 7 cfu / 100g to about 10 11 cfu / 100g, or about 10 8 cfu / 100g to about 10 10one or more probiotic bacteria in an amount of at least about 10

[0164] Suitably, the nutritional composition comprises at least about 10 5 cfu / 100g, at least about 10 6 cfu / 100g, at least about 10 7 cfu / 100g, at least about 10 8 cfu / 100g, at least about 10 9 cfu / 100g, at least about 10 10 Lactobacillus rhamnosus in an amount of at least about 10 12 cfu / 100g or less, about 10 11 cfu / 100g or less, about 10 10 Lactobacillus rhamnosus in an amount of at least about 10 6 cfu / 100g to about 10 12 cfu / 100g, about 10 7 cfu / 100g to about 10 11 cfu / 100g or about 10 8 cfu / 100g to about 10 10 Lactobacillus rhamnosus in an amount of at least about 10

[0165] Suitably, the nutritional composition comprises at least about 10 5 cfu / 100g, at least about 10 6 cfu / 100g, at least about 10 7 cfu / 100g, at least about 10 8 cfu / 100g, at least about 10 9 cfu / 100g, at least about 10 10 Bifidobacterium longum (e.g. B. infantis) in an amount of at least about 10 12 cfu / 100g or less, about 10 11 cfu / 100g or less, about 10 10 Bifidobacterium longum (e.g. B. infantis) in an amount of at least about 10 6 cfu / 100g to about 10 12 cfu / 100g, about 10 7 cfu / 100g to about 10 11 cfu / 100g or about 10 8 cfu / 100g to about 1010 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10

[0166] Suitably, the nutritional composition comprises at least about 10 5 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10 6 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10 7 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10 8 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10 9 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10 10 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10 12 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10 11 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10 10 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10 6 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10 12 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10 7 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10 11 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10 8 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10 10 Bifidobacterium longum (e.g. Bifidobacterium infantis) in an amount of at least about 10

[0167] Carbohydrate

[0168] The nutritional composition according to the present application (e.g. a growing-up milk) can contain a protein source. This is particularly preferred where the nutritional composition of the application is a growing-up milk. The amount of protein can be from about 1 g to about 4 g per 100 kcal or from about 1.5 g to about 3 g per 100 kcal.

[0169] Protein sources based on, for example, whey, casein and mixtures thereof can be used, as can plant-based (e.g. soy-based) protein sources. In the case of whey proteins of interest, the protein source can be based on acid whey or sweet whey or mixtures thereof, and can comprise alpha-lactalbumin and beta-lactoglobulin in any desired proportions. In some embodiments, the protein source is predominantly whey-based (i.e. more than 50% of the protein is from whey protein, such as 60% or 70%). The protein can be intact or hydrolysed, or a mixture of intact and hydrolysed protein. By the term "intact" is meant that the majority of the protein is intact, i.e. the molecular structure has not been altered, for example at least 80% of the protein has not been altered, such as at least 85% of the protein has not been altered, preferably at least 90% of the protein has not been altered, even more preferably at least 95% of the protein has not been altered, such as at least 98% of the protein has not been altered. In one particular embodiment, 100% of the protein has not been altered.

[0170] The term "hydrolysed" means that in the context of the present application, the protein has been hydrolysed or broken down into its constituent amino acids.

[0171] The protein can be fully hydrolysed or partially hydrolysed. If hydrolysed protein is required, the hydrolysis process can be carried out as required and as is known in the art. For example, whey protein hydrolysates can be prepared by enzymatic hydrolysis of a whey fraction in one or more steps. If the whey fraction used as a starting material is substantially lactose-free, it is found that the protein is subjected to much less lysine blockage during the hydrolysis process. This enables the degree of lysine blockage to be reduced from about 15% by weight of total lysine to less than about 10% by weight of lysine; for example about 7% by weight of lysine, which greatly improves the nutritional quality of the protein source.

[0172] In one particular embodiment, the protein of the composition is hydrolysed, fully hydrolysed or partially hydrolysed. The degree of hydrolysis (DH) of the protein can be from 2 to 20, 8 to 40, or 20 to 60, or 20 to 80, or greater than 10, 20, 40, 60, 80 or 90.

[0173] At least 70%, 80%, 85%, 90%, 95% or 97% of the protein can be hydrolysed. In one particular embodiment, 100% of the protein is hydrolysed.

[0174] In one particular embodiment, the protein of the composition is a plant-based protein.

[0175] Lipid

[0176] The nutritional composition according to the present application (e.g. a growing-up milk) can contain a carbohydrate source. This is particularly preferred in case the nutritional composition of the present application is a growing-up milk. The amount of carbohydrate can be from about 5 g to about 20 g per 100 kcal or from about 10 g to about 15 g per 100 kcal.

[0177] Any carbohydrate source commonly found in growing-up milks can be used, such as lactose, sucrose, saccharose, maltodextrin, starch and mixtures thereof, but one of the preferred carbohydrate sources for growing-up milks is lactose.

[0178] Other components

[0179] The nutritional composition according to the present application (e.g. a growing-up milk) can contain lipids and essential fatty acids. This is particularly preferred in case the nutritional composition of the present application is a growing-up milk. The amount of lipids can be from about 1 g to about 10 g per 100 kcal or from about 2 g to about 6 g per 100 kcal.

[0180] Non-limiting examples of lipids include: palm olein, high oleic sunflower oil, high oleic safflower oil, canola oil, fish oil, coconut oil, bovine milk fat and combinations thereof. It can be particularly beneficial if the composition comprises fat in an amount of about 25 to about 30 g per 100 g dry weight of the composition. Non-limiting examples of essential fatty acids include: linoleic acid (LA), alpha-linolenic acid (ALA). The composition of the present application can also contain gangliosides, monosialic ganglioside-3 (GM3) and disialic ganglioside 3 (GD3) and combinations thereof.

[0181] Preparation of composition

[0182] The nutritional composition of the present application (e.g. a growing-up milk) can also contain all the vitamins and minerals considered essential for the daily diet and in nutritionally significant amounts. Minimum requirements have been established for certain vitamins and minerals. Examples of minerals, vitamins and other nutrients optionally present in the composition of the present application include vitamin Bl, vitamin B2, vitamin B3, vitamin B6, vitamin B 12, vitamin E, vitamin C, folic acid, inositol, niacin, biotin, pantothenic acid, choline, calcium, phosphorus, iodine, iron, magnesium, copper, zinc, manganese, chlorine, potassium, sodium, selenium, chromium, molybdenum, taurine and L-carnitine. Minerals are usually added in the form of salts. The presence and amount of specific minerals and other vitamins will vary depending on the target population. If necessary, the nutritional composition of the present application can contain emulsifiers and stabilizers such as soy, lecithin, citric acid monoglycerides and diglycerides, etc.

[0183] The nutritional composition (e.g. a growing-up milk) of the application can also comprise other substances which can have beneficial effects, especially on bone health or bone development, such as lactoferrin, osteopontin, TGFbeta, slgA, glutamine, nucleotides, nucleosides, etc.

[0184] Subject

[0185] The composition according to the application can be prepared by any known or other suitable means. For example, the nutritional composition (e.g. a growing-up milk) can be completed by blending together the protein source with the carbohydrate source and the lipid source in suitable proportions. If an emulsifier is used, it can be included at this stage. Vitamins and minerals can be added at this stage, but can also be added later, to avoid heat degradation. Water (preferably reverse osmosis or deionized water) can then be added and mixed in, to form a liquid mixture. The temperature of mixing is preferably room temperature, but can also be higher. The liquid mixture can then be heat treated to reduce bacterial load. The mixture can then be homogenized.

[0186] If a powdered composition is desired, the homogenized mixture is dried in a suitable drying apparatus, such as a spray drier or a freeze drier, and converted into a powder.

[0187] The process for manufacturing a formula is based on the concept that the product must be nutritionally adequate and safe to consume from a microbiological point of view. Therefore, a step to eliminate or limit microbial growth is essential to the manufacturing process. The processing technique for each specific formula is the property of the manufacturer, but in general, for powder products, it involves the preservation of oil-in-water (o / w) emulsions by dehydration, or for ready-to-feed or concentrated liquid products, it involves sterilization. Powdered formulas can be produced by various methods, such as dry mixing of dehydrated ingredients to constitute a uniform formula, or hydration and wet mixing of a mixture of macro-ingredients, such as fat, protein and carbohydrate ingredients, and then evaporation and spray-drying of the resulting mixture. A combination of the two methods described above can be used, where a base powder is first prepared by wet mixing and spray-drying of all or some of the macro-ingredients, and then the remaining ingredients, including carbohydrates, minerals and vitamins and other micronutrients, are dry mixed, to give the final formula. Liquid formulas are provided in ready-to-feed form or as a concentrated liquid, which needs to be diluted with water, usually 1 :1. The manufacturing process for these products is similar to those used for manufacturing reconstituted milks.

[0188] If a liquid formula is desired, the homogenized mixture can be filled into suitable containers, preferably under aseptic conditions. However, the liquid composition can also be retorted in the container, suitable apparatus for such filling and retorting are commercially available.

[0189] Method for enhancing bone growth and / or bone strength

[0190] The subject can be any suitable subject. Suitably, the subject can be a mammal. In preferred embodiments, the subject is a human. In other embodiments, the subject is an animal, preferably wherein the animal is a pet. The pet can be an animal selected from a dog, a cat, a bird, a fish, a rodent (such as a mouse, a rat and a guinea pig), a rabbit, and the like. In some embodiments, the pet is a small dog breed.

[0191] In some embodiments, the subject is a juvenile, an adolescent or a child. The term "juvenile" can refer to an individual who has not yet reached adulthood. The term "adolescent" can refer to an individual from the onset of puberty to the period of adulthood. The term "child" can refer to an individual between the stages of birth and puberty.

[0192] In preferred embodiments, the subject is a toddler or a preschooler. As used herein, "toddler" or "young child" can refer to a child of about 1 to 3 years of age.

[0193] In preferred embodiments, the subject is about 1 year of age or older. For example, the subject can be about 12 months of age or older, about 18 months of age or older, or about 24 months of age or older.

[0194] In preferred embodiments, the subject is about 3 years of age or younger. For example, the subject can be about 36 months of age or younger, about 30 months to about 24 months of age or younger.

[0195] In other preferred embodiments, the subject is about 1 to about 3 years of age. For example, the subject can be about 12 months to about 36 months of age, about 18 months to about 36 months of age, or about 24 months to about 36 months of age. For example, the subject can be about 12 months to about 36 months of age, about 12 months to about 30 months of age, or about 12 months to about 24 months of age.

[0196] The present application is particularly suitable for children born prematurely or with low birth weight or who experienced intrauterine growth retardation, or infants and young children who suffered from growth retardation due to malnutrition or who experienced a disease such as Crohn's disease and / or celiac disease and / or cancer, or infants and young children treated with a drug such as a chemotherapeutic drug and / or a corticosteroid that leads to malabsorption, anorexia and / or metabolic bone disease. The present application is particularly preferably used for children born prematurely or with low birth weight or who experienced intrauterine growth retardation or who have intrauterine malnutrition or who suffered from growth delay. The present application is also suitable for children who are at risk of bone disease, who have a family history of bone disease, or who have experienced at least one, preferably several, episodes of bone fracture.

[0197] In some embodiments, the subject suffers from and / or is suffering from growth retardation. Growth retardation can be defined as an "age-height" value less than two standard deviations below the median of the WHO Child Growth Standards (see e.g. De Onis, M. and Branca, F., 2016. Maternal & child nutrition, 12, pp.12-26).

[0198] In some embodiments, the subject suffers from and / or is suffering from growth retardation. Growth retardation can be defined as an "age-height" value less than two standard deviations below the median of the WHO Child Growth Standards (see e.g. De Onis, M. and Branca, F., 2016. Maternal & child nutrition, 12, pp.12-26).

[0199] In some embodiments, the subject is preterm or has low birth weight or experiences intrauterine growth retardation. The term "preterm infant" can refer to an infant with a gestational age of less than 37 weeks at birth. The term "low birth weight infant" can refer to an infant with a birth weight of less than 2,500 g.

[0200] Method for promoting catch-up growth

[0201] The present inventors have shown that the combination of the present application can be used to enhance bone growth and / or bone strength in a subject.

[0202] In the context of the present application, the term "enhancing bone growth and / or bone strength" can in particular refer to one or more of the following physiological processes: bone catch-up growth, bone mass acquisition, peak bone mass optimization, promoting bone formation, promoting bone anabolic processes, promoting bone mineralization, increasing bone mineral density and microarchitecture, modulating bone biomechanical properties and modulating the ratio of bone formation and / or bone resorption.

[0203] In one aspect, the present application provides a combination according to the present application for use in enhancing bone growth and / or bone strength in a subject.

[0204] In one aspect, the present application provides the use of a combination according to the present application in the manufacture of a medical food product for enhancing bone growth and / or bone strength in a subject.

[0205] In one aspect, the present application provides a method for enhancing bone growth and / or bone strength in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of a combination according to the present application.

[0206] As used herein, "promoting bone growth and / or strength" can mean supporting normal bone growth and / or strength, e.g. during childhood and adolescence. Supporting normal bone growth and / or strength can result in normal bone anatomy and physiology. Suitable methods and parameters for determining bone growth and bone strength will be known to the skilled person (see for example Donnelly, E., 2011. Clinical Orthopaedics and Related Research, 469(8), pp. 2128-2138). Suitably, normal bone growth and / or strength can be determined using one or more bone parameters selected from the group consisting of trabecular bone volume fraction (BV / TV), bone mineral density (BMD), bone mineral content (BMC), cortical bone volume (Ct.BV), inner-outer diameter, anteroposterior diameter, bone ultimate force (FMax) and bone stiffness. In some embodiments, normal bone growth and / or strength is determined using one or more bone parameters selected from the group consisting of bone mineral density (BMD), trabecular bone volume fraction (BV / TV), cortical bone volume (Ct.BV) and bone ultimate force (FMax). Suitable methods for determining these parameters are available to the skilled person.

[0207] Examples

[0208] The combination of the present application can promote catch-up growth in a subject, e.g. who is growth-retarded and / or growth-reduced.

[0209] In one aspect, the present application provides a combination according to the present application for use in promoting catch-up growth in a subject.

[0210] In one aspect, the present application provides the use of a combination according to the present application in the manufacture of a medical food product for promoting catch-up growth in a subject.

[0211] In one aspect, the present application provides a method for promoting catch-up growth in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of a combination according to the present application.

[0212] As used herein, "catch-up growth" can mean a high rate of growth over the normal age limit for at least 1 year after a short period of growth inhibition, and can be complete or incomplete (see for example Wit, J.M. and Boersma, B., 2002. Journal of Pediatric Endocrinology and Metabolism, 15, pp. 1229-1242).

[0213] Determining suitable methods and parameters for catch-up growth are known to those skilled in the art. Suitably, height velocity or height standard deviation score can be used to determine catch-up growth (see, for example, Frongillo, E.A., Leroy, J.L., and Lapping, K., 2019. Advances in Nutrition, 10(3), pp.372-379 and Desmond, C. and Casale, D., 2017. PloS one, 12(12), p.e0189135).

[0214] In some embodiments, catch-up growth is determined in absolute terms of linear growth (i.e. height deficit reduction from the mean value of the healthy reference population). In some embodiments, catch-up growth is determined in relative terms of linear growth (i.e. age height z-score improvement and / or passing the -2SD or -1SD cut-off).

[0215] Example 1 - Effect of combination of vitamin K2, A, D, and HMO mixture on bone development

[0216] The application is further described with reference to the following examples. It is to be understood that the application as claimed is not intended to be limited by these examples in any way.

[0217] Results

[0218] Figure 1

[0219] The effect of vitamin K2, A, D and short chain fatty acids (SCFA) on osteoblast alkaline phosphatase (ALP) activity and osteocalcin mRNA levels in a pre-osteoblastic cell line was investigated.

[0220] After 7 days of differentiation (without ascorbic acid), vitamin A and vitamin D showed a significant effect on ALP activity, which is a marker of osteoblast differentiation, whereas vitamin K2 did not show a significant effect (see Figure 1 A). On the other hand, after 21 days of differentiation (without ascorbic acid), vitamin K2 showed a significant effect on osteocalcin expression, which is a key protein for osteoblast mineralization activity, whereas vitamin A and vitamin D did not show a significant effect (see Figure 1 B).

[0221] After 28 days of differentiation (with ascorbic acid), the combination of vitamin K2, A and D synergistically promoted osteoblast mineralization (see Figure 2 C).

[0222] The effects of SCFA were further investigated. Three mixtures of 75% acetate, 20% propionate, and 5% butyrate were evaluated to simulate normal physiological conditions (20 μM SCFA), physiological conditions after prebiotic supplementation (50 μM SCFA), and physiological conditions after synbiotic supplementation (60 μM SCFA).

[0223] Seven days after differentiation (without ascorbic acid), the combination of vitamins K2, A, and D with 50 μM or 60 μM SCFA synergistically promotes osteoblast differentiation (see [link to relevant documentation]). Materials and methods This effect is 28.4% higher than the cumulative effect.

[0224] MC3T3-E1 subclone 4 culture and treatment conditions

[0225] Osteoblast alkaline phosphatase activity

[0226] Pre-osteoblast cell line MC3T3-E1 subclone 4 (CRL-2593) was purchased from ATCC (Manassas; Virginia, USA). Cells were maintained in growth medium (GM) consisting of ascorbic acid-free αMEM (ThermoFisher Scientific) supplemented with 10% fetal bovine serum (FCS, ThermoFisher Scientific) and 1% penicillin / streptomycin. All medium was replaced every 2 to 3 days. Cells were passaged with trypsin / EDTA solution when confluence was less than 80%. To induce differentiation into osteoblasts, cells were cultured at 5 × 10⁶ cells / year. 4 cells / cm 2 Inoculated and grown in GM until confluence lasted 24 hours. The medium was then switched to differentiation medium (DM) consisting of GM supplemented with 10 mM β-glycerophosphate and the treatment solution of interest. Depending on the experiment, 50 µg / ml ascorbic acid was also added to the DM.

[0227] Osteocalcin RNA extraction

[0228] In addition to the positive control, MC3T3-E1 subclone 4 cells were differentiated for 7 days in DM without ascorbic acid with the following treatment solutions: a mixture consisting of 3 µM vit.K2 (menaquinone-7), 100 nM vit.A (all-trans retinoic acid) and 1 nM vit.D (1a,25-dihydroxyvitamin D3); a mixture consisting of 15 µM sodium acetate, 4 µM sodium propionate and 1 µM sodium butyrate, called "SCFA20"; a mixture consisting of 37.5 µM sodium acetate, 10 µM sodium propionate and 2.5 µM sodium butyrate, called "SCFA50"; - a mixture consisting of 45 µM sodium acetate, 12 µM sodium propionate and 3 µM sodium butyrate, called "SCFA60". The vitamin mixture was also combined with 3 different combinations of short chain fatty acids (SCFA).

[0229] After 7 days of differentiation, cells were then collected for alkaline phosphatase (ALP) activity measurement, as previously described, but with slight modifications. Briefly, cells were lysed by heat shock and collected in ALP buffer (1 M diethanolamine, 0.24 M MgCl2, pH 9.8). After addition of 4-nitrophenyl phosphate disodium salt hexahydrate, the enzymatic reaction was monitored at 405 nm. Michaelis-Menten kinetics were evaluated for 30 minutes at 30°C. max ALP activity was used as a proxy. Activity values were normalized by protein content measured via the Pierce BCA Protein Assay Kit (ThermoFisher Scientific) according to the manufacturer’s instructions.

[0230] Reverse transcription and quantitative PCR (qPCR)

[0231] MC3T3-E1 subclone 4 cells were differentiated for 21 days (in DM without ascorbic acid except for the positive control) or 28 days (in DM with ascorbic acid). Cells were then collected for gene expression analysis. RNA was extracted using the RNeasy plus mini kit (Qiagen; Hilden, Germany) with QIAcube (Qiagen) according to the manufacturer’s instructions. Briefly, cells were lysed in RLT buffer and centrifuged in a QIAshredder column (Qiagen), then processed by QIAcube. RNA concentration was measured using DropSense96 (TRINEAN, Gentbrugge, Belgium).

[0232] Example 2 - Promoting vitamin K2 production in the gastrointestinal tract

[0233] cDNA was synthesized using a high-capacity cDNA reverse transcription kit (AppliedBiosystems; Waltham, Massachusetts, USA) according to the manufacturer's instructions. In short, 0.7 µg of RNA was mixed into the kit components and reverse transcribed using the following procedure: 25°C for 10 min, 37°C for 120 min, and 85°C for 5 min. The cDNA was diluted 7-fold with RNase-free water and used for qPCR using the LightCycler 1536 DNA Green Master kit (Roche; Basel, Switzerland) according to the manufacturer's instructions. In short, cDNA was diluted 7-fold in a solution containing the master mixture, BrightGreen, and DNA primers targeting osteocalcin (Ocn) and β-2-microglobulin (B2m, the housekeeping gene). These DNA primers had the following nucleotide sequences: Ocn-f ACCATCTTTCTGCTCACTCTG, Ocn-rGTTCACTACCTTATTGCCCTCC, B2m-f CACTGACCGGCCTGTATGCT, and B2m-rGTATGTTCGGCTTCCCATTCTC. The reaction was run in a LightCycler 480 II (Roche) using the following procedure: 40 cycles of 7 min at 95°C, 1 sec at 95°C, and 30 sec at 60°C. Methods were used to assess relative gene expression.

[0234] Figure 3

[0235] To assess intestinal production of vitamin K2, the Human Microbiome Ecosystem Simulator (SHIME) was used. ® (See Van de Wiele, T. et al., 2015. The Impact of Food Bioactives on Health: in vitro and ex vivo models, pp. 305-317). SHIME assays typically consist of colonic fermentation of selected amounts of the test compound under simulated conditions representing the gastrointestinal tract of the subject. The yield of methylnaphthoquinone-7 was determined by supercritical fluid chromatography-tandem mass spectrometry (SFC-MS / MS).

[0236] For this group of experiments, a two-stage batch system simulating upper gastrointestinal (upper GIT, stomach, and small intestine) and colonic conditions was used as a simplified SHIME. ® The system. These studies used cow's milk-based infant beverages containing minerals appropriate for the age group, also known as infant formula milk.

[0237] To mimic the absorption processes occurring in the infant small intestine, a dialysis approach was applied by using a cellulose membrane with a 14 kDa cut-off. By introducing the small intestine suspension into the dialysis membrane, molecules such as digested amino acids, sugars, micronutrients and minerals are gradually removed from the upper gastrointestinal matrix.

[0238] Furthermore, during the 1 hour incubation period, the pH was gradually decreased from 5.5 to 3.0 during the gastric incubation period to mimic the infant’s gastric pH. In addition, during the first 30 minutes of the small intestine incubation (duodenum), a fixed pH of 4.5 was implemented to enable optimal absorption of available minerals. In the subsequent small intestine phase (jejunum + ileum) for 145 minutes, a pH of 7 was introduced. The milk matrix after exposure to gastric and small intestine conditions was transferred to the colon chamber containing the infant fecal sample.

[0239] Fresh fecal matter was collected from a 12-month-old infant donor. A fecal suspension was prepared and mixed with a protective agent. At the start of the short-term colon incubation, test ingredients (see below) were added to the sugar-depleted nutrient medium containing the basic nutrients present in the colon (e.g. host-derived glycine, such as mucin).

[0240] The following groups (test ingredients) were evaluated (in the absence of a milk matrix): blank; and HMO + BMO (7.2 g / L in total). The composition of the HMO and BMO is shown in the table below:

[0241]

[0242] It was shown that a mixture of HMO + BMO can promote vitamin K2 production in the gastrointestinal tract (see Figure 3 A). In addition, it was shown that in the milk matrix, the addition of Lactobacillus rhamnosus LPR (4.5 x 10 7 cfu / ml) can further increase the vitamin K2 production in the gastrointestinal tract by about 40% (see Example 3 B).

[0243] Figure 4

[0244] The preclinical experimental setup is shown in Figure 5 .

[0245] The microarchitecture of the distal metaphysis of the femur was assessed using micro computed tomography (µCT UCT35, Scanco Medical AG, Basserdorf, Switzerland) as previously described (N. Bonnet, J. Brun, J.C. Rousseau, L.T. Duong, S.L. Ferrari, Cathepsin K Controls Cortical Bone Formation by Degrading Periostin, J. Bone Miner. Res., 2017, 32(7): 1432-1441). Briefly, the trabecular bone region was evaluated using isotropic 6 pm voxels. To eliminate the main cancellous, the 30 slices under the distal growth plate were not considered. The 80 slices of secondary cancellous directly underneath were analyzed. Using a direct three-dimensional technique that does not rely on previous assumptions about the underlying structure, morphometric variables were calculated from binary images (N. Bonnet, N. Laroche, L. Vico, E. Dolleans, D. Courteix, C.L. Benhamou, Assessment of trabecular bone microarchitecture by two different x-ray microcomputed tomographs: a comparative study of the rat distal tibia using Skyscan and Scanco devices, Med. Phys., 2009, 36(4): 1286-97). The BV / TV fraction (%) and the connectivity density (Conn.D) were evaluated.

[0246] As Figure 5 A and Embodiments As can be seen in AB, the synbiotic [BMOS + Lactobacillus rhamnosus (LPR)] + vit.K1 AD promotes bone mass by increasing the trabecular femur volume (BV / TV). The connectivity density (Conn.D) increases with vit.K1 AD and even more when combined with the synbiotic.

[0247] ​

[0248] Various preferred features and embodiments of the present application will now be described with reference to the following numbered paragraphs (paragraphs).

[0249] 1. A combination of a vitamin mixture and an oligosaccharide mixture for use in enhancing bone growth and / or bone strength in a young child or adolescent subject, wherein the vitamin mixture comprises or consists of vitamin Kl, vitamin A and vitamin D, and wherein the oligosaccharide mixture comprises or consists of bovine milk oligosaccharides (BMOs).

[0250] 2. The combination for use according to paragraph 1, wherein vitamin Kl is administered to the subject in an amount of about 5 pg / day to about 200 pg / day.

[0251] 3. The combination for use according to paragraph 1 or 2, wherein vitamin A is administered to the subject in an amount of about 100 pg RE / day to about 1000 pg RE / day.

[0252] 4. The combination for use according to any preceding paragraph, wherein vitamin D is administered to the subject in an amount of about 2.5 pg / day to about 100 pg / day.

[0253] 5. The combination for use according to any preceding paragraph, wherein the oligosaccharide mixture comprises BMOs in an amount of about 80 wt% to about 100 wt% relative to the total weight of the oligosaccharide mixture.

[0254] 6. The combination for use according to any preceding paragraph, wherein the oligosaccharide mixture further comprises one or more human milk oligosaccharides (HMOs).

[0255] 7. The combination for use according to paragraph 6, wherein the one or more HMOs comprise or consist of at least one sialylated oligosaccharide, at least one fucosylated oligosaccharide and / or at least one N-acetylated oligosaccharide.

[0256] 8. The combination for use according to paragraph 7, wherein the at least one sialylated oligosaccharide is selected from the group consisting of 3’-sialyllactose (3’-SL), 6’-sialyllactose (6’-SL), sialyllactose-N-tetraose b (LSTb), sialyllactose-N-tetraose c (LSTc), disialyllactose-N-tetraose and combinations thereof, preferably wherein the at least one sialylated oligosaccharide is selected from 3’-sialyllactose (3’-SL), 6’-sialyllactose (6’-SL) and combinations thereof.

[0257] 9. The combination for use according to paragraph 7 or 8, wherein the at least one fucosylated oligosaccharide is selected from the group consisting of 2’-fucosyllactose (2’FL), 3-fucosyllactose (3FL), difucosyllactose (diFL), lacto-N-fucopentaose-I (LNFP-I), lacto-N-fucopentaose-II (LNFP-II), lacto-N-fucopentaose-III (LNFP-III), lacto-N-fucopentaose-V (LNFP-V), lacto-neofucopentaose V (LNnFP-V), lacto-N-difucohexaose-I (LNDFH-1), lacto-N-neodifucohexaose (LNnDFH), monofucosyllacto-N-hexaose-III (MFNLH-III), difucosyllacto-N-hexaose-a (DFLNHa), and combinations thereof, preferably wherein the at least one fucosylated oligosaccharide is 2’-fucosyllactose (2’FL) and / or difucosyllactose (diFL).

[0258] 10. The combination for use according to any one of paragraphs 7 to 9, wherein the at least one N-acetylated oligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof, preferably wherein the at least one N-acetylated oligosaccharide is selected from lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof.

[0259] 11. The combination for use according to any preceding paragraph, wherein the oligosaccharide mixture comprises:

[0260] (a) about 0.5% to about 2% by weight of at least one sialylated oligosaccharide relative to the total weight of the oligosaccharide mixture;

[0261] (b) about 2% to about 6% by weight of at least one fucosylated oligosaccharide relative to the total weight of the oligosaccharide mixture; and / or

[0262] (c) about 1% to about 4% by weight of at least one N-acetylated oligosaccharide relative to the total weight of the oligosaccharide mixture.

[0263] 12. The combination for use according to any preceding paragraph, wherein the oligosaccharide mixture is administered to the subject in a total amount of about 0.5 g / day to about 10 g / day.

[0264] 13. The combination for use according to any preceding paragraph, wherein BMO is administered to the subject in a total amount of about 0.5 g / day to about 10 g / day.

[0265] 14. The combination for use according to any preceding paragraph, wherein the combination further comprises one or more probiotic bacteria.

[0266] 15. The combination for use according to paragraph 14, wherein the one or more probiotic bacteria comprises or consists of Lactobacillus rhamnosus.

[0267] 16. The combination for use according to paragraph 15, wherein Lactobacillus rhamnosus is administered to the subject in a total amount of about 10 6 cfu / day to about 10 12 cfu / day.

[0268] 17. The combination for use according to any one of paragraphs 14 to 16, wherein the one or more probiotic bacteria comprises Bifidobacterium longum and / or Bifidobacterium infantis.

[0269] 18. The combination for use according to any preceding paragraph, wherein the combination is provided in the form of a nutritional composition.

[0270] 19. The combination for use according to any preceding paragraph, wherein the combination is provided in the form of a medical food product for clinical nutrition.

[0271] 20. The combination for use according to any preceding paragraph, wherein the combination is provided in the form of a growing-up milk.

[0272] 21. The combination for use according to any one of paragraphs 18 to 20, wherein the composition comprises vitamin Kl in an amount of about 5 pg / 100 g to about 200 pg / 100 g on a dry weight basis.

[0273] 22. The combination for use according to any one of paragraphs 18 to 21, wherein the composition comprises vitamin A in an amount of about 100 pg RE / 100 g to about 1000 pg RE / 100 g on a dry weight basis.

[0274] 23. The combination for use according to any one of paragraphs 18 to 22, wherein the composition comprises vitamin D in an amount of about 2.5 pg / 100 g to about 100 pg / 100 g on a dry weight basis.

[0275] 24. The combination for use according to any one of paragraphs 18 to 23, wherein the composition comprises an oligosaccharide mixture in a total amount of about 0.5 wt% to about 5 wt% on a dry weight basis.

[0276] 25. The combination for use according to any one of paragraphs 18 to 24, wherein the composition comprises BMO in a total amount of about 0.5 wt% to about 5 wt% based on dry weight.

[0277] 26. The combination for use according to any one of paragraphs 18 to 25, wherein the composition comprises Lactobacillus rhamnosus in an amount of about 10 6 cfu / 100g to about 10 12 cfu / 100g per 100g based on dry weight.

[0278] 27. The combination for use according to any preceding paragraph, wherein the subject is a human.

[0279] 28. The combination for use according to any preceding paragraph, wherein the subject is about 1 year or older, preferably wherein the subject is about 1 year to about 3 years.

[0280] 29. The combination for use according to any one of paragraphs 1 to 26, wherein the subject is an animal, preferably wherein the animal is a pet.

[0281] 30. The combination for use according to any preceding paragraph, wherein the subject has and / or is suffering from stunted growth and / or growth faltering.

[0282] 31. The combination for use according to any preceding paragraph, wherein the subject is preterm or has low birth weight or experiences intrauterine growth retardation.

[0283] 32. The combination for use according to any preceding paragraph, wherein the combination is administered by oral administration.

[0284] 33. The combination for use according to any preceding paragraph, wherein the combination is administered alone, simultaneously or sequentially, preferably wherein the combination is administered simultaneously.

[0285] 34. The combination for use according to any preceding paragraph, wherein the combination synergistically enhances bone growth and / or bone strength.

[0286] 35. The combination for use according to any preceding paragraph, wherein the combination enhances bone mineralization.

[0287] 36. The combination for use according to any preceding paragraph, wherein the combination promotes osteoblast mineralization and / or osteoblast differentiation.

[0288] 37. The combination for use according to any preceding paragraph, wherein the combination increases vitamin K2 production.

[0289] 38. The combination for use according to any preceding paragraph, wherein the combination improves one or more bone parameters selected from the group consisting of: bone mineral density (BMD), trabecular bone volume fraction (BV / TV), cortical bone volume (Ct.BV), and bone ultimate force (FMax).

[0290] 39. The combination for use according to any preceding paragraph, wherein the combination promotes catch-up growth, preferably wherein catch-up growth is determined using height velocity.

[0291] 40. Use of a combination of a vitamin mixture and an oligosaccharide mixture in the manufacture of a medical food product for use in enhancing bone growth and / or bone strength in a young child or adolescent subject, wherein the vitamin mixture comprises or consists of vitamin Kl, vitamin A, and vitamin D, and wherein the oligosaccharide mixture comprises or consists of bovine milk oligosaccharides (BMOs).

[0292] 41. A method for enhancing bone growth and / or bone strength in a young child or adolescent subject, the method comprising administering to the subject an effective amount of a combination of a vitamin mixture and an oligosaccharide mixture, wherein the vitamin mixture comprises or consists of vitamin Kl, vitamin A, and vitamin D, and wherein the oligosaccharide mixture comprises or consists of bovine milk oligosaccharides (BMOs).

[0293] 42. Use of an oligosaccharide mixture in promoting vitamin K2 production in the gut of a subject, wherein the oligosaccharide mixture comprises or consists of bovine milk oligosaccharides (BMOs).

[0294] 43. The use according to paragraph 42, wherein the oligosaccharide mixture comprises BMOs in an amount of from about 80% to about 100% by weight relative to the total weight of the oligosaccharide mixture.

[0295] 44. The use according to paragraph 43, wherein the oligosaccharide mixture further comprises one or more human milk oligosaccharides (HMOs).

[0296] 45. The use according to paragraph 44, wherein the one or more HMOs comprise or consist of at least one sialylated oligosaccharide, at least one fucosylated oligosaccharide, and / or at least one N-acetylated oligosaccharide.

[0297] 46. The use according to paragraph 45, wherein the at least one sialylated oligosaccharide is selected from the group consisting of 3'-sialyllactose (3'-SL), 6'-sialyllactose (6'-SL), sialyllactose-N-tetraose b (LSTb), sialyllactose-N-tetraose c (LSTc), disialyllactose-N-tetraose, and combinations thereof, preferably wherein the at least one sialylated oligosaccharide is selected from 3'-sialyllactose (3'-SL), 6'-sialyllactose (6'-SL), and combinations thereof.

[0298] 47. The use according to paragraph 45 or 46, wherein the at least one fucosylated oligosaccharide is selected from the group consisting of 2'-fucosyllactose (2'FL), 3-fucosyllactose (3FL), difucosyllactose (diFL), lacto-N-fucopentaose-I (LNFP-I), lacto-N-fucopentaose-II (LNFP-II), lacto-N-fucopentaose-III (LNFP-III), lacto-N-fucopentaose-V (LNFP-V), lacto- neofucopentaose V (LNnFP-V), lacto-N-difucohexaose-I (LNDFH-1), lacto-N-neodifucohexaose (LNnDFH), monofucosyllacto-N-hexaose-III (MFNLH-III), difucosyllacto-N-hexaose-a (DFLNHa), and combinations thereof, preferably wherein the at least one fucosylated oligosaccharide is 2'-fucosyllactose (2'FL) and / or difucosyllactose (diFL).

[0299] 48. The use according to any one of paragraphs 45 to 47, wherein the at least one N- acetylated oligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof, preferably wherein the at least one N-acetylated oligosaccharide is selected from lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT), and combinations thereof

[0300] 49. The use according to any one of paragraphs 42 to 48, wherein the oligosaccharide mixture comprises:

[0301] (a) about 0.5% to about 2% by weight of at least one sialylated oligosaccharide relative to the total weight of the oligosaccharide mixture;

[0302] (b) about 2% to about 6% by weight of at least one fucosylated oligosaccharide relative to the total weight of the oligosaccharide mixture; and / or

[0303] (c) about 1 wt% to about 4 wt% of at least one N-acetylated oligosaccharide relative to the total weight of the oligosaccharide mixture.

[0304] 50. The use according to any one of paragraphs 42 to 49, wherein the oligosaccharide mixture is administered to the subject in a total amount of about 0.5 g / day to about 10 g / day.

[0305] 51. The use according to any one of paragraphs 42 to 50, wherein BMO is administered to the subject in a total amount of about 0.5 g / day to about 10 g / day.

[0306] 52. The use according to any one of paragraphs 42 to 50, wherein the oligosaccharide mixture is administered in combination with one or more probiotic bacteria.

[0307] 53. The combination for use according to paragraph 52, wherein the one or more probiotic bacteria comprises or consists of Lactobacillus rhamnosus.

[0308] 54. The combination for use according to paragraph 53, wherein Lactobacillus rhamnosus is administered to the subject in a total amount of about 10 6 cfu / day to about 10 12 cfu / day.

[0309] 55. The combination for use according to any one of paragraphs 52 to 54, wherein the one or more probiotic bacteria comprises Bifidobacterium longum and / or Bifidobacterium infantis.

[0310] While the application has been described by way of example, it should be appreciated that modifications and additions can be made without departing from the scope of the application as defined in the claims. In addition, where known equivalents exist to specific features, such equivalents are incorporated as if specifically described herein.

Claims

1. A combination of a vitamin mixture and an oligosaccharide mixture, said combination being used to enhance bone growth and / or bone strength in infant or adolescent subjects, wherein said vitamin mixture comprises or consists of vitamin K1, vitamin A, and vitamin D, and wherein said oligosaccharide mixture comprises or consists of bovine milk oligosaccharides (BMO).

2. The combination for the purpose according to claim 1, wherein vitamin K1 is administered to the subject at an amount of about 5 µg / day to about 200 µg / day; vitamin A is administered to the subject at an amount of about 100 µg RE / day to about 1000 µg RE / day; and / or vitamin D is administered to the subject at an amount of about 2.5 µg / day to about 100 µg / day.

3. The combination for the purpose according to claim 1 or 2, wherein the oligosaccharide mixture comprises an amount of BMO of about 80% to about 100% by weight relative to the total weight of the oligosaccharide mixture.

4. The combination for the purpose according to any of the preceding claims, wherein the oligosaccharide mixture further comprises one or more human milk oligosaccharides (HMOs), preferably wherein the one or more HMOs comprise at least one sialylated oligosaccharide, at least one fucoidylated oligosaccharide and / or at least one N-acetylated oligosaccharide or composed thereof.

5. The combination for the purpose according to any of the preceding claims, wherein the oligosaccharide mixture is administered to the subject in a total amount of about 0.5 g / day to about 10 g / day.

6. The combination for the purpose according to any of the preceding claims, wherein the combination further comprises one or more probiotics.

7. The combination for the purpose according to claim 6, wherein the one or more probiotics comprise or consist of Lactobacillus rhamnosus.

8. The combination for the purpose according to any of the preceding claims, wherein the combination is provided in the form of a nutritional composition, and optionally wherein the combination is provided in the form of a growth milk.

9. The combination for the purpose according to any of the preceding claims, wherein the subject is a human being, preferably wherein the subject is about 1 year old or older, more preferably wherein the subject is about 1 year old to about 3 years old.

10. The combination for the purpose according to any one of claims 1 to 8, wherein the subject is an animal, preferably wherein the animal is a pet.

11. The combination for the purpose according to any of the preceding claims, wherein the subject has and / or is suffering from growth retardation and / or growth slowdown.

12. The combination for the purpose according to any of the preceding claims, wherein the combination is administered orally, preferably wherein the combination is administered simultaneously.

13. The combination for the purpose according to any of the preceding claims, wherein the combination promotes osteoblast mineralization and / or osteoblast differentiation.

14. The combination for the purpose according to any of the preceding claims, wherein the combination improves one or more bone parameters selected from: bone mineral density (BMD), trabecular bone volume fraction (BV / TV), cortical bone volume (Ct.BV), and bone ultimate force (FMax).

15. The combination for the purpose according to any of the preceding claims, wherein the combination promotes catch-up growth, preferably wherein catch-up growth is determined using height velocity.