Arcaban virus rescue construction method and application thereof

Abstract

The invention relates to the technical field of virus construction, and discloses an Acaban virus rescue construction method and application thereof, and the method comprises the following steps: designing primers aiming at three segments S, M and L of an Acaban virus genome, adding a T7 promoter sequence at the 5'terminal of an upstream primer, and adding a T7 terminator sequence at the 5 'terminal of a downstream primer; carrying out amplification on each gene segment of the Acaban virus by utilizing the primers; carrying out enzyme digestion on the plasmid containing the T7 promoter and terminator sequence to obtain a linearized plasmid; carrying out homologous recombination on the PCR product and the linearized plasmid to construct three recombinant plasmids; uniformly mixing the three recombinant plasmids, and co-transfecting cells for expressing T7 polymerase; culturing and collecting supernatant, inoculating BHK-21 cells, and carrying out continuous passage until cytopathic effect occurs, so as to obtain the rescued acarban virus. According to the invention, the accurate transformation of the viral genome is realized, and the virus rescue efficiency and the vaccine safety are improved.

Description

Technical Field

[0001] This invention relates to the field of virus construction technology, and more specifically, to an akaban virus rescue construction method and its application. Background Technology

[0002] Akabane virus (AKAV) is a member of the genus Ortho-Bunyavirus in the family Bunyaviridae. The virus particle is spherical, enveloped, and 90–100 nm in diameter. Its surface has glycoprotein spikes. The virus contains single-stranded RNA composed of three molecules: large, medium, and small, which, together with nucleocapsid proteins, form a helical nucleocapsid with a diameter of 2–3 nm. The virus contains four structural proteins: G1, G2, N, and L. G1 and G2 are glycoproteins with hemagglutinin activity and neutralizing antigen sites, determining viral virulence. N is a nucleoprotein with complement-binding antigen sites, and L is a polymerase protein with replication and transcription activities.

[0003] Akabane disease, also known as Akabane disease, is a viral infectious disease in cattle and sheep characterized by abortion, premature birth, stillbirth, fetal malformation, mummification, and the development of Arthrogryposis-Hydranencephaly Syndrome (AH syndrome) in newborn fetuses. Summary of the Invention

[0004] Akabane virus, a member of the Orthobniviridae family, has a high rate of genetic mutation and the ability to recombine with other strains in the same genus. Furthermore, akabane virus is present in low concentrations in infected bovine organ tissues and is easily degraded, making virus isolation extremely difficult and complicating the preparation of traditional vaccines.

[0005] Reverse genetics technology has the following advantages in the development of akaban virus vaccines: 1. Precision: It can precisely modify the viral genome to generate the desired attenuated or inactivated viral strains.

[0006] 2. High efficiency: Shortens the vaccine development cycle and enables rapid response to emerging or mutated viruses.

[0007] 3. Safety: Through precise genetic modification, the virulence of the vaccine strain is reduced, thereby improving the safety of the vaccine.

[0008] In summary, the high genetic mutation rate of akabanvirus, its low concentration in infected bovine organs and tissues, and its easy degradation pose significant challenges to the preparation of traditional vaccines. However, the emergence of reverse genetics technology offers an ideal solution for the development of akabanvirus vaccines. This technology can not only precisely modify the viral genome and rapidly generate attenuated or inactivated viral strains, shortening the vaccine development cycle, but also significantly improve vaccine safety. Through reverse genetics technology, we can expect to more effectively address the threat of akabanvirus and protect the healthy development of animal husbandry.

[0009] This invention provides a method for constructing an akaban virus rescue system and its application.

[0010] An akaban virus rescue construction method includes the following steps: Step 1: Design primers targeting the S, M, and L segments of the akabanvirus genome. Add a T7 promoter sequence to the 5' end of the upstream primer and a T7 terminator sequence to the 5' end of the downstream primer. Step 2: Amplify the gene segments of acaban virus using the primers described above; Step 3: Digest the plasmid containing the T7 promoter and terminator sequences with enzymes to obtain a linearized plasmid; Step 4: Perform homologous recombination between the PCR product amplified in Step 2 and the linearized plasmid obtained in Step 3 to construct three recombinant plasmids, S, M, and L. Step 5: Mix the three recombinant plasmids constructed in Step 4 and co-transfect them into cells expressing T7 polymerase; Step 6: Culture the transfected cells for 3 days and collect the cell culture supernatant; Step 7: Inoculate the supernatant from Step 6 into BHK-21 cells, culture and collect the culture supernatant; Step 8: Passage the collected culture supernatant continuously until cytopathic effects appear, and obtain the rescued akaban virus.

[0011] Preferably, the akaban virus in step 1 is derived from a virus strain isolated from the brain tissue of a diseased cow.

[0012] Preferably, the plasmid in step 3 is TVT7R.

[0013] Preferably, the three recombinant plasmids constructed in step 4 are TVT-S, TVT-M, and TVT-L.

[0014] Preferably, the cells expressing T7 polymerase in step 5 are BSR-T7 cells.

[0015] Preferably, homologous recombination in step 4 is performed using an Infusion kit.

[0016] Preferably, in step 8, the successful rescue of the virus is confirmed by qPCR detection.

[0017] Preferably, it also includes a step of confirming virus rescue by indirect immunofluorescence detection.

[0018] Preferably, indirect immunofluorescence detection uses a mouse anti-AKAV N protein monoclonal antibody as the primary antibody and a FITC-labeled goat anti-mouse secondary antibody as the secondary antibody.

[0019] An akaban virus rescued using the above method, which is used to prepare a vaccine against akaban virus.

[0020] The beneficial effects of this invention are as follows: This invention solves the technical problems of akaban virus's high genetic mutation rate, low content in infected bovine organs and tissues, and easy degradation, which make traditional vaccine preparation difficult. By establishing a reverse genetic system for akaban virus based on the T7 polymerase expression system, precise modification of the viral genome is achieved, improving the efficiency and success rate of virus rescue. This method can rapidly generate attenuated or inactivated virus strains, significantly shortening the vaccine development cycle and improving vaccine safety. The constructed reverse genetic system has wide applications, including: establishing vaccine vector technology platforms for the construction of live viral vector vaccines; constructing gene knockout attenuated vaccine strains; and conducting in-depth research on viral pathogenesis mechanisms. This invention provides a stable, reliable, and efficient method for rescuing akaban virus, offering technical support for the prevention and control of diseases caused by akaban virus in cattle and sheep, such as abortion, premature birth, stillbirth, and fetal malformations. Attached Figure Description

[0021] Figure 1 This invention relates to the qPCR method for isolating viruses; Figure 2 This is the acaban virus phylogenetic tree of the present invention; Figure 3 The present invention uses gel electrophoresis to display the sizes of S, M, and L on plasmids; Figure 4 This invention is an akaban virus-specific CPE; Figure 5 The acaban virus of this invention is obtained via qPCR; Figure 6 This invention relates to the indirect immunofluorescence of acaban virus; Figure 7 This invention relates to an electron microscope for the acarban virus; Figure 8 These are autopsy images of dead suckling mice from this invention. Figure 9 This invention relates to HE-coated bovine brain slices after viral challenge; Figure 10 This is a HE section of bovine lung after challenge with the present invention; Figure 11 This invention relates to HE-coated bovine liver sections after challenge with the virus; Figure 12 This invention relates to HE-coated sections of bovine lymph nodes after viral challenge; Figure 13 This is a HE section of bovine spleen after challenge with the virus, according to the present invention. Figure 14 This is a line graph showing the status of neutralizing antibodies after immunization according to the present invention. Detailed Implementation

[0022] The subject matter described herein will now be discussed with reference to exemplary embodiments. It should be understood that these embodiments are discussed only to enable those skilled in the art to better understand and implement the subject matter described herein, and changes may be made to the function and arrangement of the elements discussed without departing from the scope of this specification. Various processes or components may be omitted, substituted, or added as needed in the examples. Furthermore, some features described in the examples may be combined in other examples.

[0023] Example 1: Identification and whole-genome sequencing of AKAV strains 1. Experimental Materials and Methods 1.1 Pathological materials The pathogenic material was brain tissue collected from newborn calves at a beef cattle farm in Jilin Province. BHK-21 cells were preserved by the Ruminant Animal Disease Early Warning and Control Technology Innovation Team of the Chinese Academy of Agricultural Sciences.

[0024] 1.2 Main Reagents RNAprep Pure Animal Tissue Total RNA Extraction Kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; the HiScript III All-in-one RT SuperMix Perfect for qPCR and the qPCR enzyme BioSmart U+ Super Multiple Probe qPCR PreMix (ONE TUBE) were purchased from Novizan.

[0025] 1.3 Virus isolation The pathological samples and DMEM were ground in a mortar at a mass-to-volume ratio of 1:3. After grinding, the samples were repeatedly frozen and thawed 3 times, centrifuged at 8000 rpm for 8 min, and the supernatant was filtered through a 0.22 μm filter.

[0026] 1.4 Viral RNA Extraction and Reverse Transcription RNA was extracted and reverse transcribed into cDNA according to the instructions of the viral RNA extraction kit and reverse transcription kit.

[0027] 1.5 qPCR The isolated virus was detected using the qPCR method established in the inventor's laboratory.

[0028] 1.6 Sequencing and Analysis Viral RNA was extracted using a viral RNA extraction kit, stored on dry ice, and then sent for sequencing. Genetic evolution analysis of the sequences was performed using MEGA11.

[0029] 2. Experimental Results The experimental results showed that qPCR exhibited a clear amplification curve (see...). Figure 1 ), The complete viral genome was obtained through bioengineering sequencing, and the virus was named JL / 21 / 01. The complete viral genome is as follows: S gene sequence AGTAGTGAACTCCACTATTAACTACGCATTGCAATGGCAAATCAATTCATTTTCAACGATGTTCCACAACGGAATGCAGCTACATTTAATCCGGATGCAGGGTATGTGGCATTTATCAGTAAGTATGGGCAGCAGCTCAACTTTACTGTTGCTAGAGTCTTCTTCCTCAACCAGAAGAAGGCCAAGATGGTCTTACATAAGACGCCACAACCAAGTGTCGATCTTACTTTTGCAGGGGTCAAATTTACAGTGGTTAATAACCATTTCCCCCAGTACACTGCAAATCCAGTGTCAGACACTGCCTTTACGCTCCATCGCATCTCGGGCTACTTAGCTCGCTGGGTTGCTGAGCAGTGCAAGGCTAATCAGATCAAATTTGCAGAGGCAGCTGCCACAATTGTGATGCCGCTGGCTGAGGTGAAGGGTTGCACCTGGAGTGACGGGTATGCAATGTACCTGGGATTTGCCCCTGGTGCTGAGATGTTTCTGGAAACCTTTGAGTTTTACCCACTGGTTATCGACATGCACCGTGTGATAAAGGATGGGATGGATGTCAACTTCATGAGGAAGGTCTTACGCCAGAGGTATGGGCAGCTGACTGCAGAAGAGTGGATGACATCTAAGTTGGACGCAGTCAAGGCTGCATTTGGCTCAGTTGCCCAGATATCCTGGGCTAAATCTGGCTTCTCACCTGCAGCTAGAGCTTTCCTGGCTCAATTTGGTATCCAGATCTAATCTTAACTGATTCTCCAGTTTTCTTTCTTCTCTTCCTAAGTGCACCATGTCTATGTGGTGCACACCTTTGTTCAGCTGCTTGGATTTTATTGTTTATAGTTAATTAGTGGAGAACACTACT M gene sequence L gene sequence Based on N gene sequence analysis, this strain is type 1b (see...). Figure 2 ).

[0030] Example 2: Construction and identification of recombinant plasmids for three gene segments of AKAV JL / 21 / 01 1. Experimental Materials and Methods 1.1 Virus strain, plasmid and gene sequence The AKAV strain JL / 21 / 01 was isolated and preserved by the Institute of Special Animals and Plant Protection, Chinese Academy of Agricultural Sciences; the plasmid TVT7R was preserved by the Ruminant Disease Early Warning and Prevention Technology Innovation Team of the Institute of Special Animals and Plant Protection, Chinese Academy of Agricultural Sciences.

[0031] 1.2 Primer Design and Synthesis Primers were designed based on the accurate 5' and 3' end sequences of each gene segment of the strain. A T7 promoter sequence was added to the 5' end of each upstream primer, and a T7 terminator sequence was added to the 5' end of each downstream primer.

[0032] 1.3 Construction of recombinant plasmids Primers designed and synthesized in section 1.2 were used to amplify various gene segments of the virus strain. The plasmid TVT7R was digested with enzymes to remove the original cloned genes and linearize it. Homologous recombination was performed on the purified PCR product and the linearized plasmid using an Infusion kit to construct the recombinant plasmid.

[0033] 1.4 PCR Identification Primers were identified by PCR using primers for the S, M, and L genes.

[0034] 2. Experimental Results The experimental results showed that the three recombinant plasmids were named TVT-S, TVT-M, and TVT-L, respectively. Gel electrophoresis showed that the sizes of S, M, and L on the plasmids were correct (see...). Figure 3 By sequencing each recombinant plasmid, it was confirmed that all plasmids were successfully constructed.

[0035] Example 3: Construction and application of the reverse genetics operating system for AKAV JL / 21 / 01 strain 1. Experimental Materials and Methods 1.1 Cell lines used in experiments BHK-21 and BSR-T7 cells were preserved by the Ruminant Disease Early Warning and Prevention Technology Innovation Team of the Chinese Academy of Agricultural Sciences.

[0036] 1.2 Rescue of the parent virus strain The three plasmids, TVT-S, TVT-M, and TVT-L, were mixed thoroughly. Using Lipo2000 transfection reagent, the three plasmids were co-transfected into BSR-T7 cells. After 3 days of cell culture, the supernatant was collected and inoculated into BHK-21 cells cultured for 48 hours. The cells were incubated at 37°C for 1 hour. The adsorption buffer was discarded, and DMEM maintenance medium containing 2% fetal bovine serum was added. The cells were then incubated at 37°C in a 5% CO2 incubator, and observed daily. Virus was harvested after 3 days. Blind passage was continued using the above method until cytopathic effect (CPE) reached 75%, at which point the virus was harvested.

[0037] 1.3 Identification of the virus for rescue CPE appeared after 5 consecutive passages using the method in 1.2 (Figure 4). qPCR identification showed significant amplification curves for virus P2-P8. Figure 5 ).

[0038] 1.4 Indirect immunofluorescence Virus solution was inoculated into 6-well plates containing BHK-21 cells according to the inoculation method described in section 1.2, with positive and negative controls included. After incubation in maintenance medium for 48 hours, the maintenance medium was discarded, and the cells were washed three times with PBST. 200 μl of pre-chilled 95% anhydrous ethanol was added to each well, and the plates were fixed at room temperature for 20 min. The anhydrous ethanol was discarded, and the plates were air-dried. A 1:100 dilution of mouse anti-AKAV N protein monoclonal antibody was added to each well. The plates were incubated at 37°C for 1 hour, washed three times with PBST, and then a 1:200 dilution of FITC-labeled goat anti-mouse secondary antibody was added. The plates were incubated at 37°C for 1 hour, the secondary antibody was discarded, and the plates were washed three more times with PBST. Observation was performed using an inverted fluorescence microscope.

[0039] 1.5 Negative staining and electron microscopic observation of virus particles Collect the cell culture supernatant, centrifuge at 3000 rpm for 20 min, and discard the precipitate. Centrifuge the supernatant at 12000 rpm for 20 min, stain with phosphotungstic acid, and observe under an electron microscope.

[0040] 2. Experimental Results The experimental results showed that after two freeze-thaw cycles, the transfected cell culture was inoculated into BHK-21 cells, and after five consecutive passages, acabanvirus-specific CPE (Cellular Precipitation) was observed. Figure 4 ), via qPCR ( Figure 5 ), indirect immunofluorescence ( Figure 6 ) and electron microscope ( Figure 7 The AKAV JL / 21 / 01 strain was successfully rescued and named rAKAV-JL / 21 / 01.

[0041] The applications of the reverse genetic system based on AKAV virus are mainly reflected in: (1) the establishment of vaccine vector technology platform and its application in the construction of live viral vector vaccines; (2) the construction of gene knockout attenuated strain vaccines; and (3) the study of viral pathogenesis mechanisms.

[0042] Example 4: Pathogenicity of rAKAV in animals 1. Pathogenicity of rAKAV in mice Three-day-old suckling mice were divided into two groups of 10 each. One group was injected with 100 μL of rAKAV (P4) and the other with 100 μL of the supernatant from three freeze-thaw cycles of Vero cells (control group). Four days after injection, five suckling mice in the 100 μL rAKAV (P4) group died, and five days after injection, the remaining five mice died. No mice died in the control group. See [link to relevant documentation]. Figure 8 Autopsy images of dead suckling mice.

[0043] 2. Pathogenicity of rAKAV in cattle Four-month-old calves were divided into two groups of five each. One group received a subcutaneous injection in the neck of rAKAV (P10), while the other group received a subcutaneous injection of 10 mL of the supernatant from three freeze-thaw cycles of Vero cells (control group). Neither the challenge group nor the control group showed any clinical symptoms after injection. Twenty-eight days after injection, two calves from the challenge group and one calf from the control group were randomly culled, and their organs were harvested for pathological examination.

[0044] Figure 9 HE section of bovine brain after challenge. Note: The cerebral cortex has a rich number of neurons that are evenly distributed. A small number of neurons are shrunken (black arrows), with reduced cell volume, irregular shape, unclear nucleus-cytoplasm boundary, and darker staining. Perivascular edema is occasionally seen (blue arrows).

[0045] Figure 10 HE section of bovine lung after challenge. Note: A small number of granulocytes infiltrated the alveolar walls of the lung tissue (orange arrow), with extensive alveolar wall thickening, widening of alveolar septa, alveoli of varying sizes, and compensatory dilation of many alveoli (black arrow). Necrotic cell fragments were occasionally seen (purple arrow).

[0046] Figure 11 HE section of bovine liver after challenge. Note: The liver lamina are neatly and regularly arranged, with extensive mild hepatocyte edema (blue arrow), loose and lightly stained cytoplasm, occasional punctate necrosis of hepatocytes (purple arrow), and fragmented nuclei; occasional focal infiltration of lymphocytes around the portal area (orange arrow); no obvious compression or dilation of the hepatic sinusoids.

[0047] Figure 12HE section of bovine lymph nodes after challenge. Note: The lymph node structure is disordered, with a lot of connective tissue hyperplasia (green arrow). Lymphocytes are separated and surrounded by collagen fibers into several regions of different sizes. Lymphocytes in the medium range are loosely arranged (gray arrow). Occasionally, brownish-yellow pigment deposition is seen (brown arrow).

[0048] Figure 13 HE section of bovine spleen after challenge. Note: The spleen tissue consists of red pulp, white pulp, and marginal zone. The white pulp is composed of lymphatic sheath and lymphoid structures around the central artery. The structure is clear, and occasional lymphocyte necrosis (purple arrow) and nucleus fragmentation are observed. The red pulp is composed of splenic cords and splenic sinusoids. It is clearly demarcated from the white pulp. A very small number of granulocytes are infiltrated in the red pulp and marginal zone (orange arrow), and a small amount of brownish-yellow pigment deposition (brown arrow).

[0049] The results show that akaban virus mainly targets the central nervous system (especially motor neurons and the cerebral cortex), but systemic infection can spread to the liver, lungs, and lymphatic tissues.

[0050] 3. Immunogenicity of rAKAV inactivated vaccine Take 200 mL of P10 rAKAV and add 200 μL of β-propiolactone at a ratio of 1:1000. Inactivate the vaccine at 4℃ for 48 h, shaking well every 3 h. After 48 h, inactivate the vaccine at 37℃ for 1 h. Prepare a vaccine by mixing the inactivated P10 rAKAV with Sepik 15A adjuvant. Administer 10 ml per head intramuscularly to immunize cattle. Collect blood samples at 3, 7, 15, 22, 34, 41, 50, and 63 days post-immunization to detect neutralizing antibodies and plot neutralizing antibody curves.

[0051] Figure 14 Neutralizing antibody status after immunization. Note: 1 and 2 refer to cow No. 1 and cow No. 2, respectively; PID: number of days after immunization.

[0052] In summary, rAKAV exhibited high pathogenicity in the suckling mouse model: 5 suckling mice died 4 days after challenge, and all mice in the challenge group died 5 days after challenge. In the calf model, histopathological analysis showed that rAKAV caused neuronal damage and edema, viral interstitial pneumonia, hepatic cell edema and punctate lesions, a strong immune response in immune organs (spleen and lymph nodes), and renal tubular damage. It produced high titers of neutralizing antibodies after immunization, demonstrating good immunogenicity.

[0053] The embodiments of the present invention have been described above. However, the embodiments are not limited to the specific implementation methods described above. The specific implementation methods described above are merely illustrative and not restrictive. Those skilled in the art can make more equivalent embodiments under the guidance of the present embodiments, and all of them are within the protection scope of the present embodiments.

Claims

1. A method for constructing an akaban virus rescue system, characterized in that, Includes the following steps: Step 1: Design primers targeting the S, M, and L segments of the akabanvirus genome. Add a T7 promoter sequence to the 5' end of the upstream primer and a T7 terminator sequence to the 5' end of the downstream primer. Step 2: Amplify the gene segments of acaban virus using the primers described above; Step 3: Digest the plasmid containing the T7 promoter and terminator sequences with enzymes to obtain a linearized plasmid; Step 4: Perform homologous recombination between the PCR product amplified in Step 2 and the linearized plasmid obtained in Step 3 to construct three recombinant plasmids, S, M, and L. Step 5: Mix the three recombinant plasmids constructed in Step 4 and co-transfect them into cells expressing T7 polymerase; Step 6: Culture the transfected cells for 3 days and collect the cell culture supernatant; Step 7: Inoculate the supernatant from Step 6 into BHK-21 cells, culture and collect the culture supernatant; Step 8: Passage the collected culture supernatant continuously until cytopathic effects appear, and obtain the rescued akaban virus.

2. The method for constructing akaban virus rescue according to claim 1, characterized in that, The akaban virus in step 1 was derived from a virus strain isolated from the brain tissue of a diseased cow.

3. The method for constructing akaban virus rescue according to claim 1, characterized in that, The plasmid used in step 3 is TVT7R.

4. The method for constructing akaban virus rescue according to claim 1, characterized in that, The three recombinant plasmids constructed in step 4 are TVT-S, TVT-M, and TVT-L.

5. The method for constructing akaban virus rescue according to claim 1, characterized in that, The cells expressing T7 polymerase in step 5 are BSR-T7 cells.

6. The method for constructing akaban virus rescue according to claim 1, characterized in that, Homologous recombination in step 4 was performed using the Infusion kit.

7. The method for constructing akaban virus rescue according to claim 1, characterized in that, In step 8, the successful rescue of the virus was confirmed by qPCR testing.

8. The method for constructing akaban virus rescue according to claim 1, characterized in that, It also includes a step of confirming virus rescue through indirect immunofluorescence detection.

9. The method for constructing akaban virus rescue according to claim 8, characterized in that, Indirect immunofluorescence assay used a mouse anti-AKAV N protein monoclonal antibody as the primary antibody and a FITC-labeled goat anti-mouse secondary antibody as the secondary antibody.

10. An akaban virus rescued using the method according to any one of claims 1-10, characterized in that, The acaban virus is used to prepare a vaccine against acaban virus.

Images