Methods of treating muscular atrophic diseases using MBV

Abstract

Disclosed are methods of treating muscular atrophy diseases, such as spinal muscular dystrophy or muscular dystrophy, using matrix-bound vesicles (MBV). Compositions for the treatment of muscular atrophic diseases are also disclosed.

Description

Cross Reference to Related Applications

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 502,751, filed May 17, 2023, which is incorporated by reference herein in its entirety. TECHNICAL FIELD

[0002] The present disclosure relates to the field of treatment of muscle atrophy conditions, in particular, treatment of muscle atrophy conditions, such as muscular dystrophy or spinal muscular atrophy, using extracellular matrix (ECM)-bound nanovesicles (MBVs).

[0003] SEQUENCE LISTING The contents of the sequence listing (sequence listing.xml, size: 3,760 bytes, created on May 1, 2024) are incorporated herein by reference in their entirety.

[0004] BACKGROUND Muscle strength loss and tissue degradation affect numerous people. In particular, atrophy involves the wasting or deterioration of an organ, tissue, or body part, often due to disease, injury, or lack of use. There are multiple types of atrophy known to exist. Primary diseases include muscle atrophy, which is the wasting or loss of muscle tissue; multiple system atrophy, which is a neurodegenerative disorder associated with brain nerve cell degeneration; and spinal muscular atrophy, which affects the spinal cord and nerves. Diseases that generally cause or result in atrophy affect one or more muscles in the human body. Similarly, dystrophic conditions are also generally caused by disease and have essentially the same effect as atrophy of muscle.

[0005] Muscular dystrophy is a diverse group of inherited neuromuscular diseases that represents a class of devastating neuromuscular diseases characterized by primary or secondary skeletal muscle impairment. Duchenne muscular dystrophy (DMD) is an X-linked disease and the most common form of muscular dystrophy. DMD affects 1 in 3500 live-born boys and patients suffer from chronic muscle degeneration and weakness. Clinical symptoms are first noticed between the ages of 2 and 5, and by the patient’s teens, the ability to walk independently is lost. Patients usually die before the age of 30 from cardiorespiratory failure. There remains an urgent need for methods of treating subjects with muscular dystrophy.

[0006] Facioscapulohumeral muscular dystrophy (FSHD) is a genetic muscle disorder that primarily leads to progressive degeneration of facial, scapular, and upper arm muscles, although weakness symptoms can also occur in other muscles. FSHD is the third most common type of muscular dystrophy, with an estimated prevalence of about 3 cases per 100,000 people. In most individuals diagnosed with FSHD, symptoms manifest before age 20. FSHD is caused by mutations that lead to inappropriate expression of the double homeobox 4 gene (DUX4). There are currently no drugs to treat FSHD, so patients must cope through surgery and mechanical aids, such as surgery to stabilize the scapula, use of orthotics such as back support belts, girdles, and braces, and low-intensity exercise. Thus, there is an urgent need for new therapies that target muscle degeneration to improve the quality of life of these subjects.

[0007] Spinal muscular atrophy (SMA) is a neurodegenerative disease triggered by genetic mutations in the survival motor neuron 1 (SMN1) gene. Affected motor neurons of SMA patients produce less sustained firing and gradually degenerate over time, leading to motor neuron (MN) death. The severity of SMA ranges from respiratory failure in the neonatal period (types 1-2) to mild muscle weakness in adulthood (type 4). Novel gene therapies have successfully avoided the need for permanent respiratory support and death in neonatal patients (types 1-2). However, these gene therapies cannot yet help patients with types 3-4 who develop severe motor dysfunction after adulthood. In addition, type 1-2 patients receiving gene therapy can develop severe motor dysfunction. Thus, there is an urgent need for new therapies that target motor impairment in SMA patients and improve the effectiveness of existing therapies to improve the quality of life of these subjects.

[0008] Brief description of the disclosure Methods of treating a subject having a muscle wasting condition are disclosed. The method includes administering to the subject a composition comprising an effective amount of: a) an exogenous matrix-binding nanovesicle (MBV) derived from extracellular matrix, wherein the MBV does not express CD63 and CD81 or is CD63 lo CD81 lo and wherein the MBV is free of alkaline phosphatase; b) a myeloid progenitor cell or myeloid-derived cell treated with an exogenous MBV; and / or c) a conditioned medium or fraction thereof obtained from a macrophage culture that was cultured in the presence of an exogenous MBV.

[0009] Methods for promoting muscle regeneration or repair in a subject in need thereof are also disclosed. The method includes administering to the subject a composition comprising an effective amount of an exogenous matrix-binding nanovesicle (MBV) derived from extracellular matrix, wherein the MBV does not express CD63 and CD81 or is CD63 lo CD81 loand wherein the MBV do not contain alkaline phosphatase, thereby facilitating muscle regeneration in the subject.

[0010] The above described and other features and advantages of the present application will become more apparent by reference to the following detailed description of several aspects when taken in conjunction with the accompanying drawings. BRIEF DESCRIPTION OF DRAWINGS FIG. 1 Schematic representation of the workflow for determining the direct (left) and indirect effects (right) of MBV administration on the FSHD myoblast transcriptome as described in examples 1-4.

[0012] FIG. 2 Metabolic activity (%) of healthy and FSHD2 patient myoblasts after 24h of treatment with different doses of MBV.

[0013] FIG. 3 Effect of macrophage-derived secretomes (MBV, LPS (M1) and IL4 (M2)) on HMEC-1 cell metabolic activity (%) after 24h (left) and 72h (right).

[0014] FIG. 4 Wound scratch assay results showing the percentage of migration area of HMEC-1 cells treated with M1, M2 and M-MBV macrophage-derived secretomes.

[0015] FIG. 5 Effect of macrophage-derived secretomes (MBV, LPS (M1) and IL4 (M2)) on N1E-155 cell metabolic activity (%) after 24h (left) and 72h (right).

[0016] FIGS. 6A-6B Effect of macrophage-derived secretomes (MBV, LPS (M1) and IL4 (M2)) on N1E-155 cell differentiation after 24h and 72h, measured by morphological features of circularity (A top panel), eccentricity (A bottom panel) and Feret diameter (B). FIG. 5 FIG. 5 FIG. 5

[0017] FIG. 7 Classification of bone marrow cells that took up MBV after 3h and 24h.

[0018] FIG. 8 Distribution of accessible sequences in different treatments in vitro and in vivo, shown by ATAC sequencing analysis.

[0019] FIG. 9 ​​​The graph shows the distribution of genes that are statistically significantly regulated at the epigenetic level in different cells treated in vitro. Dots are shown on the right side of each graph (corresponding to the large circles in the Venn diagram at the bottom), and dots are shown on the left side of each graph (corresponding to the small circles in the Venn diagram). The dots in the middle of each graph correspond to genes in the overlapping region of the Venn diagram; the middle section represents the overlapping part of the Venn diagram. Similarly, in the Venn diagram, large circles represent dots on the right, and small circles represent dots on the left.

[0020] FIGS. 10A-10B : Schematic experimental design for MBV accumulation in bone marrow cells ( FIG. 10A Bone marrow and blood fluorescence imaging 24 hours after intraperitoneal injection of different MBV labeling concentrations ( FIG. 10B ) and their corresponding readings ( FIG. 10A This accumulation is related to changes in responses to the M1 challenging (M1 challenging). FIG. 10B ).

[0021] FIG. 11 Schematic diagram of a mouse model of facioscapulohumeral muscular dystrophy (FSHD). Top: DUX4 expression was induced in 4-week-old female iDUX4pA-HSA mice by feeding them a doxycycline (dox) diet on day 0 and maintained throughout the study to simulate a “moderate” Dux4 environment (iDUX4pA-HSA mouse model). Bottom: DUX4 expression was induced in 14-week-old males by injecting them with TMX on day 0 to simulate the adult FSHD phenotype. The second arm of the study evaluated the effect of MBV treatment on an aged FSHD mouse model (without TMX induction, 7-month-old mice). FLExDUX4(+TMX) The cumulative phenotype effect caused by low chronic DUX4 expression in a mouse model.

[0022] FIG. 12 This is a bar chart showing the severity scores of FSHD in normal (control) mice, MBV-treated FSHD mice, and saline-treated FSHD mice as described in Example 8. Undamaged tissue sections (i.e., normal skeletal muscle tissue) are shown with a score of zero (0). Score 1 indicates mild damage. Score 2 indicates moderate damage with increased inflammatory cells surrounding dead or dying myofibrils. Score 3 indicates severe diffuse damage with widespread presence of inflammatory cells, activated satellite cells, scattered myoblasts, and multifocal tissue necrosis.

[0023] FIG. 13 Photographs of exemplary muscle tissue samples from control (PBS-treated; left) and MBV-treated (right) FSHD mice in the FLExDUX4(+TMX) model are shown. Hematoxylin and eosin staining, magnified approximately 400x.

[0024] FIG. 14Photographs of exemplary muscle tissue samples from SMA mice in the control group (PBS-treated; left) and the MBV-treated group (right) are shown. Hematoxylin and eosin staining was performed at approximately 400x magnification. These images show longitudinal sections of skeletal muscle. The animals in the control group exhibited severe muscle atrophy, myofibril separation, increased interfibrofibrous inflammatory cells, and areas of tissue necrosis. The animals in the MBV-treated group also exhibited muscle atrophy, but to a lesser degree than the PBS-treated control group, with less inflammation and milder muscle damage.

[0025] FIG. 15 This is a schematic diagram of a mouse model of spinal muscular atrophy (SMA). Mice received an intramuscular injection of MBV on day 3 and were sacrificed on day 7.

[0026] FIGS. 16A-16B A comparison of surface markers for exosomes, bone microvesicles (MV), and bone microvesicles (MBV) is provided. The figure shows... Results from the exosome antibody array (System Biosciences) compared the levels of various biomarkers in mouse exosomes, mouse bone matrix vesicles (bone MV), and mouse matrix-bound nanovesicles (MBV). FIG. 16A Provides an array of digital images, FIG. 16B This is a graph showing the relative expression of each of the aforementioned markers in exosomes, bone microvesicles, and MBV. The data show that MBV differs from exosomes and bone microvesicles (MVs) based on the spectrum of surface markers. Compared to the levels of these markers in bone MVs or exosomes, MBV does not express or expresses low levels of CD63, EpCAM, ANXA5, TSG101, GM130, FLOT1, ICAM1, ALIX, and CD81, as shown in the bar chart below.

[0027] FIG. 17 This is a Western blot demonstrating the expression of the bone microvesicle markers Annexin V and tissue nonspecific alkaline phosphatase (TNAP) by bone microvesicles. Lysates prepared from 1711A cells were used as a positive control. The results of this experiment indicate that matrix-bound nanovesicles (MBVs) do not express either of the two markers of bone microvesicles, TNAP and Annexin V. Plasma exosomes express Annexin V but not TNAP. These results clearly distinguish MBVs from exosomes and bone microvesicles. Notably, the MBVs used were isolated from muscle tissue.

[0028] FIG. 18This is a bar chart showing the different effects of macrophage activation gene expression on exosomes, MV, and MBV. The immunomodulatory effect of MBV is differentiated; it increases M2 macrophages compared to exosomes or bone MV, which have no such effect. Bone marrow-derived macrophages (BMDM) collected from mice were either untreated (M0) or treated with the following test samples for 24 hours: M1-like phenotype (M1), IL-4-induced M2-like phenotype (M2), plasma-derived exosomes, 17A cell-derived bone MV, or MBV isolated from muscle were used. Following treatment, fold changes in the expression of indicator genes (Arg, CD206, Fixx, IL-6, INOS, and TNF) were assessed by qPCR. MBV downregulated the pro-inflammatory markers IL-6 and TNF-α, a significantly different effect from the downregulation of the same two inflammatory markers by exosomes and bone MV. MBV exhibited potent anti-inflammatory activity, while exosomes and bone MV did not.

[0029] FIG. 19 This is a schematic diagram of the D2.mdx mouse study. D2.mdx mice (6-8 weeks old) were randomly assigned to the following groups: 1) saline treatment group (n=6) and 2) MBV treatment group (n=6). 100 µl of 4.2 × 10^9 MBV was administered intraperitoneally on days 1, 3, and 5, and weekly thereafter. Body weight was recorded weekly. Animals were sacrificed at week 8, and tissues were collected, weighed, and subjected to histological examination.

[0030] FIG. 20 Graphs showing body weight and organ weight from the D2.mdx mouse study are provided. Animals (n=6 per group) were weighed at weeks 1, 3, 5, 7, and 8. Data showed a statistically significant difference in body weight between the MBV-treated and control groups. At week 8, animals were sacrificed and the gastrocnemius (GC), tibialis anterior (TA), extensor digitorum longus (EDL), soleus (SOLL), liver, and spleen were removed and weighed. Results showed a significant difference in gastrocnemius (GC) weight among the groups. Other muscle tests showed a trend toward higher weight in the MBV-treated groups compared to the control group.

[0031] FIG. 21 The results of muscle function tests are presented. Functional analysis was performed by measuring isometric torque production in the gastrocnemius muscle at weeks 1 and 7. The results showed a statistically significant increase in torque production in MBV-treated animals compared to the saline control group.

[0032] FIG. 22Representative digital images of muscle structure (assessed by H&E) and fibrosis (assessed by Masson trichrome staining). The saline-treated group showed extensive muscle degeneration, inflammation, thick bands of dense fibrous tissue replacing lost muscle tissue, and a modest attempt at myocyte regeneration. In contrast, the MBV-treated group showed significantly reduced muscle degeneration, sparse and widespread areas of muscle degeneration, a small number of scattered mononuclear inflammatory cells, and a robust muscle regeneration response demonstrated by satellite cell activation and the presence of myoblasts.

[0033] DETAILED DESCRIPTION Methods for treating subjects with muscular dystrophy are disclosed herein. Various muscular dystrophy conditions suitable for treatment by these methods are disclosed herein. The methods involve the application of MBV prepared from extracellular matrix sources as disclosed herein. The methods may include selecting a subject with muscular dystrophy and then treating that subject.

[0034] In some respects, a method for treating a subject with muscular dystrophy is disclosed, the method comprising administering to the subject a composition comprising an effective amount of: (1) exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix, wherein the MBVs do not express CD63 and CD81 or CD63 lo CD81 lo The method may include, (1) the MBV being free of alkaline phosphatase; (2) myeloid progenitor cells or myeloid-derived cells treated with exogenous MBV; and / or (3) conditioned medium or fraction thereof obtained from a macrophage culture cultured in the presence of exogenous MBV, thereby treating a subject with muscular dystrophy. The subject may be a human subject. The method may include selecting a subject with muscular dystrophy and then treating that subject.

[0035] In some aspects, a method for promoting muscle regeneration or repair in subjects in need is disclosed. The method includes administering a composition to the subject comprising an effective amount of exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix, wherein the MBVs do not express CD63 and CD81 or CD63... lo CD81 lo Furthermore, the MBV contained in the subject does not contain alkaline phosphatase, thereby promoting muscle regeneration.

[0036] MBV can be derived from the extracellular matrix of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessels, lungs, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. In some embodiments, MBV is not derived from the ECM of the bone or heart. For example, MBV is derived from the extracellular matrix of the bladder, small intestine, dermis, liver, kidney, uterus, brain, blood vessels, lungs, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. For example, MBV can be derived from the bladder matrix (UBM), small intestinal submucosa (SIS), or bladder submucosa (UBS). For example, MBV can be derived from the dermis. For example, MBV can be derived from the extracellular matrix of mammalian vertebrates selected from humans, monkeys, pigs, cattle, or sheep.

[0037] For example, in one aspect, administering an effective amount of a composition to a subject suffering from muscular dystrophy, the composition comprising exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix, wherein the MBVs do not express CD63 and CD81 or CD63 lo CD81 lo Furthermore, the MBV in question does not contain alkaline phosphatase.

[0038] In another aspect, administering an effective amount of a composition to a subject requiring muscle regeneration or repair, the composition comprising exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix, wherein the MBVs do not express CD63 and CD81 or CD63 lo CD81 lo Furthermore, the MBV in question does not contain alkaline phosphatase.

[0039] MBV can be administered to subjects via systemic administration, such as intravenous administration.

[0040] Exogenous MBV can be administered in physiologically acceptable solutions, such as saline at physiological pH. Exogenous MBV can be contained in an extracellular matrix (ECM) hydrogel or a pregel prepared from an extracellular matrix (ECM), and the hydrogel or pregel can be administered to a subject. The ECM hydrogel or pregel contains dissolved ECM at a concentration of 1 mg / mL to 500 mg / mL, for example, 1 mg / mL to 50 mg / mL. For example, the extracellular matrix hydrogel or pregel can be an enzymatically catalyzed ECM hydrogel or pregel and contains inactivated proteases, such as trypsin and / or pepsin. For example, the pH of the enzymatically catalyzed hydrogel or pregel is approximately 7.0 to 7.8. For example, the enzymatically catalyzed pregel forms a gel at a temperature above approximately 25°C. In some instances, the ECM hydrogel is an acoustic hydrogel with a storage modulus (G') of about 50 Pa to about 200 Pa, a loss modulus (G”) of about 5 Pa to about 20 Pa, and a G' to G” ratio of about 4:1 to about 15:1 at 37°C. In some embodiments, the ECM in the hydrogel or pregel is undialyzed.

[0041] ECM hydrogels can be prepared from the extracellular matrix of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessels, lungs, bones, muscles, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. In some embodiments, ECM hydrogels can be prepared from the bladder matrix (UBM), small intestinal submucosa (SIS), or bladder submucosa (UBS). ECM hydrogels can be prepared from the dermis. ECM hydrogels can be prepared from the extracellular matrix of mammalian vertebrates selected from humans, monkeys, pigs, cattle, or sheep.

[0042] For example, in another aspect, administering an effective amount of a composition to a subject suffering from muscular dystrophy, the composition comprising myeloid progenitor cells or myeloid-derived cells treated with exogenous MBV. The myeloid progenitor cells or myeloid-derived cells may be autologous cells of the subject. The myeloid progenitor cells or myeloid-derived cells may be treated with exogenous MBV in vitro, for example, in a cell culture. The myeloid progenitor cells or myeloid-derived cells may then be isolated from the cell culture for administration to the subject. The myeloid-derived cells may be macrophages, monocytes, granulocytes, or myeloid progenitor cells. The myeloid progenitor cells or myeloid-derived cells may be administered to the subject via systemic administration. For example, the myeloid progenitor cells or myeloid-derived cells may be administered intravenously. The myeloid progenitor cells or myeloid-derived cells may be administered directly into the bone marrow cavity. The subject may be a human subject.

[0043] For example, in another aspect, administering an effective amount of a composition to a subject suffering from muscular dystrophy, the composition comprising a conditioned medium or fraction thereof obtained from a macrophage culture derived from the subject and cultured in the presence of exogenous MBV. The macrophages may be autologous cells of the subject. The conditioned medium may be purified by dialysis, size fractionation, and / or centrifugation prior to administration to the subject. The subject may be a human subject.

[0044] In some respects, muscular atrophy is a type of muscular dystrophy. Examples of muscular dystrophy include Becker muscular dystrophy, congenital muscular dystrophy, Duchenne muscular dystrophy (DMD), distal muscular dystrophy, Emery-Dreifuss muscular dystrophy, facioscapulohumeral MD (FSHD), Limb-Girdle muscular dystrophy, myotonic muscular dystrophy, oculopharyngeal muscular dystrophy, Bethlem myopathy, or Ullrich congenital muscular dystrophy. For example, muscular atrophy is FSHD.

[0045] In some respects, muscular atrophy is spinal muscular atrophy (SMA). For example, SMA can be infantile progressive spinal muscular atrophy (SMA type I), intermediate spinal muscular atrophy (SMA type II), juvenile spinal muscular atrophy (SMA type III), or adult spinal muscular atrophy (SMA type IV).

[0046] In other respects, muscular atrophy is sarcopenia or cachexia.

[0047] In some respects, the methods disclosed herein for treating patients with muscular atrophy increase myotube formation, maintain undifferentiated neural progenitor cells, and / or increase endothelial cell migration in subjects. The methods disclosed herein can also increase muscle tissue growth in subjects.

[0048] In other respects, compositions for the therapeutic methods disclosed herein are provided, wherein the compositions provide an effective amount of (a) exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix, wherein the MBVs do not express CD63 and CD81 or CD63 lo CD81 lo (a) the MBV containing no alkaline phosphatase; (b) myeloid progenitor cells or myeloid-derived cells treated with exogenous MBV; and / or (c) conditioned medium or fraction thereof obtained from macrophages cultured in the presence of exogenous MBV.

[0049] In some respects, the methods disclosed herein for promoting muscle regeneration or repair increased the number of satellite cells in the muscles of the subjects requiring regeneration or repair compared to the number before MBV application. In some respects, the methods disclosed herein for promoting muscle regeneration or repair increased the number of myoblasts in the muscles of the subjects requiring regeneration or repair compared to the number before MBV application.

[0050] TERMINOLOGY Unless otherwise stated, technical terms are used in their conventional sense. Definitions of many commonly used terms in molecular biology can be found in Krebs et al. (eds.), Lewin's genes XII, published by Jones & Bartlett Learning, 2017. The following explanations of terms and methods are provided to better describe this disclosure and to guide those skilled in the art in implementing it. Unless the context clearly indicates otherwise, the singular forms “a,” “an,” and “the” refer to one or more. For example, the term “comprising a MBV” includes a singular or plural MBV and is considered equivalent to the phrase “comprising at least one MBV.” Unless the context clearly indicates otherwise, the term “or” refers to a single element among the selected elements, or a combination of two or more elements. As used herein, “comprises” means “includes.” Therefore, “comprising A or B” means “includes A, B, or A and B,” without excluding other additional elements. It should be further understood that, unless otherwise stated, any and all molecular weight or molecular mass values ​​or ratios given for the composition are approximate values ​​and are provided for descriptive purposes. GenBank® Registry numbers mentioned herein refer to sequences that were available at least as early as April 5, 2021. All references, patent applications, publications, and GenBank® Registry numbers cited herein are incorporated herein by reference. Unless otherwise stated, “about” means within 5%. When the term “approximately” is used before a quantitative value, this disclosure also includes that specific quantitative value itself. In case of conflict, this specification (including the explanation of terms) shall prevail. For ease of review of various aspects of this disclosure, the following explanations of specific terms are provided: Acidic proteases: Enzymes that cleave peptide bonds, wherein the enzyme exhibits enhanced peptide bond-cleaving activity at acidic pH. Examples, but not limited to, acidic proteases may include pepsin and trypsin.

[0051] Administration / Pressure: The composition (such as MBV or a pharmaceutical preparation containing MBV) is introduced into the subject via a selected route. This route can be local or systemic. For example, if the selected route is intravenous, the composition is administered by introducing it into the subject's vein. If the selected route is local, the composition can be administered by introducing it directly into the subject's tissues.

[0052] Animals: Living multicellular vertebrates, including, for example, mammals and birds. The term "mammal" includes both humans and non-human mammals. Similarly, the term "subject" includes both humans and veterinary subjects.

[0053] Biocompatibility: Any material that will not cause adverse reactions in mammalian subjects when implanted. When introduced into an individual, a biocompatible material can perform its intended function, is non-toxic or harmful to the individual, and will not cause immune rejection of the material in the subject.

[0054] Cachexia: A muscular dystrophy syndrome associated with an underlying disease, causing persistent muscle loss that cannot be fully reversed by nutritional supplementation and may be accompanied by a reduction in body fat. A range of diseases can lead to cachexia, the most common being cancer, congestive heart failure, chronic obstructive pulmonary disease, chronic kidney disease, and HIV / AIDS. Key characteristics of cachexia include persistent loss of muscle and fat mass, reduced food intake, abnormal carbohydrate, protein, and fat metabolism, decreased quality of life, and increased physical damage. Cachexia differs from weight loss caused by malnutrition due to malabsorption, anorexia nervosa, or major depressive disorder. Weight loss due to insufficient calorie intake usually precedes fat loss, while cachexia primarily causes muscle atrophy. Cachexia is also different from sarcopenia.

[0055] Centrifugation: The process of applying centrifugal force to a mixture, causing the denser component to move away from the centrifuge shaft relative to the less dense components. The force applied to the mixture is a function of the centrifuge rotor speed and the radius of rotation. In most applications, the rotational force causes precipitate (pellets) to accumulate at the bottom of the centrifuge tube, and the remaining solution is appropriately referred to as the "supernatant." In other similar applications, density-based separation, or "gradient centrifugation," is used to separate specific substances from mixtures containing components with densities higher and lower than the desired component.

[0056] During the circular motion of a centrifuge rotor, the applied force is the product of the radius of rotation and the angular velocity, where the force is usually expressed as the acceleration relative to the standard acceleration "g" caused by gravity at the Earth's surface. The applied centrifugal force is called the "relative centrifugal force" (RCF), and is expressed as a multiple of "g".

[0057] Comminute (or comminution, comminuting): The process of reducing larger particles to smaller particles, including but not limited to grinding, mixing, shredding, slicing, milling, or chopping. ECM can be comminuted in any form, including but not limited to hydrated, frozen, air-dried, lyophilized, powdered, or flake form. "Comminuted ECM" contains intact collagen. In some cases, comminuted ECM is not subjected to ultrasonication or enzymatic digestion, such as with proteases, like acidic proteases.

[0058] Conditioned medium (medium, media): A culture medium containing basal medium and cell secretions. Basal medium is suitable for cell culture. Conditioned medium is typically prepared by culturing cells of interest (such as macrophages) in basal tissue medium, allowing the cells to secrete active components (such as proteins and other factors) into the basal medium. Cells are usually removed from the conditioned medium before use, for example by centrifugation and / or other suitable methods. Conditioned medium can be substantially cell-free (e.g., less than 5% of the conditioned medium volume) or completely cell-free to prevent the presence of viable cells.

[0059] Contact: being in a direct physical bond, which can be in solid or liquid form.

[0060] Cytokines: The term "cytokines" is used as a general name for a diverse group of soluble proteins and peptides that, under normal or pathological conditions, act as humoral regulatory factors at concentrations ranging from nanometers to picomoles, modulating the functional activity of individual cells and tissues. These proteins also directly mediate cell-to-cell interactions and regulate processes occurring in the extracellular environment. Examples of cytokines include, but are not limited to, tumor necrosis factor-α, interleukin (IL)-6, IL-10, IL-12, transforming growth factor, and interferon-γ.

[0061] Diagnosis: The process of identifying a disease based on physical signs, symptoms, and the results of various tests. The conclusion reached through this process is also called a "diagnosis." Common diagnostic tests include, but are not limited to, blood tests, medical imaging, and biopsies.

[0062] Enrichment: The process in which the ratio of the content of the component of interest, such as nanovesicles, in a mixture to the content of other components in the mixture increases after the enrichment process compared to before the enrichment process.

[0063] Extracellular matrix (ECM): A complex mixture of structural and functional biomolecules and / or biomacromolecules (including, but not limited to, structural proteins, specialized proteins, proteoglycans, glycosaminoglycans, and growth factors) surrounding and supporting cells within a tissue, and which is cell-free unless otherwise stated. ECM preparations may be considered “decellularized” or “cell-free,” meaning that cells have been removed from the source tissue by processes described herein and known in the art. The term “ECM-derived material,” such as “ECM-derived nanovesicles,” “matrix-bound nanovesicles,” “MBV,” or “ECM-derived nanovesicles,” refers to nanovesicles prepared from natural ECM or from in vitro sources, wherein the ECM is generated by cultured cells. “Intact extracellular matrix” and “intact ECM” refer to an extracellular matrix that retains the activity of its structural and non-structural biomolecules, including but not limited to collagen, elastin, laminin, glycosaminoglycans, proteoglycans, antimicrobial agents, chemical inducers, cytokines, and growth factors, such as, but not limited to, fragmented ECM as described herein. The activity of biomolecules within an ECM can be removed chemically or mechanically, such as by cross-linking and / or dialysis. Intact ECM is essentially uncross-linked and / or dialyzed, meaning it has not undergone dialysis and / or cross-linking processes, nor has it experienced any conditions other than those that occur naturally during the storage and handling of the ECM before dissolution in enzymatic ECM hydrogel preparation. Therefore, ECM that has undergone substantial cross-linking and / or dialysis (unless the treatment is performed in a manner that is extremely minor and does not substantially affect the gelation and functional properties of the ECM for the purposes described herein) is not considered "intact."

[0064] Exogenous: Derived from a different source. Exogenous MBV is generated separately, for example, extracted from an ECM source and added to an ECM hydrogel, which may or may not contain endogenous MBV. Exogenous MBV can originate from the same tissue as the ECM used to prepare the ECM hydrogel or from a different tissue. Exogenous MBV can originate from the same species as the ECM used to prepare the ECM hydrogel or from a different species.

[0065] Gel: A state of matter between liquid and solid, typically defined as a cross-linked polymer network that expands in a liquid medium. Generally, a gel is a two-phase colloidal dispersion containing both solids and liquids, with the solid content being higher than that found in a two-phase colloidal dispersion called a "sol." Therefore, a gel possesses some properties of liquids (i.e., its shape is elastic and deformable) and some properties of solids (e.g., its shape is sufficiently discrete to maintain a three-dimensional morphology on a two-dimensional surface). "Gelization time," also known as "gelation period," refers to the time required for a composition to become non-flowing under moderate pressure.

[0066] Gelation: The formation of a gel from a sol.

[0067] Hydrogels: Networks of hydrophilic polymer chains, sometimes exhibiting as colloidal gels dispersed in water. Hydrogels are natural or synthetic polymer networks with high water absorption. Hydrogels also possess flexibility similar to natural tissues. "Acoustic" hydrogels, such as acoustic ECM hydrogels, are generated using ultrasonic energy, for example, by dissolving ECM. The properties of these hydrogels are disclosed herein. For hydrogels, G' (storage modulus) is typically about an order of magnitude greater than G (loss modulus). "Enzymatic" ECM hydrogels are produced by enzymatic digestion of ECM. The viscosity of enzymatic hydrogels increases when heated to near physiological temperatures of 37°C. For example, enzymatic hydrogels are formed from injectable solutions at temperatures below 37°C, which gel at physiological temperatures of 37°C. "Pre-gelled" refers to enzymatic hydrogels in a sol state, for example, because the appropriate gelation temperature has not yet been reached.

[0068] Improved muscle health: Muscle health is improved compared to a pre-existing condition or a condition present without treatment. For example, improved muscle health may include increased muscle regeneration, maintenance, or repair, or reduced or reversed muscle tissue degeneration. Improved muscle health also includes pre-treatment of the subject to prevent or reduce muscle injury, degeneration, or damage.

[0069] Isolation: "Isolated" biological components (such as nucleic acids, proteins, cells, or nanovesicles) have been substantially separated or purified from the somatic cells of the organism in which the component is naturally present or from other biological components in the ECM. "Isolated" nucleic acids and proteins include those purified using standard purification methods. Isolated MBVs are removed from the fibrous material of the ECM. The term also includes nucleic acids and proteins prepared through recombinant expression in host cells, as well as chemically synthesized nucleic acids.

[0070] Isotonic buffer solution: A solution buffered to a pH of 7.0 to 7.8 and having a balanced salt concentration to promote an isotonic environment.

[0071] Lysyl oxidase (Lox): A copper-dependent enzyme that catalyzes the formation of aldehydes from lysine residues in collagen and elastin precursors. These aldehydes are highly reactive and spontaneously react with other lysine oxidase-derived aldehyde residues or unmodified lysine residues. In vivo, this leads to cross-linking of collagen and elastin, playing a role in the stability of collagen fibers and the integrity and elasticity of mature elastin. Complex cross-links are formed in collagen (pyridinium esters derived from three lysine residues) and elastin (dextromethorphan esters derived from four lysine residues), exhibiting diverse structures. Genes encoding Lox enzymes have been cloned from various organisms (Hamalainen...). et al ., Genomics 11:508, 1991; Trackman etal (Biochemistry 29:4863, 1990; incorporated herein by reference). Residues 153-417 and 201-417 of the human lysyl oxidase sequence have been shown to be important for catalytic function. Four Lox-like isoforms exist, named LoxL1, LoxL2, LoxL3, and LoxL4.

[0072] Macrophages: A type of white blood cell that engulfs and degrades cellular debris, foreign substances, microorganisms, and cancer cells. In addition to their role in phagocytosis, these cells play crucial roles in development, tissue maintenance and repair, and in innate and adaptive immunity. They can recruit and influence other cells, including immune cells such as lymphocytes. Macrophages can exhibit various phenotypes, including those known as M1 and M2. Macrophages that primarily perform pro-inflammatory functions are called M1 macrophages (CD86). + / CD68 + Macrophages that reduce inflammation and promote and regulate tissue repair are called M2 macrophages (CD206). + / CD68 + Biomarkers for identifying various macrophage phenotypes vary by species. It is important to note that macrophage phenotypes exhibit a spectrum, with extreme values ​​at the M1 and M2 phenotypes, respectively. F4 / 80 (encoded by the adhesion G protein-coupled receptor E1 (ADGRE1) gene) is a macrophage biomarker; see GENBANK® accession numbers NP_001243181.1, April 6, 2018, and NP_001965, March 5, 2018, both incorporated herein by reference. Not wishing to be bound by theory, it is considered that MBV has the ability to modulate macrophage phenotypes, potentially leading to an increase in M2-like, regulatory, or pro-remodeling macrophages. The effects of MBV on macrophages are further described in PCT Publication WO2017 / 151862A1, the entire contents of which are incorporated herein by reference. In some respects, MBV can be used to induce an M2 phenotype in macrophages and inhibit M1 macrophages in subjects.

[0073] MicroRNAs (miRNAs) are small non-coding RNAs, approximately 17 to 25 nucleotides in length, that post-transcriptionally regulate gene expression by typically inhibiting the translation of target mRNAs. MicroRNAs (miRNAs or miRs) can act as negative regulators; the higher the quantity of a particular miRNA, the lower the expression level of the target gene. miRNAs exist in three forms: primary miRNAs (pri-miRNAs), pre-miRNAs (pre-miRNAs), and mature miRNAs. Primary miRNAs (pri-miRNAs) are expressed as stem-loop transcripts ranging from a few hundred bases to over 1 kb. These primary miRNA transcripts are cleaved in the cell nucleus by an RNase II endonuclease called Drosha, which cuts both strands of the stem near the base of the stem-loop. Drosha cleaves the RNA double strand through staggered cutting, retaining the phosphate group at the 5' end and forming a 2-nucleotide overhang at the 3' end. The cleavage product, pre-miRNA, is approximately 60 to 110 nucleotides long and has a hairpin structure formed in a fold-back manner. Precursor miRNAs are transported from the nucleus to the cytoplasm via Ran-GTP and Exportin-5. In the cytoplasm, the precursor miRNA is further processed by an RNase II endonuclease called Dicer. Dicer recognizes the 5' phosphate group and the 3' overhang, cleaving the loop at the stem-loop junction to form a double-stranded miRNA. The double-stranded miRNA binds to the RNA-induced silencing complex (RISC), in which the antisense strand is preferentially degraded, while the mature sense strand guides the RISC to the target site. Mature miRNA is the biologically active form of miRNA, and its length is approximately 17 to 25 nucleotides.

[0074] Muscular dystrophy: This term refers to a group of inherited diseases that cause progressive muscle weakness. Muscular dystrophy can lead to skeletal muscle weakness and deficiencies in skeletal muscle proteins, resulting in impairment of various physiological functions. Currently, there is no satisfactory treatment for muscular dystrophy. Existing treatments typically focus on improving the impact of the disease and enhancing the patient's quality of life, such as through physical therapy, surgical intervention, or the provision of orthopedic devices.

[0075] Mutant genes associated with muscular dystrophy encode a variety of proteins related to the sarcomere protein network. These proteins include laminin-2, collagen, dystroglycan, integrin, caveolin-3, ankyrin, dystrophin, α-dystrobrevin, vinculin, plectin, BPAG1b, myo-LIM protein, desmin, actinin-associated LIM protein, α-actin, titin, telehonin, cypher, myotilin, and the sarcoglycan / sarcospan complex.

[0076] The most common type of muscular dystrophy is Duchenne muscular dystrophy (DMD), affecting approximately 1 in 3,500 live male births. DMD is an X-linked recessive disorder characterized by mutations in the gene encoding dystrophin, a cytoskeletal protein with a molecular weight of approximately 430 kDa. This protein acts as a linker between the cytoskeleton and the extracellular matrix of cells. In DMD patients, the absence of dystrophin leads to the loss of muscle fiber attachment to the extracellular matrix during contraction, ultimately resulting in persistent fiber damage, membrane leakage, and loss of muscle function. Most patients die before the age of 30 from respiratory or heart failure.

[0077] Beckers' muscular dystrophy (also known as...) Benign pseudohypertrophic muscular dystrophy Both DMD and Becker's muscular dystrophy are related to Duchenne muscular dystrophy, and are caused by mutations in the dystrophin gene. However, DMD cannot produce functional dystrophin, making it more severe than Becker's muscular dystrophy. Becker's muscular dystrophy is an X-linked recessive genetic disorder characterized by slow, progressive muscle weakness in the legs and pelvis. BMD is a type of muscular dystrophy, encompassing a range of muscle diseases caused by insufficient production of dystrophin within muscle cells, leading to instability in the muscle cell membrane structure. This is caused by mutations in the dystrophin gene. The symptom progression pattern of BMD is similar to that of DMD, but it has a later onset and a slower rate of progression.

[0078] Congenital muscular dystrophy is caused by gene mutations that affect the production of other costameric proteins. Merosin deficiency congenital muscular dystrophy (MDC1A) is caused by... LAMA2Congenital muscular dystrophy (MDD) is caused by gene mutations resulting in the absence or complete loss of laminin-α2 protein. The absence of laminin-α2 leads to the absence of laminin-211 / 221. Laminin-211 / 221 are major components of the extracellular matrix and play a crucial role in myocyte development. During myocyte differentiation, laminin binds to α7β1 integrin. Without laminin-α2, myofibrils cannot attach to the basement membrane, and myotubes undergo apoptosis. Muscle regeneration also fails, leading to loss of muscle repair, increased myofibrils, and inflammation. This chronic tissue damage is a major cause of morbidity and mortality in MDC1A.

[0079] Congenital muscular dystrophy (CMD) and limb-girdle muscular dystrophy (LGMD) are common forms of highly heterogeneous muscular dystrophy and can be distinguished by age of onset. In CMD, symptoms appear at birth or within the first 6 months of life; in LGMD, symptoms appear in late childhood, adolescence, or even adulthood. LGMD can be inherited in an autosomal dominant manner (LGMD type 1) or an autosomal recessive manner (LGMD type 2), while CMD is recessive. There is overlap between CMD and LGMD both clinically and genetically.

[0080] MDC1A is a progressive muscular atrophy that leads to wheelchair dependence, mechanical ventilation, and premature death in children. Symptoms are present at birth and include poor muscle tone and "floppy" infant syndrome. DMD, BMD, and LGMD are also progressive muscular degenerative diseases, typically diagnosed between 3 and 5 years of age, when children exhibit developmental delays, including in walking and climbing stairs. These diseases are progressive, and children often require wheelchairs and mechanical ventilation by adolescence.

[0081] Facioscapulohumeral muscular dystrophy (FSHD) is a muscular dystrophy characterized by progressive muscle weakness and loss of muscle tissue. Unlike DMD and BMD, which primarily affect the lower limbs, FSHD affects the upper limbs, mainly the muscles of the face, shoulders, and upper arms. However, it can also affect the muscles around the pelvis, hips, and calves. Symptoms of FSHD typically appear between the ages of 10 and 26, but later onset is not uncommon. In some cases, symptoms never appear. Symptoms are usually mild and progress slowly. Facial muscle weakness is common and may include ptosis (drooping eyelids), inability to whistle, reduced facial expressions, a depressed or angry facial expression, difficulty speaking, shoulder muscle weakness (leading to deformities such as winged scapula and tilted shoulders), lower limb weakness, hearing loss, and possible heart problems. FSHD is caused by a mutation that leads to abnormal expression of the dual homeobox protein 4 (DUX4) gene, resulting in the expression of a protein that is toxic to muscle cells.

[0082] Myeloid cells: "Myeloid cells" or "myeloid-derived cells" refer to cells derived from myeloid progenitor cells, including, for example, granulocytes (such as basophils, neutrophils, and eosinophils) and monocytes. Because monocytes can differentiate into macrophages or dendritic cells, macrophages and dendritic cells are also considered myeloid cells or myeloid-derived cells.

[0083] Myoblasts: Proliferating satellite cells and their progeny are called myoblasts, also known as myogenic progenitor cells. Myoblasts fuse together to produce new muscle fibers and can fuse with existing muscle fibers in skeletal muscle tissue, leading to skeletal muscle regeneration.

[0084] Muscle cells: Muscle cells are mature contractile cells in animal muscles. There are three types of muscles: skeletal muscle, smooth muscle, and cardiac muscle. Skeletal muscle cells are long, filamentous cells containing multiple nuclei, called myofibrils, and develop from myoblasts. Skeletal muscle cells are formed through the fusion of myoblasts, producing multinucleated cells (syncytiotrophs), a process called myogenesis. Skeletal muscle cells contain myofibrils and sarcomeres formed from filaments, forming striated muscle tissue. The filaments of myofibrils, myofilaments, are composed of three types: thick filaments, thin filaments, and elastic filaments. Thin filaments are mainly composed of the protein actin and are wrapped with actin filaments. Thick filaments are mainly composed of the protein myosin, which is responsible for generating force. Elastic filaments are composed of a protein called titin, which holds the thick filaments in place. Actin and myosin filaments each have a specific and constant length on the order of a few micrometers, much smaller than the length of an elongated muscle cell (a few millimeters in human skeletal muscle cells). These filaments are arranged in repeating subunits along the length of the myofibril. Muscle cells are almost entirely filled with myofibrils that run parallel to each other along the cell's long axis.

[0085] Nanovesicles: Extracellular vesicles are nanoparticles with diameters ranging from approximately 10 to 1000 nanometers. Nanovesicles are lipid-membrane-enclosed particles that carry bioactive signaling molecules such as microRNAs and proteins. Typically, nanovesicles are confined within a lipid bilayer, with biomolecules enclosed and / or embedded within the bilayer. Therefore, nanovesicles contain cavities surrounded by a plasma membrane. Different types of vesicles can be distinguished based on diameter, subcellular origin, density, shape, sedimentation rate, lipid composition, protein markers, nucleic acid content, and origin (e.g., derived from the extracellular matrix or secreted). Nanovesicles can be identified by their origin (e.g., matrix-bound nanovesicles derived from the ECM, see above), protein content, and / or miR content.

[0086] Exosomes, or liquid-phase extracellular vesicles (EVs), are membranous vesicles secreted by cells, ranging in diameter from 10 to 150 nm. Late endosomes or multivesicular bodies typically contain luminal vesicles, formed by vesicles budding inward from the limited endosome membrane and dividing into these enclosed vesicles. These luminal vesicles are then released from the multivesicular body lumen into the extracellular environment during exocytosis, typically into bodily fluids such as blood, cerebrospinal fluid, or saliva. Intracellular exosomes are produced when a segment of the membrane invaginates and is endocytosed. The internalized fragment contains proteins and RNA molecules, such as mRNA and miRNA, which are broken down into smaller vesicles and eventually expelled from the cell. Plasma-derived exosomes are largely lacking in ribosomal RNA. Extracellular matrix-derived exosomes contain specific miRNA and protein components and have been shown to be present in almost all bodily fluids, such as blood, urine, saliva, semen, and cerebrospinal fluid. Exosomes can express CD11c, CD63, CD81 and / or CD9, and therefore can be CD11c. + and / or CD63 + and / or C81 + and / or CD9 + There are no high levels of lysyl oxidase on the surface of exosomes.

[0087] "ECM-derived nanovesicles," "matrix-bound nanovesicles," "MBVs," or "ECM-derived nanovesicles" all refer to the same membrane-bound particles present in the extracellular matrix, ranging in size from 10 nm to 1000 nm, containing bioactive signaling molecules that influence cellular behavior, such as proteins, lipids, nucleic acids, growth factors, and cytokines. These terms are interchangeable and refer to the same vesicles. These nanovesicles are embedded and bound within the ECM, rather than simply attached to the surface or freely circulating in body fluids. These nanovesicles are resistant to harsh separation conditions, such as freeze-thaw cycles and digestion with proteases such as pepsin, elastase, hyaluronidase, proteinase K, and collagenase, as well as digestion with detergents. MBVs differ from other extracellular vesicles, including exosomes, and have a different phospholipid composition. MBVs differ from bone matrix vesicles that express alkaline phosphatase, as MBVs do not express alkaline phosphatase. In some cases, MBVs can also be distinguished from exosomes by the absence of certain markers typically attributed to exosomes.

[0088] In some respects, MBV is characterized by one or more of the following protein expression or lipid content characteristics: (i) Compared to other vesicles such as exosomes, MBV may not express one or more of CD63 and / or CD81 and / or CD9, or may have low or almost undetectable levels of CD63 and / or CD81 and / or CD9 (CD63). lo and / or CD81lo and / or CD9 lo (See, for example, Example 1). Various methods can be used to distinguish low, barely detectable, or no expression of CD63 and / or CD81 and / or CD9 in MBV, such as antibody-based methods like Western blotting or flow cytometry (see, for example, Bashashati and Brinkman, Adv Bioinformatics (2009: 584603). In some respects, the expression of CD63 and / or CD81 and / or CD9 in MBV is considered low or almost undetectable compared to other vesicles, and the expression of CD63 and / or CD81 and / or CD9 in MBV is at least one standard deviation or at least two standard deviations lower than the mean expression of other vesicles such as exosomes; (ii) MBV has phospholipid content, wherein at least 55% of the total phospholipids comprises a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (iii) MBV has phospholipid content, of which 10% or less of the total phospholipids contain sphingomyelin (SM). (iv) MBV contains phospholipids, of which 20% or less of the total phospholipids contain phosphatidylethanolamine (PE). (v) MBV has a phospholipid content, wherein 15% or more of the total phospholipid content contains phosphatidylinositol (PI), and this percentage represents the percentage of lipid concentration.

[0089] In some respects, MBV is characterized by all of the following features: (i) Does not express one or more of CD63 and / or CD81 and / or CD9, or has low or almost undetectable levels of CD63 and / or CD81 and / or CD9 (CD63 lo and / or CD81 lo and / or CD9 lo (as described above); (ii) Phospholipid content, wherein at least 55% of the total phospholipids comprise a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (iii) Phospholipid content, wherein 10% or less of the total phospholipids contain sphingomyelin (SM). (iv) Phospholipid content, wherein 20% or less of the total phospholipids contain phosphatidylethanolamine (PE); and (v) Phospholipid content, of which 15% or more of the total phospholipid content is phosphatidylinositol (PI).

[0090] In some respects, MBV is characterized by all of the following features: (i) Phospholipid content, wherein at least 55% of the total phospholipids comprise a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (ii) Phospholipid content, wherein 10% or less of the total phospholipids contain sphingomyelin (SM). (iii) Phospholipid content, wherein 20% or less of the total phospholipids contain phosphatidylethanolamine (PE); and (iv) Phospholipid content, wherein 15% or more of the total phospholipid content is phosphatidylinositol (PI).

[0091] In some respects, MBV is characterized by one or more of the following features: (i) Phospholipid content, wherein at least 55% of the total phospholipids comprise a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (ii) Phospholipid content, wherein 10% or less of the total phospholipids contain sphingomyelin (SM). (iii) Phospholipid content, wherein 20% or less of the total phospholipids contain phosphatidylethanolamine (PE); and (iv) Phospholipid content, wherein 15% or more of the total phospholipid content is phosphatidylinositol (PI).

[0092] In some respects, MBV is characterized by one or more of the following features: (i) It does not contain detectable levels of alkaline phosphatase; (ii) It does not contain detectable levels of osteopontin. (iii) It does not contain detectable levels of osteoprogeterin. (iv) Absence of detectable levels of complement C5; and / or (v) Contains no detectable levels of C-reactive protein.

[0093] In some respects, MBV contains IL33 and is IL33. + .

[0094] The ECM used to isolate MBV can be tissue-derived ECM, produced by cultured cells, or purchased from commercial sources.

[0095] Pharmaceutically acceptable carriers: Pharmaceutically acceptable carriers that can be used in the pharmaceutical formulation for which protection is sought are conventional. Remington’s Pharmaceutical Sciences The book, by EW Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for drug delivery of the fusion proteins disclosed herein.

[0096] The nature of the carrier typically depends on the specific route of administration employed. For example, parenteral preparations often include injectable fluids, such as pharmaceutically and physiologically acceptable fluids like water, saline, balanced salt solutions, glucose solutions, glycerol, etc., as carriers. For solid compositions (e.g., powders, pills, tablets, or capsules), conventional non-toxic solid carriers may include, for example, pharmaceutical-grade mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral carriers, the pharmaceutical preparation to be administered may also contain small amounts of non-toxic excipients, such as wetting agents or emulsifiers, preservatives, and pH buffers, such as sodium acetate or sorbitol monolaurate.

[0097] Pharmaceutical: A compound or composition which, when properly administered to a subject or cells, is capable of producing the desired therapeutic or preventative effect.

[0098] Phospholipids: A class of lipids whose structure consists of two hydrophobic fatty acid tails and a hydrophilic head, the hydrophilic head being composed of a phosphate group. Major classes of phospholipids include phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI), phosphatidylserine (PS), phosphatidylglycerol (PG), sphingomyelin (SM), cardiolipin (CL), phosphatidic acid (PA), and bis(monoacylglycerol) phosphate (BMP). Phospholipids can be determined by a variety of methods. For example, whole lipidomics and redox lipidomics based on liquid chromatography-mass spectrometry (LC-MS) can be used. In some respects, the content of a particular phospholipid is expressed as a percentage concentration of total phospholipids (e.g., total phospholipid content in MBV), where the percentage concentration is weight / weight (w / w).

[0099] Polynucleotides: Nucleic acid sequences of any length (such as linear sequences). Therefore, polynucleotides include both oligonucleotides and gene sequences in chromosomes. An "oligonucleotide" is a set of linked nucleotides connected by natural phosphodiester bonds. Oligonucleotides are polynucleotides ranging in length from 6 to 300 nucleotides. Oligonucleotide analogs are parts that function similarly to oligonucleotides but contain non-naturally occurring parts. For example, oligonucleotide analogs may contain non-naturally occurring parts, such as modified sugar moieties or interglycosidic linkages, such as phosphate-thionucleotide oligodeoxynucleotides. Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, including peptide nucleic acid (PNA) molecules.

[0100] Preventative: As used herein, this refers to a medicine or treatment designed and intended to prevent the occurrence of a disease or condition. As used herein, the terms "prophylactic" and "prevention" are used interchangeably.

[0101] Purification: The term "purification" does not require absolute purity; rather, it is a relative term. Thus, for example, a purified nucleic acid preparation is one in which the nucleic acid is purer than that found in its native intracellular environment. For instance, a nucleic acid preparation is purified so that its nucleic acid content accounts for at least 50% of the total protein content of the preparation. Similarly, a purified MBV preparation is one in which exosomes are purer than the environment, including cells, where microvesicles and exosomes are present. The purified population purity of nucleic acids or MBV is greater than approximately 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or completely free of other nucleic acid or cellular components.

[0102] Disease prevention or treatment: "Disease prevention" refers to suppressing the development of a disease, such as in individuals known to be susceptible to it. Examples of individuals known to be susceptible are those with a family history of the disease or those exposed to factors that predispose them to a condition. "Treatment" refers to therapeutic interventions that improve the signs or symptoms of a disease or pathological condition after it has begun to develop.

[0103] Regeneration: When referring to skeletal muscle, this refers to the formation of new skeletal muscle tissue. Regeneration is the natural response process that occurs in response to injury, stress, or other events that lead to the loss of existing skeletal muscle in a subject. Skeletal muscle regeneration occurs through a process initiated by muscle stem cells (satellite cells), which results in the generation of new muscle fibers and the repair of existing muscle fibers. The presence of satellite cells and myoblasts in muscle tissue indicates that the muscle tissue is in a regenerative state.

[0104] Sarcopenia: A progressive loss of muscle mass and strength associated with age. The main symptom of this condition is muscle weakness. Sarcopenia affects men and women equally; the incidence increases with age. In humans, sarcopenia typically affects individuals aged 60 and older. The disease affects both sexes equally. This condition is characterized by a degenerative loss of skeletal muscle mass, quality, and strength. The rate of muscle loss depends on exercise level, complications, nutrition, and other factors. The pathological changes in sarcopenia include decreased muscle tissue quality, manifested as replacement of muscle fibers with fat, increased fibrosis, changes in muscle metabolism, oxidative stress, and neuromuscular junction degeneration. Sarcopenia is diagnosed when a patient's muscle mass is at least two standard deviations below the population average and they walk slowly. Subjects with this condition exhibit low muscle mass, low muscle strength, or low physical performance.

[0105] Satellite cells: Satellite cells are myogenic (muscle) stem cells that play a crucial role in the maintenance, remodeling, and repair of muscle fibers. These precursors of skeletal muscle cells are mononuclear and located between the basement membrane and plasma membrane of muscle fibers. Normally quiescent in adult muscle, they can proliferate in response to injury or stress, generating regenerated muscle and more satellite cells.

[0106] Dissolved ECM: ECM that has undergone ultrasonic cavitation or enzymatic digestion, resulting in changes to its microstructure, such as physical disruption of protein aggregates or digestion.

[0107] Spinal muscular atrophy (SMA): a hereditary and acquired neurodegenerative disease of the central nervous system (CNS) characterized by the progressive loss of motor neurons in the spinal cord and brainstem, leading to muscle weakness and atrophy. The most common form of SMA is caused by mutations in the surviving motor neuron (SMN) gene, and its severity varies considerably, affecting individuals from infants to adults. Crawford and Pardo, Neurobiol. Dis., 1996, 3:97 ).

[0108] Specifically, SMA is caused by mutations in the survivor motor neuron 1 (SMN1) gene, which prevent the normal expression of the SMN protein. In most cases, SMA is diagnosed based on clinical symptoms and the presence of at least one copy of the SMN1 gene. However, in approximately 5% of cases, SMA is caused by mutations in genes other than SMN1 inactivation. In some cases, when SMN1 gene testing is not feasible or shows no abnormalities, other tests may be necessary, such as electromyography (EMG) or muscle biopsy.

[0109] It is noteworthy that although the SMN1 gene is universally expressed in all motor neurons (MNs), not all muscles are affected. SMA particularly affects the lower limbs, and in more severe cases, it can also impair respiratory function. In SMA patients, the affected motor neurons have a reduced ability to generate sustained firing and gradually degenerate over time, leading to motor neuron (MN) death. Mouse model experiments have shown that insufficient SMN protein expression initially causes functional impairment and leads to MN death in the later stages of the disease. MN dysfunction in SMA patients is caused by non-cellular autonomous mechanisms and is independent of MN death. Therefore, MN dysfunction and death in SMA patients are two independent processes.

[0110] Severity of SMA ranges from respiratory failure in the neonatal period (types 1-2) to mild muscle weakness in adulthood (type 4). Infantile SMA is the most severe form of this neurodegenerative disease. Symptoms include muscle weakness, hypotonia, difficulty crying, limb weakness or a tendency to fall, difficulty sucking or swallowing, buildup of secretions in the lungs or throat, difficulty feeding, and increased susceptibility to respiratory infections. The legs are often weaker than the arms, and developmental milestones such as head lifting or sitting up may not be reached. Generally, the earlier symptoms appear, the shorter the lifespan. Symptoms appear quickly as motor neurons degenerate. The severe form of this disease is fatal. The course of SMA is directly related to the rate of motor neuron degeneration and the severity of the resulting weakness. Infants with severe SMA often die from respiratory illnesses due to weakness in the muscles supporting breathing. Children with mild SMA live longer, although they may require long-term medical support, especially those with more severe cases. The clinical spectrum of SMA is divided into the following five groups.

[0111] 1) Type O SMA (intrauterine SMA) is the most severe form of this disease, beginning before birth. Typically, the first symptom of type O SMA is reduced fetal movement, which can be first observed between 30 and 36 weeks of gestation. After birth, these newborns show almost no movement and experience difficulty swallowing and breathing.

[0112] 2) Type 1 SMA (infantile SMA or Werdnig-Hoffmann's disease) presents with symptoms between 0 and 6 months of age. This form of SMA is also very severe. Patients are never able to sit up and usually die within 2 years of age without respiratory support.

[0113] 3) Type 2 SMA (intermediate SMA) has an age of onset of 7-18 months. Patients can sit without support but can never stand or walk without assistance. The prognosis for this group depends largely on the extent of respiratory involvement.

[0114] 4) Type 3 SMA (juvenile SMA or Kugelberg-Welander disease) is usually diagnosed after 18 months. Individuals with type 3 SMA are able to walk independently at some point during the course of the disease, but often become wheelchair-dependent in adolescence or adulthood.

[0115] 5) Type 4 SMA (adult-onset SMA). Weakness usually begins in the tongue, hands, or feet in late adolescence and then spreads to other parts of the body. Adult SMA has a much slower course and has little or no impact on life expectancy.

[0116] Subjects: Humans and non-human animals, including all vertebrates such as mammals and non-mammals such as non-human primates, mice, rabbits, sheep, dogs, cats, horses, cattle, chickens, amphibians, and reptiles. In some aspects of the method, the subject is a human. The term "subject" is used interchangeably with the term "patient." A subject can be an individual diagnosed as being at high risk of having a disease or condition, such as an infectious disease or condition (e.g., an immunocompromised individual, a healthcare professional); a person diagnosed with a disease or condition, such as an infectious disease or condition; a person who has previously had a disease or condition, such as an infectious disease or condition; or a person assessed as having symptoms or signs of a disease or condition, such as an infectious disease or condition.

[0117] Therapeutic effective dose: The amount of a specific substance (such as MBV) sufficient to achieve the desired effect in the treated subject. When administered to a subject, a dose is typically used that achieves a target tissue concentration (e.g., in the lungs) that has been shown to achieve the desired in vitro effect.

[0118] Thermally reversible hydrogels: hydrogels formed by polymer chain entanglement whose viscosity changes at a characteristic gelation temperature. The disclosed acoustic ECM hydrogel is a thermally reversible hydrogel that exhibits gelation (sol-to-gel transition) upon cooling.

[0119] Topical application: Topically applied agents are administered only to a specific area rather than the whole body. In certain instances, the composition is applied to the skin or eyes where hemostasis is required. For example, a pharmaceutical composition may be applied as a topical preparation to wounds, such as epithelial wounds or defects, such as traumatic or surgical wounds, such as skin or corneal abrasions or surgical incisions.

[0120] Total phospholipid content: For MBV, the term "total phospholipids" or "total phospholipid content" as used herein refers to the sum of all phospholipids present in a given amount of isolated MBV, i.e., MBV isolated from ECM. For example, MBV can be isolated by enzymatic digestion and differential centrifugation of decellularized ECM. Total phospholipid content can be determined by methods such as total lipidomics and redox lipidomics based on LC-MS. Total phospholipid content is determined by weight. The percentage of total phospholipid content refers to the percentage concentration on a weight-to-weight basis.

[0121] Transplantation: Placing a biocompatible matrix, such as MBV, into the body of a subject in need.

[0122] Treatment (or therapy) refers to any success or indication of success in reducing or improving an injury, pathology, or condition, including any objective or subjective parameters such as reduction, relief, or attenuation of symptoms or making the condition more tolerable for the patient, slowing the rate of degeneration or decline, reducing the debilitating endpoint of degeneration, or improving the physical or mental health of the subject. Treatment can be assessed by objective or subjective parameters; including the results of physical examination, neurological examination, or psychiatric evaluation.

[0123] Ultrasonic treatment: refers to the process of exposing oneself to ultrasound waves with a frequency higher than 20 kHz.

[0124] Matrix-bound nanovesicles (MBV) derived from extracellular matrix (ECM) ECM-derived nanovesicles (also known as matrix-bound nanovesicles, "MBVs") are generally described in PCT publications WO2017 / 151862, WO2018 / 204848, and WO2019 / 213482, all of which are incorporated herein by reference. MBVs are disclosed to be embedded in the extracellular matrix. These MBVs are isolable and biologically active. MBVs do not express CD63 and CD81, or CD63... lo CD81 lo MBVs are free of alkaline phosphatase. MBVs may contain IL-33. These MBVs can be used for therapeutic purposes. In some respects, MBVs do not contain alkaline phosphatase, osteopontin, osteopoietin, complement C5, and / or C-reactive protein.

[0125] The extracellular matrix (MBV) is a complex mixture of structural and functional biomolecules and / or biomacromolecules (including, but not limited to, structural proteins, specialized proteins, proteoglycans, glycosaminoglycans, and growth factors) that surrounds and supports cells within mammalian tissues and is acellular unless otherwise stated. Typically, the disclosed MBV is embedded in any type of extracellular matrix (ECM) and can be detached from that site. Therefore, MBV is not detachably present on the ECM surface, nor is it an exosome (also known as an extracellular vesicle or EV).

[0126] Extracellular matrix is ​​disclosed in, for example, but not limited to, U.S. Patent Nos. 4,902,508; 4,956,178; 5,281,422; 5,352,463; 5,372,821; 5,554,389; 5,573,784; 5,645,860; 5,771,969; 5,753,267; 5,762,966; 5,866,414; 6,099,567; 6,485,723; 6,576,265; 6,579,538; 6,696,270; 6,783,776; 6,793,939; 6,849,273; 6,852,339; References 6,861,074; 6,887,495; 6,890,562; 6,890,563; 6,890,564; and 6,893,666; each of which is incorporated herein by reference in its entirety. However, ECM can be produced from any tissue or any in vitro source, wherein the ECM is produced from cultured cells and contains one or more polymeric components (ingredients) of the natural ECM. ECM preparations can be considered “decellularized” or “cell-free,” meaning that the cells have been removed from the source tissue or culture.

[0127] In some respects, the extracellular matrix (ECM) is isolated from vertebrates, such as mammalian vertebrates, including but not limited to humans, monkeys, pigs, cattle, sheep, etc. The ECM can be derived from any organ or tissue, including but not limited to the bladder, intestine (such as the small or large intestine), heart, dermis, liver, kidney, uterus, brain, blood vessels, lungs, bones, muscles, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. In certain non-limiting instances, the extracellular matrix is ​​isolated from esophageal tissue, bladder (such as bladder matrix (UBM) or bladder submucosal layer (UBS)), small intestinal submucosal layer (SIS), dermis, umbilical cord, pericardium, cardiac tissue, or skeletal muscle. For example, the ECM is UBM, or the ECM is SIS, or the ECM is UBS, or the ECM is dermis. The ECM can include any part or tissue obtained from an organ, including, for example, but not limited to, the submucosa, epithelial basement membrane, lamina propria, etc. In one non-limiting aspect, the ECM is isolated from the bladder. In some respects, the ECM is derived from human subjects. In other respects, the ECM is derived from pig subjects. In some respects, the ECM is not a pig ECM.

[0128] An ECM may or may not include a basement membrane. In another non-limiting aspect, an ECM includes at least a portion of the basement membrane. The ECM material may or may not retain some cellular elements that constitute the original tissue, such as capillary endothelial cells or fibroblasts. In some aspects, an ECM comprises both a basement membrane surface and a non-basement membrane surface.

[0129] In some respects, ECM is derived from a pig bladder (also known as bladder matrix or UBM). In short, ECM is prepared by removing bladder tissue from a mammal such as a pig and trimming away any remaining external connective tissue, including adipose tissue. The tissue is repeatedly washed with tap water to remove all residual urine. It is first soaked in an epithelialization solution, such as, but not limited to, hypertonic saline (e.g., 1.0 N saline), for periods ranging from 10 minutes to 4 hours, thereby causing the tissue to detach in layers. Exposure to the hypertonic saline solution causes the epithelial cells to detach from the underlying basement membrane. Optionally, a calcium chelating agent may be added to the saline solution. The remaining tissue after the initial layering procedure consists of the epithelial basement membrane and the tissue layer outside the lumen of the epithelial basement membrane. The relatively fragile epithelial basement membrane is always damaged and removed due to any mechanical abrasion of the luminal surface. The tissue is then further processed to remove most of the extraluminal tissue, but retains the epithelial basement membrane and lamina propria. The outer serosa, adventitia, muscularis mucosae (tunica muscularis mucosa), submucosa, and most of the muscularis mucosae are removed from the remaining deepithelialized tissue by mechanical abrasion or a combination of enzymatic treatments (e.g., using trypsin or collagenase) followed by hydration and abrasion. Mechanical removal of these tissues is achieved by using, for example, but not limited to, Adson-Brown forceps and Metzenbaum scissors to remove mesenteric tissue, and by using a scalpel handle or other rigid object wrapped in moist gauze to perform longitudinal wiping motions to remove the muscularis and submucosa. Automated robotic procedures involving cutting blades, lasers, and other tissue dissection methods may also be considered. After removal of these tissues, the resulting ECM consists primarily of the epithelial basement membrane and the underlying tunica propria.

[0130] In another aspect, the ECM is prepared by abrading the porcine bladder tissue with a longitudinal wiping motion using a scalpel handle and moistened gauze to remove the outer layer, which includes the serosa and muscle layer. After eversion of the tissue segment, the luminal portion of the mucosal layer is peeled away from the underlying tissue using the same wiping motion. Care is taken to prevent perforation of the submucosal layer. After removing these tissues, the resulting ECM consists primarily of the submucosal layer (see U.S. Patent No. 9,277,999). FIG. 2 (This patent is incorporated herein by reference).

[0131] ECM can also be prepared as a powder. This powder can be referenced from Gilbert's work. et al.,The methods described in Biomaterials 26 (2005) 1431-1435 are incorporated herein by reference in their entirety. For example, UBM sheets can be freeze-dried, then cut into small pieces and immersed in liquid nitrogen. The rapidly frozen material can then be pulverized to a size small enough to be placed in a rotary grinder, where the ECM is pulverized. Similarly, the material is broken into uniformly sized particles by NaCl, which acts as a precipitant within the ECM tissue, and these particles can be rapidly frozen, freeze-dried, and pulverized.

[0132] In one non-limiting aspect, the ECM is derived from the submucosa of the small intestine or the SIS. Commercially available preparations include, but are not limited to, those mentioned above. , , , and (Cook Urological Inc.; Indianapolis, Indiana) and (Organogenesis Inc.; Canton, Massachusetts). In another non-limiting aspect, the ECM is derived from the dermis. Commercially available preparations include, but are not limited to, those mentioned above. (in Europe) For Sale; Covington, Bard, Georgia (Microvasive; Boston, Massachusetts) and (LifeCell; Blancheburg, NJ). In another aspect, ECM is derived from the bladder. Commercially available preparations include, but are not limited to, UBM (ACell Corporation; Jessup, Maryland).

[0133] MBV can be obtained (released) from the extracellular matrix by the methods disclosed below. For example, MBV can be obtained from the extracellular matrix according to the method disclosed in U.S. Patent Application Publication No. 2019 / 0117837, the contents of which are incorporated herein by reference for all purposes. In some aspects, the ECM is digested with enzymes such as pepsin, collagenase, elastase, hyaluronidase, and / or proteinase K, and MBV is isolated. In other aspects, the release and isolation of MBV from the ECM is achieved by: altering the pH with a solution of, for example, glycine HCl, citric acid, or ammonium hydroxide; using a chelating agent, such as, but not limited to, EDTA or EGTA; using a salt to achieve ionic strength and / or separation effect, said salt including but not limited to potassium chloride (KCl), sodium chloride, magnesium chloride, sodium iodide, or sodium thiocyanate; or exposing the ECM to denaturing conditions such as guanidine hydrochloride or urea.

[0134] MBV can be derived from the extracellular matrix of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessels, lungs, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, and / or esophagus. In certain non-limiting examples, MBV is derived from the bladder matrix (UBM), small intestinal submucosa (SIS), or bladder submucosa (UBS). In one aspect, MBV is derived from the dermis. In another aspect, MBV is derived from the UBM. In still other aspects, MBV is derived from the extracellular matrix of mammalian vertebrates selected from humans, monkeys, pigs, cattle, or sheep. In certain non-limiting examples, MBV is derived from non-human mammals. In some aspects, MBV is not derived from the bone ECM. In some aspects, MBV is not derived from the heart ECM. In some aspects, MBV is not derived from the heart ECM or bone ECM. In certain respects, MBV is prepared by digesting ECM with enzymes such as pepsin, elastase, hyaluronidase, proteinase K, salt solution, and / or collagenase or combinations thereof. ECM can be freeze-thawed or mechanically degraded.

[0135] In some respects, the expression of CD63, CD81, and / or CD9 is undetectable on MBVs. Therefore, in some respects, MBVs do not express CD63 and / or CD81 and / or CD9. In one specific instance, CD63, CD81, and CD9 are undetectable on nanovesicles. In other respects, MBVs express only extremely low levels of CD63, CD81, and CD9, levels that are detectable, for example, by Western blotting. These MBVs are CD63... lo CD81 lo CD9 lo In other respects, MBV does not express detectable levels of one or more of CD63, CD81, or CD9. In other respects, MBV expresses only very low levels of one or more of CD63, CD81, or CD9. Those skilled in the art can readily determine CD63 using, for example, antibodies that specifically bind to CD63, CD81, and CD9. lo and / or CD81 lo and / or CD9 loMBV. Low levels of these markers can be determined using procedures such as fluorescence-activated cell sorting (FACS) and fluorescently labeled antibodies to identify thresholds for low and high levels of CD63, CD81, and CD9. In some instances, the disclosed MBV does not contain detectable alkaline phosphatase, osteopontin, osteopoietin, complement C5, and / or C-reactive protein. The disclosed MBV differs from nanovesicles, such as exosomes that may temporarily attach to the surface of the ECM due to their presence in biological fluids; MBV binds to the ECM in vivo and is not present in biological fluids.

[0136] MBV has a unique phospholipid content, for example, compared to exosomes. In some aspects, the total phospholipid content of MBV is at least 50%, 55%, 60%, 65%, 70%, 75%, 85%, or 90%, or about 50%-90%, 50%-65%, 50%-60%, 50%-70%, 60%-70%, 60%-90%, or 70%-90% of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI). In certain aspects, the total phospholipid content of MBV is at least 55% of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI). In certain aspects, the total phospholipid content of MBV is at least 60% of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI). In some aspects, the phospholipid content of MBV includes a ratio of phosphatidylcholine (PC) to phosphatidylinositol (PI) of less than 8:1 (e.g., less than 7:1, less than 6:1, less than 5:1, less than 4:1, less than 3:1, or less than 2:1). In some aspects, the phospholipid content of MBV includes a ratio of phosphatidylcholine (PC) to phosphatidylinositol (PI) in the range of 0.5-1:1, or 1:0.5-1, or 0.5-1:2, or 2:0.5-1, or 0.8-1:1, or 1:0.8-1. In one aspect, the phospholipid content of MBV includes a ratio of phosphatidylcholine (PC) to phosphatidylinositol (PI) of about 1:1. In a particular aspect, the phospholipid content of MBV includes a ratio of phosphatidylcholine (PC) to phosphatidylinositol (PI) of about 0.9:1.

[0137] In some respects, the total phospholipid content of MBV is 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4% or less, or about 5%-10%, 5%-15%, 10%-15%, or 8%-12% sphingomyelin (SM). In certain respects, the total phospholipid content of MBV is 10% or less sphingomyelin (SM). In some respects, the total phospholipid content of MBV is 15% or less sphingomyelin (SM), 14% or less sphingomyelin, 13% or less sphingomyelin, 12% or less sphingomyelin, 11% or less sphingomyelin, 10% or less sphingomyelin, 9% or less sphingomyelin, 8% or less sphingomyelin, 7% or less sphingomyelin, 6% or less sphingomyelin, 5% or less sphingomyelin, or 4% or less sphingomyelin.

[0138] In some respects, the total phospholipid content of MBV is 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, or 10% or less, or about 10%-20%, 15%-20%, 14%-18%, or 12%-16% phosphatidylethanolamine (PE). In certain respects, the total phospholipid content of MBV is 20% or less phosphatidylethanolamine (PE).

[0139] In some respects, the total phospholipid content of MBV is 5%, 10%, 12%, 15%, 18%, 20%, 25%, or 30% or more, or about 5%-30%, 10%-20%, 10-25%, 15%-25%, or 12%-18% phosphatidylinositol (PI). In certain respects, MBV contains 15% or more phosphatidylinositol (PI).

[0140] In certain aspects, the total phospholipid content of MBV comprises 15% or more phosphatidylinositol, 20% or less phosphatidylethanolamine, and 10% or less sphingomyelin. In certain aspects, the total phospholipid content of MBV is 15% or more phosphatidylinositol and 20% or less phosphatidylethanolamine. In certain aspects, the total phospholipid content of MBV is 15% or more phosphatidylinositol and 10% or less sphingomyelin. In certain aspects, the total phospholipid content of MBV comprises 20% or less phosphatidylethanolamine and 10% or less sphingomyelin. In certain aspects, the total phospholipid content of MBV is more than 15% phosphatidylinositol, 20% or less phosphatidylethanolamine, 10% or less sphingomyelin, and at least 55% of a combination of phosphatidylcholine and phosphatidylinositol. In one aspect, the total phospholipid content of MBV is a combination of at least 55% phosphatidylcholine (PC) and phosphatidylinositol (PI) and 10% or less sphingomyelin (SM). In a particular aspect, the total phospholipid content of MBV is a combination of at least 55% phosphatidylinositol and phosphatidylcholine, and more than 15% phosphatidylinositol. In a particular aspect, the total phospholipid content of MBV is a combination of 55% phosphatidylinositol and phosphatidylcholine and 20% or less phosphatidylethanolamine.

[0141] MBVs may also contain lysine oxidase (Lox). Typically, nanovesicles derived from the ECM have a higher Lox content than exosomes. Lox is expressed on the MBV surface. Nano-LC MS / MS proteomics analysis can be used to detect Lox protein. Quantification of Lox can be performed (see, e.g., Hill RC, ...). et al ., Mol Cell Proteomics. 2015;14(4):961-73, the entire contents of which are incorporated herein by reference.

[0142] In some respects, MBV is characterized by one or more of the following features: (i) It does not contain detectable levels of alkaline phosphatase; (ii) Contains no detectable levels of osteopontin; (iii) Contains no detectable levels of osteopoietin; (iv) Absence of detectable levels of complement C5; and / or (v) Contains no detectable levels of C-reactive protein.

[0143] In some respects, MBV is characterized by one or more of the following features: (i) Contains low levels or no detectable levels of EpCAM, (ii) Contains low levels or no detectable levels of ANXA5, (iii) Contains low levels or no detectable levels of TSG101; (iv) Contains low levels or no detectable levels of FLOT1; (v) Contains low levels or no detectable levels of ICAM1; (vi) Contains low levels or no detectable levels of GM130; and / or (vii) Contains low levels or no detectable levels of ALIX.

[0144] In one implementation, MBV is characterized by low or undetectable levels of ANXA5, TSG101, and ICAM1.

[0145] In one implementation, MBV is characterized by low or undetectable levels of CD81, CD63, ANXA5, TSG101, and ICAM1.

[0146] In some respects, an MBV contains one or more miRNAs. In certain non-limiting instances, an MBV contains one, two, or all three of miR-143, miR-145, and miR-181. miR-143, miR-145, and miR-181 are all known in the art.

[0147] The miR-145 nucleic acid sequence is available in MiRbase accession number MI0000461, which is incorporated herein by reference. CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU (SEQ ID NO: 1). The miR-181 nucleic acid sequence is provided in miRbase accession number MI0000269, which is incorporated herein by reference. The miR-181 nucleic acid sequence is: AGAAGGGCUAUCAGGCCAGCCUUCAGAGGACUCCAAGGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUUGAAAAAACCACUGACCGUUGACUGUACCUUGGGGUCCUUA (SEQ ID NO: 2). The miR-143 nucleic acid sequence is available in NCBI accession number NR_029684.1, incorporated herein by reference on March 30, 2018. The DNA encoding the miR-143 nucleic acid sequence is: gcgcagcgcc ctgtctccca gcctgaggtg cagtgctgca tctctggtca gttgggagtctgagatgaag cactgtagct caggaagaga gaagttgttc tgcagc (SEQ ID NO: 3).

[0148] Following administration, MBV maintained the expression of F4 / 80 (a macrophage marker) and CD-11b on the subjects' macrophages. Macrophages treated with nanovesicles were predominantly F4 / 80+ Fizz1+, indicating the M2 phenotype.

[0149] The MBV disclosed herein can be formulated into compositions for drug delivery. The MBV is further disclosed and described in PCT Publication No. WO 2017 / 151862, which is incorporated herein by reference.

[0150] Isolation of MBV from ECM MBV can be generated from ECM produced by any cell of interest, or, as described above, they can be isolated from commercially sourced ECM. MBV can be generated from the same species as or different from the treated subject. In some aspects, these methods involve digesting the ECM with enzymes to produce digested ECM. In a particular aspect, the ECM is digested with one or more of pepsin, elastase, hyaluronidase, collagenase, metalloproteinases, and / or proteinase K, or combinations thereof. In a particular non-limiting example, the ECM is digested only with elastase and / or metalloproteinases. In another non-limiting example, the ECM is not digested with collagenase and / or trypsin and / or proteinase K. In other aspects, the ECM is treated with a detergent. In yet another aspect, the method does not include the use of enzymes. In a particular non-limiting example, the method utilizes a dissociating agent or ionic strength to separate MBV, such as a salt, like potassium chloride. In other aspects, the ECM can be manipulated prior to MBV separation to increase the MBV content. The technique for separating MBV from ECM is described, for example, in U.S. Patent Application Publication No. 2019 / 0117837, the contents of which are incorporated herein by reference for all purposes. The technique for separating MBV is also described in Quijano et al., Tissue Eng Part CMethods. 2020 Oct;26(10):528-540, which is also incorporated herein by reference.

[0151] In some respects, ECM is digested with enzymes. ECM can be digested with enzymes for about 12 to about 48 hours, for example, about 12 to 36 hours. ECM can be digested with enzymes for about 12, about 24, about 36, or about 48 hours. In a particular non-limiting example, ECM is digested with enzymes at room temperature. However, digestion can occur at about 4°C or at any temperature between about 4°C and 25°C. Generally, ECM can be digested with enzymes for any time and at any temperature, as long as it is sufficient to remove collagen fibers. The digestion process can vary depending on the tissue origin. Alternatively, ECM may be processed by freeze-thaw before or after enzyme digestion. ECM can be treated with detergents, including ionic and / or nonionic detergents.

[0152] The digested ECM is then processed, for example by centrifugation, to separate a fiber-free supernatant. In some cases, the digested ECM is centrifuged, for example, in the first step at about 300 to about 1000 g. Therefore, the digested ECM can be centrifuged at about 400 g to about 750 g, for example, about 400 g, about 450 g, about 500 g, or about 600 g. This centrifugation can last about 10 to about 15 minutes, for example, about 10 to 12 minutes, for example, about 10, about 11, about 12, about 14, about 14, or about 15 minutes. The supernatant containing the digested ECM is collected.

[0153] In some respects, MBV includes Lox. In some respects, methods for isolating such MBV include digesting the extracellular matrix with elastase and / or metalloproteinase to produce digested extracellular matrix, centrifuging the digested extracellular matrix to remove collagen fiber residues to produce a fiber-free supernatant, centrifuging the fiber-free supernatant to separate solids, and suspending the solids in a carrier.

[0154] In some respects, the digested ECM can also be centrifuged a second time at approximately 2000g to approximately 3000g. Therefore, the digested ECM can be centrifuged at approximately 2500g to approximately 3000g, for example, at approximately 2000g, 2500g, 2750g, or 3000g. This centrifugation can last approximately 20 to approximately 30 minutes, for example, approximately 20 to approximately 25 minutes, such as approximately 20, approximately 21, approximately 22, approximately 23, approximately 24, approximately 25, approximately 26, approximately 27, approximately 28, approximately 29, or approximately 30 minutes. The supernatant containing the digested ECM is collected.

[0155] In another aspect, the digested ECM can be centrifuged in a third step at approximately 10,000 to approximately 15,000 g. Therefore, the digested ECM can be centrifuged at approximately 10,000 g to approximately 12,500 g, for example, at approximately 10,000 g, 11,000 g, or 12,000 g. This centrifugation can last approximately 25 to approximately 40 minutes, for example, approximately 25 to approximately 30 minutes, such as approximately 25, approximately 26, approximately 27, approximately 28, approximately 29, approximately 30, approximately 31, approximately 32, approximately 33, approximately 34, approximately 35, approximately 36, approximately 37, approximately 38, approximately 39, or approximately 40 minutes. The supernatant containing the digested ECM is collected. One, two, or all three centrifugation steps can be performed independently. In some aspects, all three centrifugation steps are performed. The centrifugation steps can be repeated, for example, 2, 3, 4, or 5 times. In one aspect, all three centrifugation steps are repeated three times.

[0156] In some respects, the digested ECM is centrifuged at about 500 g for about 10 minutes, at about 2500 g for about 20 minutes, and / or at about 10000 g for about 30 minutes. These steps, such as all three steps, are repeated 2, 3, 4, or 5 times, for example, 3 times. Thus, in a non-limiting example, the digested ECM is centrifuged at about 500 g for about 10 minutes, at about 2500 g for about 20 minutes, and at about 10000 g for about 30 minutes. These three steps are repeated three times. Thus, a fiber-free supernatant is produced. The fiber-free supernatant is then centrifuged to separate MBV. In some respects, the fiber-free supernatant is centrifuged at about 100000 g to about 150000 g. Therefore, the fiber-free supernatant is centrifuged at approximately 100,000 g to approximately 125,000 g, such as approximately 100,000 g, approximately 105,000 g, approximately 110,000 g, approximately 115,000 g, or approximately 120,000 g. This centrifugation can be sustained for approximately 60 to approximately 90 minutes, such as approximately 70 to approximately 80 minutes, such as approximately 60, approximately 65, approximately 70, approximately 75, approximately 80, approximately 85, or approximately 90 minutes. In a non-limiting example, the fiber-free supernatant is centrifuged at approximately 100,000 g for approximately 70 minutes. The solid material, i.e., MBV, is collected. This MBV can then be resuspended in any carrier of interest (e.g., but not limited to, buffer solutions).

[0157] In another aspect, ECM is not digested with enzymes. In these methods, ECM is suspended in an isotonic saline solution, such as phosphate-buffered saline. Salt is then added to the suspension to bring the final salt concentration to a level greater than about 0.1 M. The concentration can be, for example, up to about 3 M, such as about 0.1 M salt to about 3 M, or about 0.1 M to about 2 M. The salt can be, for example, about 0.1 M, 0.15 M, 0.2 M, 0.3 M, 0.4 M, 0.7 M, 0.6 M, 0.7 M, 0.8 M, 0.9 M, 1.0 M, 1.1 M, 1.2 M, 1.3 M, 1.4 M, 1.5 M, 1.6 M, 1.7 M, 1.8 M, 1.9 M, or 2 M. In some non-limiting examples, the salt is potassium chloride, sodium chloride, or magnesium chloride. In other respects, salts are sodium chloride, magnesium chloride, sodium iodide, sodium thiocyanate, sodium salts, lithium salts, cesium salts, or calcium salts.

[0158] In some aspects, the ECM is suspended in a salt solution for about 10 minutes to about 2 hours, for example, about 15 minutes to about 1 hour, about 30 minutes to about 1 hour, or about 45 minutes to about 1 hour. The ECM can be suspended in a salt solution for about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 120 minutes. The ECM can be suspended in a salt solution at a temperature of about 4°C to about 50°C, for example, but not limited to about 4°C to about 25°C or about 4°C to about 37°C. In one particular non-limiting example, the ECM is suspended in a salt solution at about 4°C. In other particular non-limiting examples, the ECM is suspended in a salt solution at about 22°C or about 25°C (room temperature). In a further non-limiting example, the ECM is suspended in a salt solution at about 37°C.

[0159] In some aspects, the method includes incubating the extracellular matrix at a salt concentration greater than about 0.4 M; centrifuging the digested extracellular matrix to remove collagen fiber residues and separating the supernatant; centrifuging the supernatant to separate solids; and suspending the solids in a carrier to separate MBV from the extracellular matrix.

[0160] After incubation in a salt solution, the ECM is centrifuged to remove collagen fibers. In some respects, the digested ECM may also be centrifuged at about 2000g to about 5000g. Therefore, the digested ECM may be centrifuged at about 2500g to about 4500g, for example, at about 2500g, about 3000g, about 3500g, about 4000g, or about 4500g. In a particular non-limiting example, centrifugation is performed at about 3500g. This centrifugation may last about 20 to about 40 minutes, for example, about 25 to about 35 minutes, for example, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 minutes, about 31, about 32, about 33, about 34, or about 35 minutes. The supernatant is then collected.

[0161] In another aspect, the supernatant can then be centrifuged a third time at approximately 100,000 to approximately 150,000 g. Therefore, the digested ECM can be centrifuged at approximately 100,000 to approximately 125,000 g, for example, at approximately 100,000 g, 110,000 g, or 120,000 g. This centrifugation can last from approximately 30 minutes to approximately 2.5 hours, for example, from approximately 1 hour to approximately 3 hours, for example, approximately 30 minutes, approximately 45 minutes, approximately 60 minutes, approximately 90 minutes, or approximately 120 minutes (2 hours). The solid matter is collected and suspended in a solution such as buffered saline, thereby separating the MBV.

[0162] In other respects, the ECM is suspended in an isotonic buffer solution, such as, but not limited to, phosphate-buffered saline. Centrifugation or other methods may be used to remove large particles (see below). The MBV is then separated from the ECM by ultrafiltration, separating particles between approximately 10 nm and approximately 10,000 nm, for example, between approximately 10 nm and approximately 1,000 nm, for example, between approximately 10 nm and approximately 300 nm.

[0163] In a specific, non-limiting example, the total salt concentration of the isotonic buffer solution is approximately 0.164 mM, and the pH is approximately 7.2 to approximately 7.4. In some aspects, the isotonic buffer solution comprises approximately 0.002 M KCl to approximately 0.164 M KCl, for example, approximately 0.0027 M KCl (the concentration of KCl in a phosphate buffer solution). The suspension is then treated by ultracentrifugation.

[0164] After incubation in an isotonic buffer solution, the ECM is centrifuged to remove collagen fibers. In some respects, the digested ECM may also be centrifuged at about 2000 g to about 5000 g. Thus, the digested ECM may be centrifuged at about 2500 g to about 4500 g, for example at about 2500 g, about 3000 g, 3500 g, about 4000 g, or about 4500 g. In a particular non-limiting example, centrifugation is performed at about 3500 g. This centrifugation may last for about 20 to about 40 minutes, for example, about 25 to about 35 minutes, for example, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 minutes, about 31, about 32, about 33, about 34, or about 35 minutes.

[0165] Microfiltration and centrifugation, and can be combined, can be used to remove large molecular weight substances from suspensions. In one aspect, microfiltration removes large molecular weight substances, such as those larger than 200 nm. In another aspect, centrifugation removes large molecular weight substances. In a third aspect, both microfiltration and ultracentrifugation are used to remove large molecular weight substances, such as those larger than approximately 10,000 nm, larger than approximately 1,000 nm, larger than approximately 500 nm, or larger than approximately 300 nm, from suspended ECMs.

[0166] The microfiltration effluent or supernatant is then subjected to ultrafiltration. Therefore, the effluent is collected and used, comprising particles smaller than approximately 10,000 nm, approximately 1,000 nm, approximately 500 nm, or approximately 300 nm. This effluent is then ultrafiltered using a membrane with a molecular weight cutoff (MWCO) of 3,000 to 100,000.

[0167] Preparation of ECM-hydrogels Any type of extracellular matrix can be used to prepare mammalian ECM hydrogels (see US patents related to ECM: 4,902,508; 4,956,178; 5,281,422; 5,352,463; 5,372,821; 5,554,389; 5,573,784; 5,645,860; 5,771,969; 5,753,267; 5,762,966; 5,866,414; 6,099,567; 6,485,723; 6,576,265; 6,579,538; 6,696,270; 6,783,776; 6,793,939; 6,849,273;). 6,852,339; 6,861,074; 6,887,495; 6,890,562; 6,890,563; 6,890,564; and 6,893,666). In some aspects, the ECM is separated from vertebrates, such as, but not limited to, mammals, including but not limited to humans, monkeys, horses, pigs, cattle, and sheep. In a particular non-limiting instance, the ECM is of the pig.

[0168] ECM can be derived from any organ or tissue, including but not limited to the bladder, intestines (such as the small or large intestine), heart, kidneys, uterus, brain, blood vessels, lungs, bones, muscles, pancreas, stomach, spleen, adipose tissue, liver, esophagus, and dermis. ECM can be obtained from cell cultures. In one aspect, ECM is isolated from the bladder. In another aspect, ECM is derived from the esophagus. In yet another aspect, ECM is derived from the dermis. In yet another aspect, ECM is derived from the submucosa of the small intestine (SIS). ECM may or may not include a basement membrane portion of the ECM. In some aspects, ECM includes at least a portion of the basement membrane. Tissue can be decellularized to remove cells and cellular material, for example from a source tissue or organ, to produce ECM. Using decellularized material to avoid an immune response is desirable, for example when ECM is implanted into a subject, such as as a component of the hydrogel disclosed herein. Removing cellular material, for example when using ECM to form a hydrogel, can avoid this immune response.

[0169] U.S. Patent No. 8,361,503 (the entire contents of which are incorporated herein by reference for all purposes) discloses the preparation of a bladder ECM, such as a porcine bladder ECM, by abrading the bladder tissue using a longitudinal wiping motion with a scalpel handle and moistened gauze to remove the outer layer, including the serosal and muscular layers. After eversion of the tissue segment, the lumen portion of the mucosal layer is peeled away layer by layer from the underlying tissue using the same wiping motion. In some respects, this prevents perforation of the submucosal layer. After removing these tissues, the resulting ECM consists primarily of the submucosal layer.

[0170] Wolf et al., Biomaterials 33: 7028-7038, 2012 discloses the production of hydrogels from dermal ECM, which is incorporated herein by reference. For example, Badylak et al. J Pediatr Surg. 35(7):1097-103, 2000 and Badylak et al., J Surg Res. 2005 September; 128(1):87-97, 2005 disclose the production of ECM from esophageal tissue, both of which are incorporated herein by reference. U.S. Patent No. 6,893,666 discloses the production of ECM from the bladder, skin, esophagus, and small intestine, which is incorporated herein by reference. ECM can be produced from any of these tissues.

[0171] Commercially available ECM preparations may also be used. In one aspect, the ECM is derived from the submucosa of the small intestine or SIS. Commercially available preparations include, but are not limited to, those derived from the submucosa of the small intestine. , , , and (CookUrological Inc.; Indianapolis, Indiana) and (Organogenesis Inc.; Canton, Massachusetts). In another respect, ECM is derived from the dermis. Commercially available preparations include, but are not limited to, those from the dermis. (in Europe) For Sale; Covington, Bard, Georgia (Microvasive; Boston, Massachusetts) and (LifeCell; Blancheburg, NJ). In another aspect, ECM is derived from the bladder. Commercially available preparations include, but are not limited to, UBM (Acell Corporation; Jessup, Maryland).

[0172] Tissues used for preparing ECM can be collected in various ways, and once collected, individual portions of the collected tissue can be used. ECMs are also prepared from the esophagus and small intestine, see, for example, Keane et al., Tissue Eng. Part A, 21(17-18): 2293-2300, 2015, incorporated herein by reference. Esophageal ECMs can be prepared by mechanically separating the mucosal and submucosa from the outer muscularis propria, digesting the mucosal layer in a buffer containing trypsin, and then exposing it to sucrose, TRITON-X100®, deoxycholic acid, peracetic acid, and DNase. Small intestinal submucosa (SIS) can be prepared by mechanically removing the surface of the mucosal, serosa, and outer muscularis propria from the intact small intestine, preserving the intact submucosa, muscularis mucosae, and basal compacta. The SIS is then treated with peracetic acid. Keane et al. provides an exemplary protocol. For example, dermal hydrogels can be used, for example, as in Wolf et al. J Biomed Mater Res The preparation method disclosed in A. 2013. 35(25):6838–49. PMID: 23873846.PMCID: 3808505 is incorporated herein by reference.

[0173] In one aspect, the extracorporeal membrane (ECM) is isolated from the collected pig bladder to prepare the bladder matrix (UBM). Excess connective tissue and residual urine are removed from the bladder. The serosal layer, outer muscular layer, submucosa, and most of the muscular mucosa can be removed by mechanical abrasion or by a combination of enzymatic treatment, hydration, and abrasion. Mechanical removal of these tissues can be achieved by abrasion using longitudinal wiping motions to remove the outer layers (particularly the extraluminal smooth muscle layer) and even the luminal portion of the mucosa (epithelial layer). Mechanical removal of these tissues can be achieved by removing mesenteric tissue using, for example, Adson-Brown forceps and Metzenbaum scissors, and by longitudinal wiping motions using a scalpel handle or other rigid object wrapped in moist gauze to remove the muscular and submucosa. The epithelial cells of the mucosa can also be separated by immersing the tissue in a deepithelializing solution, such as, but not limited to, hypertonic saline. The resulting UBM comprises a basement membrane of the mucosal layer and an adjacent intrinsic layer, which is further treated with peracetic acid, lyophilized and powdered, see U.S. Patent No. 8,361,503, which is incorporated herein by reference.

[0174] Dermal sections can be used to prepare ECM hydrogels; see PCT application number 2015 / 15164728, which is incorporated herein by reference. In a particular, non-limiting example, dermis can be decellularized at room temperature on a vortex mixer at 300 RPM with 0.25% trypsin / 1% TRITON-X®-100 (i.e., SDS-free) in the following solutions: 0.25% trypsin for 6 h, lx; deionized water, 15 min, 3x; 70% ethanol, 10 to 12 h, lx; 3% H2O2, 15 min, lx; deionized water, 15 min, 2x; 1% TRITON-X®-100 in 0.26% EDTA / 0.69% Tris, 6 h, lx, then overnight, lx; deionized water, 15 min, 3x; 0.1% peracetic acid / 4% ethanol, 2 h, lx; PBS, 15 min, 2x; and finally deionized water, 15 min, 2x. The leather flakes were then freeze-dried and subsequently reduced to granular form using a Waring mixer and a Wiley Mill equipped with a #20 mesh sieve.

[0175] In some cases, epithelial cells can be delaminated by first immersing the tissue in a deepithelializing solution such as hypertonic saline (e.g., but not limited to 1.0N saline) for a period of 10 minutes to 4 hours. Exposure to the hypertonic saline solution effectively removes epithelial cells from the underlying basement membrane. The remaining tissue after the initial delamination step comprises the epithelial basement membrane and the extraluminal tissue layer of the epithelial basement membrane. This tissue is then further processed to remove most of the extraluminal tissue, but not the epithelial basement membrane. The outer serosa, adventitia, smooth muscle tissue, submucosa, and most of the muscularis mucosae are removed from the remaining deepithelialized tissue by mechanical abrasion or by a combination of enzymatic treatment, hydration, and abrasion.

[0176] In some respects, ECM itself can be sterilized using a variety of standard techniques, including but not limited to exposure to peracetic acid, low-dose gamma radiation, gas plasma sterilization, ethylene oxide treatment, or electron beam treatment. More typically, ECM sterilization is achieved by immersion in 0.1% (v / v) peracetic acid, 4% (v / v) ethanol, and 95.9% (v / v) sterile water for two hours. Peracetic acid residue is removed by washing twice with PBS (pH=7.4) for 15 minutes and then twice with sterile water for 15 minutes. ECM materials can be sterilized by treatment with propylene oxide or ethylene oxide, gamma irradiation (0.05 to 4 mRad), gas plasma sterilization, peracetic acid sterilization, or electron beam treatment. ECM can also be sterilized by treatment with glutaraldehyde, which causes cross-linking of protein materials, but this treatment substantially alters the material, making it slowly or not absorbed at all, and triggering different types of host remodeling that are closer to scar tissue formation or encapsulation than constructive remodeling. Cross-linking of protein materials can also be induced using carbodiimide, dehydrothermal methods, or photo-oxidation. As disclosed in US Patent No. 8361503, ECM was sterilized by immersion in 0.1% (v / v) peracetic acid (a), 4% (v / v) ethanol, and 96% (v / v) sterile water for 2 hours. The ECM material was then washed twice with PBS (pH=7.4) for 15 minutes each time, and then washed twice with deionized water for 15 minutes each time.

[0177] Typically, after isolating the tissue of interest, decellularization is performed using various methods, such as, but not limited to, exposure to hypertonic saline, peracetic acid, TRITON-X®, or other detergents. Sterilization and decellularization can be performed simultaneously. For example, but not limited to, the peracetic acid sterilization described above can also be used for decellularization. The ECM can then be dried, lyophilized (freeze-dried), or air-dried. The dried ECM can be pulverized by methods including, but not limited to, tearing, grinding, chopping, milling, and shearing. The pulverized ECM can also be further processed into powder form by methods such as, but not limited to, grinding or milling in a frozen or lyophilized state.

[0178] Mammalian ECMs are also commercially available products. These include... , and These commercially available products can also be used to produce mammalian acoustic ECM hydrogels.

[0179] Preparation of acoustic ECM-hydrogels In some cases, pulverized ECM, such as mammalian ECM, is diluted in a liquid to prepare an acoustic ECM hydrogel. The ECM may or may not be lyophilized prior to pulverization. The ECM may be pulverized, for example by grinding, chopping, or shredding the ECM. The pulverized ECM should have fragments ranging from about 10 µm to about 5000 µm, about 10 µm to about 4000 µm, about 10 µm to about 3000 µm, about 10 µm to about 2000 µm, about 10 µm to about 1000 µm, about 10 µm to about 500 µm, about 30 µm to about 300 µm, about 40 µm to about 400 µm, about 25 µm to about 500 µm, about 50 µm to about 500 µm, about 100 µm to about 300 µm, about 10 µm to about 50 µm, or 10 µm to 100 µm. In one aspect, the ECM is provided in fragments of about 10 µm to about 1000 µm. In another preferred aspect, the ECM is provided in fragments of about 10 µm to about 2000 µm. In a non-limiting example, these fragments are in the range of about 30 µm to about 300 µm. The liquid can be a buffer solution with a neutral pH, such as pH of about 7.0 to about 7.6, about 7.1 to about 7.5, about 7.2 to about 7.4, about 7.0 to 7.2, about 7.0 to 7.4, or about 7.1, 7.2, 7.3, 7.4, 7.5, or 7.6. The ECM can be diluted in an isotonic buffered saline solution, such as, but not limited to, phosphate-buffered saline (PBS) or Tris-buffered saline. In some aspects, the buffered saline solution has an osmotic pressure of about 290 mOsm / L. The liquid can be water. In some respects, isotonic buffers, including but not limited to phosphate-buffered saline (PBS), can be used to bring a solution to a target pH or help maintain the pH and ionic strength of a gel at target levels, such as physiological pH and ionic state. This forms a liquid ECM solution.

[0180] Methods for preparing acoustic hydrogels typically do not involve the use of acidic proteases, including pepsin, trypsin, or hyaluronidase, nor do they involve enzymatic digestion of ECM tissue. See PCT application WO 2015 / 164728, which is incorporated herein by reference. Generally, dissolved ECM in a liquid does not come into contact with acidic proteases.

[0181] Methods for preparing extracellular matrix hydrogels using acoustic techniques such as ultrasonic frequencies are described in U.S. Patent Application Publication No. 2022 / 0143265, the contents of which are incorporated herein by reference for all purposes. In some aspects, ECM is used in liquids at concentrations greater than about 25 mg / ml. ECM can be used in liquids such as buffers at concentrations from about 25 mg / ml to about 600 mg / ml. Suitable concentrations also include about 25 mg / ml to about 300 mg / ml, about 25 mg / ml to about 200 mg / ml, and about 25 mg / ml to about 150 mg / ml. ECM can be used in liquids such as buffers at concentrations from about 50 mg / ml to 600 mg / ml. Suitable concentrations also include about 50 mg / ml to about 300 mg / ml, about 50 mg / ml to about 200 mg / ml, and about 50 mg / ml to about 150 mg / ml. Suitable concentrations include about 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200 mg / ml. Exemplary concentrations include about 25 mg / ml, 100 mg / ml, and 150 mg / ml. In one non-limiting example, the concentration of ECM in a liquid is about 25 mg / ml to about 150 mg / ml. In one non-limiting example, the concentration of ECM in a liquid is 100 mg / ml.

[0182] ECM in liquids such as buffered saline solutions is treated with ultrasonic frequencies. In one aspect, the ultrasonic frequency is from about 20 kHz to about 100 kHz. ECM in liquids can be treated with ultrasonic frequencies from about 20 kHz to about 30 kHz, from about 20 kHz to about 40 kHz, from about 20 kHz to about 50 kHz, from about 20 kHz to about 60 kHz, from about 20 kHz to about 70 kHz, from about 20 kHz to about 80 kHz, or from about 20 kHz to about 90 kHz. ECM in liquids can be treated with ultrasonic frequencies from about 20 kHz, 30 kHz, 40 kHz, 50 kHz, 60 kHz, 70 kHz, 80 kHz, 90 kHz, or 100 kHz. In a non-limiting example, ECM in liquids can be treated with ultrasonic frequencies from about 20 kHz.

[0183] ECM in liquids such as buffered saline solutions is sonicated for at least 20 seconds, such as at least 30 seconds. ECM in liquids such as buffered saline solutions is sonicated for at least 60 seconds. In some aspects, ECM in liquids is sonicated for at least 60 seconds to about 1 hour. In further aspects, ECM in liquids is sonicated for at least 60 seconds to about 30 minutes. In further aspects, ECM in liquids is sonicated for at least 30 seconds to about 30 minutes. In many more aspects, ECM in liquids is sonicated for at least 60 seconds to about 15 minutes. In many more aspects, ECM in liquids is sonicated for at least 30 seconds to about 15 minutes. In some aspects, ECM in liquids is sonicated for at least 60 seconds to about 10 minutes. In some aspects, ECM in liquids is sonicated for at least 30 seconds to about 10 minutes. In some aspects, ECM in liquids is sonicated for at least 60 seconds to about 5 minutes. In some aspects, ECM in liquids is sonicated for at least 30 seconds to about 5 minutes. ECM in liquids can be treated with ultrasound for approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 minutes. In some cases, ECM in liquids is treated with pulsed ultrasound, with the total time as listed in this article. Therefore, in some respects, ECM in liquids such as buffered saline solutions is treated with pulses, such as pulses of at least about 30 seconds, or pulses of about 30, 40, or 60 seconds. ECM in liquids such as buffered saline solutions can be treated with ultrasound 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times, so that the total treatment time is from 60 seconds to 1 hour, or any total time listed. ECM in liquids such as saline solutions can be treated for 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 seconds. ECM in liquids such as saline solutions can be treated for at least 30 seconds. Typically, if multiple treatments are used, they occur within a timeframe of less than one hour. An exemplary method is a 30-second ultrasonic pulse, followed by 30 to 45 seconds of no treatment, and then another treatment. This treatment can be applied 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more times.One exemplary, non-limiting method is six 30-second ultrasound pulses, for example at a frequency of about 20 kHz, followed by a 45-second pause, repeated six times for a total of three minutes of ultrasound treatment.

[0184] The amplitude of ultrasound is from approximately 20 µm to approximately 320 µm. Typically, the amplitude is measured from the center of the probe used to generate the ultrasound. The amplitude of the probe's vibrating surface, i.e., the distance between the probe's positions in its fully extended and fully retracted states, is measured in micrometers (µm). In some aspects, the amplitude is from approximately 30 µm to approximately 200 µm. In further aspects, the amplitude is from approximately 36 µm to approximately 180 µm. The amplitude can be approximately 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 150, 160, 70, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 µm. In some respects, the amplitude can be approximately 30-40 μm, 40-50 μm, 50-60 μm, 60-70 μm, 70-80 μm, 80-90 μm, 90-100 μm, 100-110 μm, 110-120 μm, 120-130 μm, 130-140 μm, 140-150 μm, 150-160 μm, 160-170 μm. The ultrasound pulses are 0 μm, 170-180 μm, 180-190 μm, 190-200 μm, 200-210 μm, 210-220 μm, 220-230 μm, 230-240 μm, 240-250 μm, 250-260 μm, 260-270 μm, 270-280 μm, 280-290 μm, or 290-300 μm. In one particular non-limiting example, the ultrasound frequency is about 20 kHz, and the amplitude is about 36 μm to about 180 μm. In another non-limiting example, the ultrasound frequency is about 20 kHz, the amplitude is about 36 μm to about 180 μm, and the total treatment time is about 1, 2, 3, 4, or 5 minutes, for example, about 3 minutes. Ultrasonic treatment can last for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 minutes. Ultrasonic treatment can also last from about 30 seconds to about 5 minutes. Ultrasonic treatment can, for example, last from about 1 to about 5 minutes. Ultrasonic treatment can last from about 1 to about 10 minutes. For example, ultrasonic treatment can last from 1 to about 20 minutes. In many other respects, ultrasonic treatment can be less than about 1 hour, less than about 30 minutes, less than about 20 minutes, or less than about 10 minutes. In some respects, ultrasonic treatment can be at least 30 seconds. In other respects, ultrasonic treatment can last from about 10 minutes to about 24 hours, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours. In some respects, ultrasonic treatment can last up to 48 hours.

[0185] In some aspects, the ECM in the liquid is ultrasonically treated in a temperature range of about 30°C to about 43°C. In one aspect, the ECM in the liquid is ultrasonically treated in a temperature range of about 35°C to about 40°C. In another aspect, the ECM in the liquid is ultrasonically treated in a temperature range of about 36°C to about 38°C. In yet another aspect, the ECM in the liquid is ultrasonically treated in a temperature range of about 37°C or higher, for example, about 37°C to about 55°C, such as about 37°C to about 50°C, such as about 37°C to about 45°C, such as about 37°C to about 40°C. The ECM in the liquid is ultrasonically treated at temperatures of about 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55°C. In a further aspect, the ECM in the liquid is ultrasonically treated at temperatures above about 38°C, such as about 38°C to about 50°C, such as about 38°C to about 45°C, such as about 38°C to about 40°C.

[0186] In some cases, ultrasonic treatment is used to produce acoustic ECM hydrogels. Acoustic ECM hydrogels typically undergo a phase transition from sol to gel at around 37°C, thus transforming into a liquid phase above 37°C and a gel phase below 37°C. At 37°C, the acoustic ECM hydrogel is sufficiently viscous, resembling a gel; however, as the temperature rises above 37°C, the gel transforms back into a sol. When the temperature drops below 37°C, the acoustic ECM hydrogel forms a gel (sol-to-gel transition). Therefore, in some cases, after ultrasonic treatment, the acoustic ECM hydrogel is cooled to temperatures below 37°C, such as from about 4°C to about 36°C. The acoustic ECM hydrogel can be cooled to room temperature, typically about 25°C. In some cases, the acoustic ECM hydrogel is cooled to about 15°C to about 25°C. The acoustic ECM hydrogel can be cooled to about 23°C to about 27°C. Acoustic ECM hydrogels can be cooled to approximately 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30°C to induce a gel phase.

[0187] In some aspects, exogenous MBV can be added to the ECM solution prior to sonication. In other aspects, exogenous MBV can be added to the acoustic ECM hydrogel after sonication. Exogenous MBV can be added to the ECM hydrogel before it transforms into a gel (e.g., when it is in the liquid phase); thus, in one aspect, exogenous MBV is added to the acoustic ECM hydrogel at a temperature above 37°C to produce a composition comprising the acoustic hydrogel containing exogenous MBV disclosed herein. In another aspect, exogenous MBV is added to the acoustic ECM hydrogel during its gelation stage, for example, at a temperature below 37°C. For example, an acoustic ECM hydrogel containing exogenous MBV is disclosed herein.

[0188] In some aspects, acoustic mammalian ECM hydrogels are disclosed, wherein the hydrogel is thermally reversible, wherein the hydrogel is a solid (gel) phase at temperatures below about 37°C and a liquid (sol) phase above 37°C. The acoustic hydrogels can be produced using any of the methods disclosed herein. In some respects, the storage modulus (G') of the acoustic ECM hydrogel is about an order of magnitude higher than its loss modulus (G"). In a further respect, the viscosity of the acoustic ECM hydrogel decreases with increasing stress at temperatures ranging from about 15 to about 37°C, for example at about 15, 15, 16, 17, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, and / or 36°C. In another respect, the viscosity of the acoustic ECM hydrogel decreases with increasing stress at room temperature and / or at about 23°C to about 27°C and / or about 15°C to about 25°C. In one respect, the acoustic ECM hydrogel transforms from a gel to a sol at about 37°C, making the hydrogel suitable for use as a submucosal pad because it has sufficient viscosity at body temperature.

[0189] These acoustic ECM hydrogels can be made from any mammalian ECM disclosed above. In a specific, non-limiting example, the ECM is a human ECM. In other non-limiting examples, the ECM is a bladder ECM, a submucosal ECM of the small intestine, an esophageal ECM, or a dermal ECM. In one aspect, the ECM is a bladder ECM. In another aspect, the ECM is a dermal ECM. In yet another aspect, the ECM is an esophageal ECM. The ECM can be derived from, for example, pigs, cattle, or sheep.

[0190] In some aspects, the acoustic ECM hydrogel comprises ECM concentrations of about 25 mg / ml to about 600 mg / ml. In further aspects, the acoustic ECM hydrogel comprises ECM concentrations of about 20 mg / ml to about 600 mg / ml, about 25 mg / ml to about 300 mg / ml, about 25 mg / ml to about 200 mg / ml, and about 25 mg / ml to about 150 mg / ml. In still other aspects, the acoustic ECM hydrogel comprises ECM concentrations of about 50 mg / ml to 600 mg / ml in a liquid, such as in a buffer solution. The acoustic ECM hydrogel may also have ECM concentrations of about 50 mg / ml to about 300 mg / ml, about 50 mg / ml to about 200 mg / ml, about 50 mg / ml to about 150 mg / ml, about 50-100 mg / ml, or about 100-150 mg / ml. In some non-limiting examples, acoustic ECM hydrogels include ECM concentrations of about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195 and 200 mg / ml. In some non-limiting examples, acoustic ECM hydrogels include concentrations of about 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80, 80-85, 85-90, 90-95, 95-100, 100-105, 105-110, and 110-115. ECM concentrations of 115-120, 120-125, 125-130, 130-135, 135-140, 140-145, 145-150, 150-155, 155-160, 160-165, 165-170, 170-175, 175-180, 180-185, 185-190, 190-195, and 195-200 mg / ml are permitted. Exemplary non-limiting concentrations of ECM also include about 25 mg / ml, 100 mg / ml, and 150 mg / ml. In one non-limiting example, the acoustic ECM hydrogel comprises ECM concentrations of about 25 mg / ml to about 150 mg / ml. In one aspect, the ECM concentration is about 100 mg / ml.

[0191] In some respects, when the ECM concentration is approximately 150 mg / mL, the viscosity of the acoustic ECM hydrogel at 15°C is approximately 1400. At 25°C, the viscosity is approximately 400. In other aspects, the acoustic ECM hydrogel has a storage modulus of approximately 2700 at 15°C when the ECM concentration is approximately 150 mg / mL. At 25°C, it is approximately 800. And at 37°C, it is 600 .

[0192] Acoustic ECM hydrogels in the liquid phase can be placed into a 3D model before cooling or laid on TEFLON® sheets to form a thin film. The high concentration of ECM in the acoustic ECM hydrogel (50 to 600 mg / ml) allows for the formation of very thin sheets, such as sheets as thin as 4 micrometers. Acoustic ECM hydrogels can be configured to any size greater than 4 micrometers and can be any two-dimensional or three-dimensional shape. In some aspects, sheets with a thickness of about 4 to about 10 micrometers are formed, such as about 4, 5, 6, 7, 8, 9, or 10 micrometers. Acoustic ECM hydrogels can be formed into any three-dimensional shape, including but not limited to cylinders, spheres, ellipsoids, disks, sheets, cubes, cuboids, cones, triangular or rectangular prisms, as well as hollow spheres, hollow ellipsoids, and open hollow cylinders. Acoustic ECM hydrogels can also be used as injectables, for example, by placing them in a syringe and then extruding them from the syringe as a gel or sol phase.

[0193] In some aspects, mammalian acoustic ECM hydrogels include dissolved ECM at concentrations greater than about 0.1 mg / ml. Mammalian acoustic ECM hydrogels may include dissolved ECM at concentrations from about 0.1 mg / ml to about 1000 mg / ml. Suitable concentrations also include dissolved ECM at concentrations from about 1 mg / ml to about 1000 mg / ml, from 1 mg / ml to about 500 mg / ml, from 1 mg / ml to about 300 mg / ml, from 1 mg / ml to about 200 mg / ml, from about 1 mg / ml to about 100 mg / ml, from about 10 mg / ml to about 200 mg / ml, from about 100 mg / ml to about 500 mg / ml, from about 50 mg / ml to about 150 mg / ml, from about 20 mg / ml to about 70 mg / ml, from about 4 mg / ml to about 20 mg / ml, or from about 40 mg / ml to about 66 mg / ml. Mammalian acoustic ECM hydrogels may comprise dissolved ECM at concentrations from about 10 mg / ml to about 500 mg / ml in a liquid such as a buffer. Mammalian acoustic ECM hydrogels may comprise dissolved ECM at concentrations of 10, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200 mg / ml. Exemplary concentrations include dissolved ECM at concentrations of about 20 mg / ml, 40 mg / ml, 66 mg / ml, 70 mg / ml, and 150 mg / ml. In one non-limiting example, the mammalian acoustic ECM hydrogel comprises dissolved ECM at a concentration of about 20 mg / ml to about 70 mg / ml. In one non-limiting example, the mammalian acoustic ECM hydrogel comprises dissolved ECM at a concentration of about 40 mg / ml or about 66 mg / ml. In one non-limiting example, the mammalian acoustic ECM hydrogel comprises dissolved ECM at a concentration of about 10 mg / ml to about 100 mg / ml. In one non-limiting example, the mammalian acoustic ECM hydrogel comprises dissolved ECM at a concentration of about 50 mg / ml to about 150 mg / ml. In one non-limiting example, the mammalian acoustic ECM hydrogel comprises dissolved ECM at a concentration of about 10 mg / ml to about 200 mg / ml. In one non-limiting example, the mammalian acoustic ECM hydrogel comprises dissolved ECM at a concentration of about 10 mg / ml to about 500 mg / ml.

[0194] Exemplary concentrations include dissolved ECM at concentrations of approximately 20 mg / ml, 40 mg / ml, 66 mg / ml, 70 mg / ml, and 150 mg / ml. In one non-limiting example, the mammalian acoustic ECM hydrogel comprises dissolved ECM at concentrations of approximately 20 mg / ml to approximately 70 mg / ml. In one non-limiting embodiment, the mammalian acoustic ECM hydrogel comprises dissolved ECM at concentrations of approximately 40 mg / ml or approximately 66 mg / ml.

[0195] In some aspects, the mammalian acoustic ECM hydrogel comprises dissolved ECM at concentrations of about 25 mg / ml to about 600 mg / ml. In further aspects, the mammalian acoustic ECM hydrogel comprises dissolved ECM at concentrations of about 20 mg / ml to about 600 mg / ml, about 25 mg / ml to about 500 mg / ml, about 25 mg / ml to about 400 mg / ml, about 25 mg / ml to about 300 mg / ml, about 25 mg / ml to about 200 mg / ml, and about 25 mg / ml to about 150 mg / ml. In still other aspects, the mammalian acoustic ECM hydrogel comprises dissolved ECM at concentrations of about 50 mg / ml to 600 mg / ml. The mammalian acoustic ECM hydrogel may further comprise dissolved ECM at concentrations of about 50 mg / ml to about 300 mg / ml, about 50 mg / ml to about 200 mg / ml, about 50 mg / ml to about 150 mg / ml, about 50-100 mg / ml, or about 100-150 mg / ml. In some non-limiting embodiments, the mammalian acoustic ECM hydrogel comprises concentrations of about 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80, 80-85, 85-90, 90-95, 95-100, 100-105, 105-110, and 110-110. 5. Dissolved ECM at concentrations of 115-120, 120-125, 125-130, 130-135, 135-140, 140-145, 145-150, 150-155, 155-160, 160-165, 165-170, 170-175, 175-180, 180-185, 185-190, 190-195 and 195-200 mg / ml.

[0196] In some aspects, a composition comprising a mammalian acoustic ECM hydrogel and trehalose is produced. In more aspects, the composition used comprises about 0.1 mg / ml to about 700 mg / ml of trehalose. In some aspects, the composition comprises about 1 mg / ml of trehalose to about 700 mg / ml of trehalose. In a further aspect, the composition comprises about 50 mg / ml to about 500 mg / ml of trehalose. In other aspects, the composition comprises about 10 mg / ml of trehalose to about 600 mg / ml, about 10 mg / ml to about 500 mg / ml, about 10 mg / ml to about 400 mg / ml, about 10 mg / ml to about 300 mg / ml, about 10 mg / ml to about 200 mg / ml, or about 10 mg / ml to about 100 mg / ml of trehalose. In a further aspect, the composition may include about 0.1 to about 100 mg / ml of trehalose, about 0.1 to about 10 mg / ml of trehalose, or about 0.1 to about 1 mg / ml of trehalose. In more aspects, the composition may include about 50 mg / ml to about 400 mg / ml of trehalose, about 50 mg / ml to about 300 mg / ml of trehalose, about 50 mg / ml to about 200 mg / ml of trehalose, or about 50 mg / ml to about 100 mg / ml of trehalose. In some aspects, the composition includes about 20 mg / ml to about 70 mg / ml of trehalose. In some aspects, the composition includes about 10 mg / ml to about 100 mg / ml of trehalose. In some aspects, the composition includes 15-30 mg / ml of trehalose. In some aspects, the composition includes 60-70 mg / ml of trehalose. In some aspects, the composition includes 20 mg / ml of trehalose. In some aspects, the composition comprises 66 mg / ml of trehalose. In other aspects, the composition may comprise about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 66, 70, 80, 90, 100, 200, 300, 400, 500, or 600 mg / ml of trehalose. In still other aspects, the composition comprises about 100 mg / ml to about 700 mg / ml of trehalose, such as about 100, 150, 20, 250, 300, 350, 400, 450, 500, 550, or 600 mg / ml of trehalose. In many more aspects, the composition may comprise about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 mg / ml of trehalose.

[0197] In more detail, the composition comprises a mammalian acoustic ECM hydrogel containing dissolved ECM, additional pulverized mammalian ECM, and optional trehalose. The pulverized ECM is neither sonicated nor dissolved in the hydrogel. The pulverized ECM is a distinct additive for compositions that also include mammalian ECM hydrogels. The composition may comprise about 1 to about 30% pulverized ECM, by weight / volume (w / v), which is not dissolved in the acoustic ECM hydrogel. Without being bound by theory, pulverized ECM typically contains intact collagen particles, while the collagen in the acoustic ECM hydrogel is destroyed by sonication, resulting in an increased content of soluble collagen (Hussey et al., Ultrasonic cavitation to prepare ECMhydrogels Acta Biomater. 2020 May;108:77-86, incorporated herein by reference in its entirety). Therefore, an acoustic ECM hydrogel composition containing additional pulverized mammalian ECM comprises both intact and destroyed collagen.

[0198] The composition may include about 5% to about 30% w / v, about 10% to about 30%, about 15% to about 30%, about 20% to about 30%, about 25% to about 30%, about 1% to about 20%, about 5% to about 20%, about 10% to about 20%, about 15% to about 20%, about 10% to about 20%, or about 15% to about 20% of ground ECM (w / v). The composition may include about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30% of ground ECM (w / v). The composition may include no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30% of ground ECM (w / v). The composition may include at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30% of ground ECM (w / v).

[0199] The pulverized ECM can originate from the same species as the mammalian acoustic ECM hydrogel. In one particular, non-limiting instance, both the mammalian acoustic ECM hydrogel and the pulverized ECM are from pigs. In other, non-limiting instances, both the mammalian acoustic ECM hydrogel and the pulverized ECM are from humans.

[0200] The pulverized ECM can originate from the same or different tissues as the mammalian acoustic ECM hydrogel. In one respect, the mammalian acoustic ECM hydrogel and the pulverized ECM originate from the same tissue. In another respect, the mammalian acoustic ECM hydrogel and the pulverized ECM are dermal ECM. In yet another respect, the mammalian acoustic ECM hydrogel and the pulverized ECM are porcine dermal ECM.

[0201] The composition can be sterilized before being applied to a subject. The composition can be sterilized using any method known to those skilled in the art, including filtration and radiation. In some aspects, the composition is sterilized with ionizing radiation, such as an electron beam or gamma rays. The composition can be sterilized by gamma rays, for example, by irradiation of 10 to 50 kGy, such as by irradiation of 15 to 45 kGy, 20 to 40 kGy, or 10 to 30 kGy. In some non-limiting examples, the composition is sterilized by irradiation of 10, 15, 20, 25, 30, 35, 40, 45, or 50 kGy. Typically, the composition is sterilized for a sufficient time to achieve undetectable live pathogens, such as, but not limited to, viruses and bacteria.

[0202] Preparation of enzymatic ECM-hydrogels Methods for preparing ECM hydrogels are disclosed above and are also disclosed, for example, in U.S. Patent No. 8361503, the contents of which are incorporated herein by reference for all purposes. Any type of extracellular matrix tissue can be used to prepare hydrogels that can be used in the methods disclosed herein (see U.S. Patent Nos. 4,902,508; 4,956,178; 5,281,422; 5,352,463; 5,372,821; 5,554,389; 5,573,784; 5,645,860; 5,771,969; 5,753,267; 5,762,966; 5,866,414; 6,099,567; 6,485,723; 6,576,265; 6,579,538; 6,696,270; 6,783,776; 6,793,939; 6,849,273;) related to ECM. 6,852,339; 6,861,074; 6,887,495; 6,890,562; 6,890,563; 6,890,564; and 6,893,666). In some aspects, the ECM is isolated from vertebrates, such as, but not limited to, warm-blooded mammalian vertebrates, including but not limited to humans, monkeys, horses, pigs, cattle, and sheep. In certain non-limiting instances, the ECM is of pig or human origin.

[0203] ECM can be derived from any organ or tissue, including but not limited to the bladder, intestines, liver, esophagus, and dermis. For example, ECM can be derived from the bladder, small intestine, heart, dermis, liver, kidneys, uterus, brain, blood vessels, lungs, bones, muscles, pancreas, placenta, stomach, spleen, colon, adipose tissue, and / or esophagus. ECM can be obtained from cell cultures. In one respect, ECM is isolated from the bladder. In another respect, ECM is derived from the esophagus. ECM may or may not include a basement membrane portion of the ECM. In some respects, ECM includes at least a portion of the basement membrane.

[0204] In some respects, such as U.S. Patent No. 8,361,503 (incorporated herein by reference), bladder ECM, such as porcine bladder ECM, is prepared by abrading bladder tissue using a longitudinal wiping motion with a scalpel handle and moistened gauze to remove the outer layer, which includes the serosal and muscular layers. After eversion of the tissue segment, the luminal portion of the mucosal layer is peeled away layer by layer from the underlying tissue using the same wiping motion. In some respects, this prevents perforation of the submucosal layer. After removal of these tissues, the resulting ECM is primarily composed of the submucosal layer. The preparation of hydrogels from decellularized dermal ECM is disclosed in Wolf et al., Biomaterials 33: 7028-7038, 2012, which is incorporated herein by reference. For example, methods for generating ECM from esophageal tissue are disclosed in Badylak et al. J Pediatr Surg. 35(7):1097-103, 2000 and Badylak et al., J Surg Res. 2005 September; 128(1):87-97, 2005, both of which are incorporated herein by reference. U.S. Patent No. 6,893,666 discloses methods for generating ECM from the bladder, skin, esophagus, and small intestine, which is also incorporated herein by reference.

[0205] Commercially available ECM preparations can also be used in the methods, apparatus, and compositions described herein. In one aspect, the ECM is derived from the submucosa of the small intestine or SIS. Commercially available preparations include, but are not limited to, those described herein. , , and (Cook Urological Inc.; Indianapolis, Indiana) and (Organogenesis Inc.; Canton, Massachusetts). In another respect, ECM is derived from the dermis. Commercially available preparations include, but are not limited to, those from the dermis. (in Europe) For Sale; Covington, Bard, Georgia (Microvasive; Boston, Massachusetts) and (LifeCell; Blancheburg, NJ). In another aspect, ECM is derived from the bladder. Commercially available preparations include, but are not limited to, UBM (Acell Corporation; Jessup, Maryland).

[0206] Tissues used for preparing ECM can be collected in various ways, and once collected, individual portions of the tissue can be used. ECMs are also prepared from the esophagus and small intestine, and hydrogels are also prepared from such ECMs; see, for example, Keane et al., TissueEng. Part A, 21(17-18): 2293-2300, 2015, incorporated herein by reference. Esophageal ECMs can be prepared by mechanically separating the mucosal and submucosa from the outer muscularis propria, digesting the mucosal layer in a buffer containing trypsin, and then exposing it to sucrose, TRITON-X100®, deoxycholic acid, peracetic acid, and DNase. Small intestinal submucosa (SIS) can be prepared by mechanically removing the mucosal, serosa, and outer muscularis propria from the intact small intestine, preserving the intact submucosa, muscularis mucosae, and basal compacta. The SIS is then treated with peracetic acid. Keane et al. provides an exemplary protocol. For example, dermal hydrogels can be prepared, for example, as in Wolf et al. J Biomed Mater Res The preparation method disclosed in A. 2013. 35(25):6838–49. PMID:23873846. PMCID: 3808505 is incorporated herein by reference.

[0207] In one aspect, the extracorporeal membrane (ECM) is isolated from the collected pig bladder to prepare the bladder matrix (UBM). Excess connective tissue and residual urine are removed from the bladder. The serosal layer, outer muscular layer, submucosa, and most of the muscular mucosa can be removed by mechanical abrasion or by a combination of enzymatic treatment, hydration, and abrasion. Mechanical removal of these tissues can be achieved by abrasion using longitudinal wiping motions to remove the outer layers (particularly the extraluminal smooth muscle layer) and even the luminal portion of the mucosa (epithelial layer). Mechanical removal of these tissues can be achieved by removing mesenteric tissue using, for example, Adson-Brown forceps and Metzenbaum scissors, and by longitudinal wiping motions using a scalpel handle or other rigid object wrapped in moist gauze to remove the muscular and submucosa. The epithelial cells of the mucosa can also be separated by immersing the tissue in a deepithelializing solution, such as, but not limited to, hypertonic saline. The resulting UBM comprises a basement membrane of the mucosal layer and an adjacent intrinsic layer, which is further treated with peracetic acid, lyophilized and powdered, see U.S. Patent No. 8,361,503, which is incorporated herein by reference.

[0208] Dermal sections can be used to prepare enzymatic ECM hydrogels, see PCT application number 2015 / 15164728, which is incorporated herein by reference. In one particular non-limiting example, dermis can be decellularized at room temperature on a vortex mixer at 300 RPM with 0.25% trypsin / 1% Triton X®-100 (i.e., SDS-free) in the following solutions: 0.25% trypsin for 6 h, lx; deionized water, 15 min, 3x; 70% ethanol, 10 to 12 h, lx; 3% H2O2, 15 min, lx; deionized water, 15 min, 2x; 1% Triton X®-100 in 0.26% EDTA / 0.69% Tris for 6 h, lx, then overnight, lx; deionized water, 15 min, 3x; 0.1% peracetic acid / 4% ethanol, 2 h, lx; PBS, 15 min, 2x; and finally deionized water, 15 min, 2x. The leather flakes were then freeze-dried and subsequently reduced to granular form using a Waring mixer and a Wiley Mill equipped with a #20 mesh sieve.

[0209] In some cases, epithelial cells can be delaminated by first immersing the tissue in a deepithelializing solution such as hypertonic saline (e.g., but not limited to 1.0N saline) for a period of 10 minutes to 4 hours. Exposure to hypertonic saline solution effectively removes epithelial cells from the underlying basement membrane. The remaining tissue after the initial delamination step includes the epithelial basement membrane and the tissue layer outside the lumen of the epithelial basement membrane. This tissue is then further processed to remove most of the extraluminal tissue, but not the epithelial basement membrane. The outer serosa, adventitia, smooth muscle tissue, submucosa, and most of the muscularis mucosae are removed from the remaining deepithelialized tissue by mechanical abrasion or by a combination of enzymatic treatment, hydration, and abrasion.

[0210] ECM can be sterilized using a variety of standard techniques, including but not limited to exposure to peracetic acid, low-dose gamma radiation, gas plasma sterilization, ethylene oxide treatment, or electron beam treatment. More typically, ECM sterilization is achieved by immersion in 0.1% (v / v) peracetic acid, 4% (v / v) ethanol, and 95.9% (v / v) sterile water for two hours. Peracetic acid residue is removed by washing twice with PBS (pH=7.4) for 15 minutes and twice with sterile water for 15 minutes. ECM materials can be sterilized by treatment with propylene oxide or ethylene oxide, gamma irradiation (0.05 to 4 mRad), gas plasma sterilization, peracetic acid sterilization, or electron beam treatment. ECM can also be sterilized by treatment with glutaraldehyde, which causes cross-linking of protein materials; however, this treatment substantially alters the material, making it slowly or not absorbed at all, and triggering different types of host remodeling that are more akin to scar tissue formation or encapsulation than constructive remodeling. Cross-linking of protein materials can also be induced using carbodiimide, dehydrothermal methods, or photo-oxidation. As disclosed in US Patent No. 8361503, ECM was sterilized by immersion in 0.1% (v / v) peracetic acid (a), 4% (v / v) ethanol, and 96% (v / v) sterile water for 2 hours. The ECM material was then washed twice with PBS (pH=7.4) for 15 minutes each time and twice with deionized water for 15 minutes each time.

[0211] After isolating the tissue of interest, decellularization is performed using various methods, such as, but not limited to, exposure to hypertonic saline, peracetic acid, TRITON-X®, or other detergents. Sterilization and decellularization can be performed simultaneously. For example, but not limited to, the peracetic acid sterilization described above can also be used for ECM decellularization. The decellularized ECM can then be dried, lyophilized (freeze-dried), or air-dried. The dried ECM can be pulverized by methods including, but not limited to, tearing, grinding, chopping, milling, and shearing. The pulverized ECM can also be further processed into powder form by methods such as, but not limited to, grinding or milling in a frozen or freeze-dried state. To prepare dissolved ECM tissue, the pulverized ECM is digested in an acidic solution with an acidic protease to form a digestion solution. The acidic protease can be, for example, trypsin and / or pepsin, or a combination thereof.

[0212] In one aspect, the decellularized ECM material was partially digested with acidic proteases. In one instance, the digestion of the decellularized ECM material was less complete than the digestion of 1 mg / mL lyophilized ECM powder with 1 mg / mL pepsin in 0.01 M HCl for 48 hours. In another instance, the digestion of the decellularized ECM material was less complete than the digestion of 10 mg / mL lyophilized ECM powder with 1 mg / mL pepsin in 0.01 M HCl for 48 hours. In a further aspect, the amount of hyaluronic acid digested in the ECM material was less than 50%, 40%, 30%, 25%, 20%, or 10% compared to undigested ECM material, see PCT application No. WO 2015 / 164728, which is incorporated herein by reference.

[0213] The digestion solution of ECM is typically stirred continuously at room temperature for a certain period of time. The ECM digestion solution can be used immediately or stored at -20°C, or frozen at, for example, but not limited to, -20°C or -80°C. This allows the ECM digestion solution to remain in a dissolved form. Methods for maintaining hydrogels in a dissolved form are disclosed, for example, in PCT application No. PCT / US16 / 52261, filed September 10, 2016, which is incorporated herein by reference.

[0214] Once the ECM is dissolved (usually substantially completely), the pH of the solution rises to between 7.2 and 7.8, and depending on one aspect, to pH 7.4. The pH can rise to approximately 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, or 7.8. Bases, such as those containing hydroxide ions, including NaOH, can be used to raise the pH of the solution. Similarly, buffers, such as isotonic buffers, including but not limited to phosphate-buffered saline (PBS), can be used to bring the solution to the target pH or help maintain the pH and ionic strength of the gel at target levels, such as physiological pH and ionic state. This forms a “pre-gel” solution, which is the dissolved ECM hydrogel. The neutralized digestion solution (pre-gel, dissolved ECM hydrogel) can gel at a lower critical solution temperature, see PCT Publication No. 2015 / 164728, which is incorporated herein by reference.

[0215] ECM hydrogels form a gel upon increasing temperature (sol-to-gel transition). The lowest critical solution temperature (LCST) for reverse gelation is the temperature below which the reverse gelling polymer is soluble in its solvent (e.g., water or an aqueous solvent). When the temperature of the reverse gel is raised above the LCST, a hydrogel forms. The general concept of polymer reverse gelation and its relationship to the LCST is well known in the field of chemistry. The ECM gels described herein are prepared, for example, from decellularized, intact ECM as described below, by digesting the ECM material with an acidic protease, neutralizing the material to form a pregel, raising the temperature of the pregel above the LCST of the pregel to gelle it, thereby forming a hydrogel. In the case of acidic protease digestion, the transition temperature from solution to gel is typically in the range of 10°C to 40°C, and any increments or ranges therebetween, such as 20°C to 35°C. For example, the pregel can be heated to 37°C to form a hydrogel.

[0216] Therefore, ECM can typically be derived from mammalian tissues, such as, but not limited to, the bladder, esophagus, or small intestine. In a particular, non-limiting instance, the ECM is derived from the bladder. According to one aspect, decellularized ECM material prepared from tissue is not dialyzed before partial or complete digestion with acidic proteases, and / or is not dialyzed after digestion with acidic enzymes and before gelation of the neutralized digested ECM material.

[0217] In one non-limiting aspect, the ECM is lyophilized and pulverized. The ECM is then dissolved in an acidic solution with an acidic protease to produce digested ECM, such as bladder ECM. The acidic protease may be, but is not limited to, pepsin or trypsin, or a combination thereof. The ECM can then be dissolved at an acidic pH suitable or most suitable for the protease, for example, greater than about pH 2, or between pH 2 and 4, for example, in a 0.01 M HCl solution. ECM is typically dissolved over about 12 to about 48 hours, depending on the tissue type (e.g., see examples below), and mixed (stirring, shaking, blending, mixing, rotating, tilting, etc.). ECM hydrogels are prepared by: (i) pulverizing the extracellular matrix, (ii) dissolving intact, undialyzed, or uncrosslinked extracellular matrix by digestion with an acidic protease in an acidic solution to produce a digested solution, (iii) raising the pH of the digested solution to between 7.2 and 7.8 to produce a neutralized digested solution (pre-gelled solution), and (iv) gelling the solution.

[0218] Therefore, an ECM composition containing exogenous MBV, which is digested by acidic protease in an acidic solution, is disclosed. When neutralized, for example to pH 7.0-7.8, and heated to about 37°C, the composition forms a gel, and the protease is inactivated. In one aspect, the exogenous MBV is not derived from bone or heart tissue. In a further aspect, the concentration of exogenous MBV in the composition is greater than 5 mg / mL.

[0219] Also disclosed is an ECM composition for enzymatic digestion in a neutral solution (e.g., pH 7.0-7.8), the solution containing an inactivated acidic protease, such as inactivated pepsin and / or trypsin, or another inactivated acidic protease whose active form is suitable for digesting ECM; the composition also contains exogenous MBV. The solution forms a gel upon heating to approximately 37°C. In one aspect, the exogenous MBV is not derived from bone or heart tissue. In a further aspect, the concentration of exogenous MBV in the composition is greater than 5 mg / mL. The acidic protease can be inactivated or deactivated due to, for example, changes in pH.

[0220] In a further aspect, the ECM hydrogel can be centrifuged and the soluble fractions collected. Exemplary methods for fractionation of ECM hydrogels are disclosed, for example, in PCT Publication No. WO 2015 / 164728, which is incorporated herein by reference. The method disclosed in that PCT publication includes partially or completely digesting decellularized ECM material prepared from tissue with an acidic protease (such as pepsin); neutralizing the digested ECM material to pH 7.0-8.0, 7.2-7.8, or 7.4; gelling the neutralized, digested ECM material at a temperature above its least critical solution temperature; centrifuging the gelled ECM material to produce a precipitate and a supernatant; and separating the supernatant and the precipitate, thereby separating the structural and soluble fractions of the ECM material.

[0221] ECM hydrogels form a gel when exposed to temperatures above their minimum critical solution temperature, such as about 37°C. ECM hydrogels in a “pre-gelated” form (dissolved ECM hydrogels) can be frozen and stored, for example, but not limited to, -20°C or -80°C. ECM hydrogels in a “pre-gelated” form can be stored at room temperature, for example, about 25°C. In some non-limiting instances, ECM hydrogels are in a pre-gelated form below 37°C, for example, at 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, and 4°C. ECM hydrogels can be frozen and therefore can be stored below 0°C. As used herein, the term “pre-gelated form” or “pre-gel” refers to an ECM hydrogel in which the pH value is elevated but not gelled. For example, but not limited to, the pH value of a pre-gelated ECM hydrogel is between 7.2 and 7.8. In some aspects, the methods disclosed herein use dissolved ECM hydrogels. Methods for maintaining hydrogels in dissolved form are disclosed, for example, in PCT application No. PCT / US16 / 52261, filed September 10, 2016, which is incorporated herein by reference. In some aspects, ECM compositions prepared by any of the methods described herein are absorbed, adsorbed, or otherwise dispersed onto or within a biocompatible substrate. Non-limiting examples of biocompatible substrates include: meshes, nonwovens, decellularized tissue, polymer compositions, polymeric structures, cell growth scaffolds, implants, orthopedic implants and intraocular lenses, sutures, intravascular implants, scaffolds, and transplantation materials. The compositions described herein may be applied to or incorporated into nonwoven materials, such as bandages, sutures, implants, such as ceramic, metallic, or polymeric implants, such as prostheses, artificial or otherwise modified blood vessels, valves, intraocular lenses, or tissue implants, by any suitable method. As used herein, the term "coat" and related cognates such as "coated" or "coating" refer to a process that includes partially or completely covering an inorganic structure with the composition described herein. For example, but not limited to, coating an inorganic structure with dissolved fractions can include methods such as casting, embedding, layering, impregnation, and spraying. Ultrasonic treatment can be used to aid in coating inorganic structures.

[0222] The composition used includes an ECM hydrogel that is an "enzymatically hydrolyzed" ECM hydrogel containing exogenous MBV. The addition of exogenous MBV enriches the bioactive properties of the ECM hydrogel and enhances its efficacy in reducing inflammation and promoting tissue growth and repair when administered or implanted in subjects. The enzymatically hydrolyzed ECM hydrogel is made from dissolved ECM. To prepare the dissolved ECM tissue, the pulverized ECM is digested in an acidic solution with an acidic protease to form a digestion solution. As used herein, the term "acidic protease" refers to an enzyme that cleaves peptide bonds, wherein the enzyme has enhanced peptide bond-cleaving activity at an acidic pH. For example, but not limited to, acidic proteases may include pepsin and trypsin. In one aspect, the ECM is lyophilized prior to pulverization.

[0223] The digestion solution for ECM is typically stirred continuously at room temperature for a certain period of time. The ECM digestion solution can be used immediately or stored at -20°C, or frozen at, for example, but not limited to, -20°C or -80°C. To form a “pre-gel” solution, the pH of the digestion solution is raised to between 7.2 and 7.8. The pH can be raised by adding one or more bases or isotonic buffer solutions, such as, but not limited to, NaOH or PBS at pH 7.4. This method typically does not include a dialysis step before gelation, resulting in a more complete ECM-like matrix that gels more slowly at 37°C than similar collagen or dialyzed ECM preparations. This gel is therefore easier to inject into patients and retains more of the properties of natural ECM due to the preservation of many natural soluble factors (such as, but not limited to, cytokines).

[0224] As used herein, the term "isotonic buffer solution" refers to a solution buffered to a pH between 7.2 and 7.8, having a balanced salt concentration to promote an isotonic environment. As used herein, the term "base" refers to any compound or compound solution with a pH greater than 7. For example, but not limited to, a base is an alkaline hydroxide or an aqueous solution of an alkaline hydroxide. In some respects, a base is NaOH or NaOH in PBS.

[0225] At this point, the "pre-gelled" solution can be incubated at a suitable warm temperature (e.g., but not limited to about 37°C) to gel. The pre-gel can be frozen and stored, for example, but not limited to, -20°C or -80°C. As used herein, the term "pre-gelled solution" or "pre-gel" refers to a digestive solution with an elevated pH. For example, but not limited to, the pH of the pre-gel is between 7.2 and 7.8. The ECM hydrogel composition may include inactivated acidic proteases. The pH of the ECM hydrogel composition may be between 7.2 and 7.8. The "pre-gel" may contain exogenous MBV. In one respect, the exogenous MBV is not derived from the cardiac or skeletal ECM.

[0226] ECM hydrogels, digestion solutions, or pregels may contain dissolved ECM at concentrations between 1 mg / mL and 500 mg / mL. In some aspects, the amount of ECM dissolved in the ECM hydrogel, digestion solution, or pregel is between 1 mg / mL and 400 mg / mL, for example, 1 mg / mL to 350 mg / mL, or 1 mg / mL to 300 mg / mL, or 1 mg / mL to 250 mg / mL, or 1 mg / mL to 200 mg / mL, or 1 mg / mL to 150 mg / mL, or 1 mg / mL to 100 mg / mL, or 1 mg / mL to 50 mg / mL, or 5 mg / mL to 250 mg / mL, or 20 mg / mL to 200 mg / mL, or 5 mg / mL to 200 mg / mL, or 5 mg / mL to 100 mg / mL. In other respects, the amount of ECM dissolved in the ECM hydrogel, digestion solution, or pregel is between about 5 mg / mL and about 50 mg / mL, for example, about 10 mg / mL to about 50 mg / mL, about 20 mg / mL to about 50 mg / mL, for example, about 30 mg / mL to about 50 mg / mL, about 40 mg / mL to about 50 mg / mL, about 5 mg / mL to about 40 mg / mL, about 5 mg / mL to about 30 mg / mL, about 5 mg / mL to about 20 mg / mL, or about 5 mg / mL to about 10 mg / mL. For example, the ECM hydrogel, digestion solution, or pregel may contain dissolved ECM at concentrations of about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, or 500 mg / mL. In one non-limiting example, the amount of ECM dissolved in the ECM hydrogel, digestion solution, or pregel is between 10 mg / mL and 30 mg / mL. In another non-limiting example, the amount of ECM dissolved in the ECM hydrogel, digestion solution, or pregel is between 1 mg / mL and 20 mg / mL. In yet another non-limiting example, the amount of ECM dissolved in the ECM hydrogel, digestion solution, or pregel is between 4 mg / mL and 20 mg / mL. In another non-limiting example, the amount of ECM dissolved in the ECM hydrogel, digestion solution, or pregel is between 1 mg / mL and 50 mg / mL. In some aspects, the amount of ECM dissolved in the ECM hydrogel, digestion solution, or pregel is about 5 to about 100 mg / mL, for example, 50 to 100 mg / mL, 25 to 75 mg / mL, 60 to 80 mg / mL, 40 to 60 mg / mL, 50 to 80 mg / mL, or about 30 to about 60 mg / mL.

[0227] Preparation of ECM hydrogels containing exogenous MBV Exogenous MBV can be added to ECM hydrogels (or pre-gels), such as enzymatic hydrogels or acoustic hydrogels as disclosed herein. Exogenous MBV can be present in the ECM hydrogel at a concentration of less than 1 mg / mL. For example, MBV can be present at a concentration of at least about 1 × 10⁻⁶ mg / mL. 5 To approximately 1×10 20 The concentration of particles / mL present in the ECM hydrogel is [missing value]. In some respects, exogenous MBV is present at a concentration of approximately 1 × 10 [missing value]. 5 To approximately 1×10 20 Particles / mL, for example, about 1×10 5 To approximately 1×10 18 Particles / mL, for example, about 1×10 5 To approximately 1×10 16 Particles / mL, for example, about 1×10 5 To approximately 1×10 14 Particles / mL, or for example, about 1 × 10⁻⁶ 5 To approximately 1×10 12 The concentration of particles / mL exists in the ECM hydrogel (or pre-gel). In some respects, exogenous MBV is present at a concentration of approximately 1 × 10⁻⁶. 6 To approximately 1×10 20 Particles / mL, for example, about 1×10 6 To approximately 1×10 18 Particles / mL, for example, about 1×10 6 To approximately 1×10 16 Particles / mL, for example, about 1×10 6 To approximately 1×10 14 Particles / mL, for example, about 1×10 6 To approximately 1×10 12 Particles / mL, for example, about 1×10 7 To approximately 1×10 12 Particles / mL, for example, about 1×10 7 To approximately 1×10 11 Particles / mL, for example, about 1×10 8 To approximately 1×10 12 Particles / mL, for example, about 1×10 8 To approximately 1×10 11 Particles / mL, for example, about 1×10 9 To approximately 1×10 12 Particles / mL, for example, about 1×10 9 To approximately 1×10 11 Particles / mL, for example, about 1×10 10 To approximately 1×10 12 Particles / mL, for example, about 1×10 10 To approximately 1×10 11Particles / mL, for example, about 1×10 11 To approximately 1×10 12 The particle / mL concentration is present in the ECM hydrogel (or pre-gel). In a non-limiting example, exogenous MBV is present at a concentration of approximately 1 × 10⁻⁶. 8 To approximately 1×10 11 The concentration of particles / mL is present. In a non-limiting example, exogenous MBV is present at a concentration of approximately 1 × 10⁻⁶. 5 To approximately 1×10 12 The concentration of particles / mL is present. In a non-limiting example, exogenous MBV is present at a concentration of approximately 1 × 10⁻⁶. 6 To approximately 1×10 12 The particle / mL concentration is present in the ECM hydrogels (or pre-gels) disclosed herein. In some respects, exogenous MBV is approximately 1 × 10⁻⁶. 6 1×10 7 1×10 8 1×10 9 1×10 10 1×10 11 1×10 12 1×10 14 1×10 16 1×10 18 Or approximately 1×10 20 The particle / mL concentration is present in the ECM hydrogel (or pre-gel). In other respects, exogenous MBV is present at approximately 5 × 10⁻⁶. 6 5×10 7 5×10 8 5×10 9 5×10 10 5×10 11 Or approximately 5×10 12 The particle / mL concentration is present in the ECM hydrogel (or pre-gel). In a specific, non-limiting example, the exogenous MBV is approximately 1 × 10⁻⁶. 11 The particle / mL concentration is present in the ECM hydrogel (or pre-gel). In another non-limiting example, exogenous MBV is present at a concentration of approximately 1 × 10⁻⁶. 12 The particle / mL concentration is present in the ECM hydrogel (or pre-gel). In a further non-limiting example, exogenous MBV is present at a concentration of approximately 1 × 10⁻⁶. 10 Particles / mL or approximately 1×10 9 The concentration of particles / mL exists in the ECM hydrogel (or pre-gel). In some respects, exogenous MBV is present at a concentration of approximately 1 × 10⁻⁶. 6 Up to 1×10 18 Particles / mL, for example, about 1×10 6 Up to 1×10 14 Approximately 1×1010 Up to 1×10 14 Approximately 1×10 12 Up to 1×10 18 Approximately 1×10 14 Up to 1×10 18 Approximately 1×10 10 Up to 1×10 18 The concentration of exogenous MBV is present in the ECM hydrogel (or pregel). In another non-limiting example, exogenous MBV is present in the ECM hydrogel (or pregel) at a concentration less than 1 mg / mL, such as ≤0.9 mg / mL, ≤0.8 mg / mL, ≤0.7 mg / mL, ≤0.6 mg / mL, ≤0.5 mg / mL, ≤0.4 mg / mL, ≤0.3 mg / mL, ≤0.2 mg / mL, ≤0.1 mg / mL, ≤90 µg / mL, ≤80 µg / mL, ≤70 µg / mL, ≤60 µg / mL, ≤50 µg / mL, ≤40 µg / mL, ≤30 µg / mL, ≤20 µg / mL, or ≤10 µg / mL, but greater than 0 µg / mL, such as greater than 0.1 µg / mL, or greater than 0.5 µg / mL, or greater than 1 µg / mL.

[0228] MBV can be added to hydrogels, for example, before the enzymatic hydrogel gels are gelled. For instance, MBV can be added to enzymatic hydrogels before raising the temperature above 25°C, such as 37°C. For instance, MBV can be added to acoustic hydrogels at any point after ECM sonication to produce the hydrogel.

[0229] Treatment This document discloses various methods for treating subjects with muscular dystrophy. These methods can be used to treat any of the disclosed conditions, covering a wide range of muscular dystrophy diseases. The methods involve directly administering MBV to subjects with muscular dystrophy, or using MBV in combination with cells to provide cells for adoptive transplantation to subjects, or preparing conditioned media for administering to subjects using cells cultured with MBV. In some instances, human subjects with muscular dystrophy are selected and treated according to the methods disclosed herein.

[0230] Muscle atrophy disorders include small muscle atrophy, muscular dystrophy, and other conditions that lead to muscle atrophy. For example, the treatments disclosed herein can be used to treat spinal muscular atrophy (SMA), such as infantile progressive spinal muscular atrophy (SMA type I), intermediate spinal muscular atrophy (SMA type II), juvenile spinal muscular atrophy (SMA type III), or adult spinal muscular atrophy (SMA type IV). The treatments disclosed herein can also be used to treat muscle atrophy occurring in cachexia or sarcopenia. The treatments disclosed herein can also be used to treat muscular dystrophy (MD), such as Becker MD, congenital MD, Duchenne MD, distal MD, Emery-Dreifuss MD, facioscapulohumeral MD (FSHD), Limb-Girdle MD, myotonic MD, oculopharyngeal MD, Bethlem myopathy, or Ullrich congenital muscular dystrophy. For example, the disclosed methods can be used to treat FSHD. For example, the methods disclosed herein can be used to treat SMA. Subjects suffering from SMA can be selected and treated using the disclosed methods.

[0231] The treatment method for promoting muscle regeneration or repair in subjects in need is also disclosed, wherein an effective amount of a composition comprising exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix is ​​administered to the subject, wherein the MBVs do not express CD63 and CD81 or CD63 lo CD81 lo Furthermore, the MBV in question does not contain alkaline phosphatase.

[0232] Administration of MBV In some respects, methods for treating subjects with muscular dystrophy are disclosed, the method comprising administering to the subject a composition comprising an effective amount of exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix, wherein the MBVs do not express CD63 and CD81 or CD63 lo CD81 lo Furthermore, it does not contain alkaline phosphatase. In another aspect, methods for promoting muscle regeneration or repair in subjects with need are disclosed, wherein an effective amount of a composition comprising exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix are administered to the subject, wherein the MBVs do not express CD63 and CD81 or CD63 lo CD81 lo Furthermore, it does not contain alkaline phosphatase. In all these respects, MBV can be prepared as disclosed herein.

[0233] MBV can be administered in the form of ECM hydrogels disclosed herein, such as enzymatic hydrogels or acoustic hydrogels. Enzymatic hydrogels may be in a pre-gelled state. Exogenous MBV contained in the hydrogel may be present in the hydrogel in the amounts described herein. MBV-containing ECM hydrogels can be administered systemically, such as intravenously. For example, MBV-containing ECM hydrogels can be applied topically to muscles affected by atrophy or malnutrition, as in any muscular dystrophy condition described herein. The amount of hydrogel applied will depend on the concentration of MBV in the hydrogel and the patient's desired outcome, including disease severity.

[0234] MBV can also be suspended in pharmaceutically acceptable carriers. For example, MBV can be provided in carriers such as balanced salt solutions or physiological saline, which can be isotonic, hypotonic, or hypertonic depending on the subject's needs. For example, the salt solution can be a magnesium chloride solution, sodium chloride solution, potassium chloride solution, or calcium chloride solution. The carrier can be lactated Ringer's solution, or a glucose or other sugar solution. The carrier can be appropriately buffered to maintain physiological pH in the subject. The carrier may include glycerol. MBV can be contained in a carrier at concentrations less than 1 mg / mL, such as ≤0.9 mg / mL, ≤0.8 mg / mL, ≤0.7 mg / mL, ≤0.6 mg / mL, ≤0.5 mg / mL, ≤0.4 mg / mL, ≤0.3 mg / mL, ≤0.2 mg / mL, ≤0.1 mg / mL, ≤90 µg / mL, ≤80 µg / mL, ≤70 µg / mL, ≤60 µg / mL, ≤50 µg / mL, ≤40 µg / mL, ≤30 µg / mL, ≤20 µg / mL, or ≤10 µg / mL, but greater than 0 µg / mL. ， For example, concentrations greater than 0.1 µg / mL, or greater than 0.5 µg / mL, or greater than 1 µg / mL are provided.

[0235] Depending on the concentration of MBV in the solution and the required dose, the amount of solution administered can be, for example, 100 μL to 10 mL.

[0236] MBV (e.g., in a pharmaceutically acceptable carrier or in a hydrogel prepared as described herein) may be administered to subjects, such as human subjects with muscular dystrophy, to treat muscular dystrophy. Muscular dystrophy can be any of those disclosed herein. Administration may be, for example, intravenous, intramuscular, or subcutaneous.

[0237] MBV can be administered to subjects daily, weekly, bi-weekly, monthly (e.g., approximately every 28 days), bi-monthly (e.g., approximately every 56 days), or bi-monthly (e.g., approximately every 84 days). The dosage and frequency of MBV administration can be adjusted based on the desired outcome and the type and severity of the subject's muscular dystrophy.

[0238] For example, the dosage for the subjects was approximately 1 × 10⁻⁶ per administration. 1 To approximately 1×10 20 MBV / kg body weight. For example, the dosage for a subject is approximately 1 × 10⁻⁶ per administration. 6 To approximately 1×10 20 MBV / kg body weight, for example, approximately 1×10 6 To approximately 1×10 12 MBV / kg body weight. In some embodiments, the dosage administered to the subject is approximately 1 × 10⁻⁶ per dose. 6 To approximately 1×10 19 MBV / kg body weight, approximately 1×10 6 To approximately 1×10 18 MBV, approximately 1×10 6 To approximately 1×10 17 MBV, approximately 1×10 6 To approximately 1×10 16 MBV, approximately 1×10 6 To approximately 1×10 15 MBV, approximately 1×10 6 To approximately 1×10 14 MBV, approximately 1×10 6 To approximately 1×10 13 MBV, approximately 1×10 6 To approximately 1×10 12 MBV. In other instances, the dosage administered to the subjects was approximately 1 × 10⁻⁶ per dose. 7 To approximately 1×10 11 MBV / kg body weight. In another instance, the subject was administered 1×10⁻⁶ MBV per dose. 7 Up to 1×10 8 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 8 Up to 1×10 10 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 9 Up to 1×10 10 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 6 Up to 1×10 8MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 7 Up to 1×10 9 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 8 Up to 1×10 11 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 9 Up to 1×10 11 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 10 Up to 1×10 11 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 11 Up to 1×10 12 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 6 Up to 1×10 14 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 12 Up to 1×10 14 MBV / kg body weight. In one embodiment, the MBV administration according to any of the above doses is systemic. For example, in one embodiment, it is administered intravenously. In another embodiment, it is administered by subcutaneous injection, such as intramuscular injection.

[0239] Adoptive transfer In some aspects, methods for treating patients with muscular dystrophy are disclosed, comprising administering to the patient a composition comprising an effective amount of exogenous MBV-treated myeloid progenitor cells or their progeny (“myeloid-derived cells”). In some embodiments, the myeloid-derived cells are macrophages. Macrophages are resident phagocytes in lymphoid and non-lymphoid tissues, possessing highly diverse functions in maintaining the biological integrity of an organism from development and homeostasis to repair and immune responses to pathogens. Macrophages perform these functions by clearing cellular debris, producing growth factors, efficiently phagocytosing (especially tumor cells), and producing inflammatory cytokines. Macrophages are generally classified into classically activated, pro-inflammatory, or M1 macrophages, and alternatively activated, anti-inflammatory, or M2 macrophages. In some aspects, the myeloid cells used in the disclosed methods are anti-inflammatory M2 macrophages.

[0240] M2 or anti-inflammatory macrophages (also known as alternative activated macrophages) can be induced by IL-4 or IL-13 secreted by innate and adaptive immune cells such as mast cells, basophils, and TH-2 lymphocytes. M2a or activated macrophages typically express surface markers including CD206, CD36, ILHRa, and CD163; transcription factors including STAT6, GATA3, SOCS1, and PPARγ; and metabolic enzymes including ARG1 and CARKL, and may secrete cytokines, including but not limited to IL-10 and TGFp. M2b or regulatory macrophages are typically induced by stimulation with immune complexes and TLR ligands or by IL-1R agonists. M2b macrophages typically express surface markers including CD86 and MHC-II molecules; transcription factors including STATS, IRF4, and p50 (NF-κb); and metabolic enzymes including ARG1 and CARKL. In some respects, myeloid-derived cells are M2b macrophages. M2c macrophages are activated by glucocorticoids or IL-10 and exhibit a strong anti-inflammatory spectrum and phagocytic activity of apoptotic bodies. M2c macrophages typically express surface markers including CD163, TLR1, and TLR8; transcription factors including STATS, STAT6, IRF4, and p50 (NF-κb); and metabolic enzymes including ARG1 and GS. M2c macrophages also typically secrete cytokines, including IL-10 and TGF-β. The expression of surface markers on M2 macrophages, including CD14, CD206, and CD163, has been described as being associated with phagocytic capacity (Schulz et al. In-Depth Characterization of Monocyte-Derived Macrophages using a Mass Cytometry-Based Phagocytosis Assay. Sci Rep 9, 1925 (2019), doi.Org / 10.1038 / s41598-018-38127-9). The disclosed method can utilize M2 macrophages, including M2a, M2b and / or M2c macrophages.

[0241] In some respects, the cells are myeloid progenitor cells or myeloid-derived cells, such as cells isolated directly from the subject (autologous) and / or isolated from the subject and treated with MBV. In other respects, the cells are derived from cell lines and treated with MBV. Cells may also be obtained from xenogeneic sources such as mice, rats, non-human primates, or pigs and treated with MBV. In some respects, these cells are human cells. In some respects, myeloid-derived cells such as M2 macrophages can be obtained from human induced pluripotent stem cells (IPSCs) (see Hansen et al., Stem cell research vol. 29 (2018): 232-244; Lachmannet et al., Stem cell reports vol. 4,2 (2015): 282-96. doi:10.1016 / j.stemcr.2015.01.005; Mukherjee et al., A Simple Multistep Protocol for Differentiating Human Induced Pluripotent Stem Cells into Functional Macrophages. In: Rousselet G. (eds) Macrophages. Methods in Molecular Biology, vol 1784. Humana Press, New York, NY.).

[0242] Regarding the subject to be treated, myeloid progenitor cells or myeloid-derived cells can be allogeneic and / or autologous. Cells and compositions are typically isolated from a sample, particularly a biological sample, which is obtained from or derived from the subject, for example. The subject typically requires cell therapy (adoptive cell therapy) and / or will receive cell therapy. The subject is preferably a mammal, particularly a human.

[0243] In autologous adoptive cell transfer, myeloid progenitor cells or myeloid-derived cells are collected from the subject, treated with MBV, and returned to the subject. In allogeneic adoptive cell transfer, myeloid progenitor cells or myeloid-derived cells are collected from a healthy donor (not a patient), treated with MBV, and administered to an interested subject with muscular dystrophy to be treated. In some respects, these allogeneic cells are HLA-matched to reduce the likelihood of host rejection. Therefore, myeloid-derived cells, as described herein, may also include modifications, such as the disruption or removal of HLA class I molecules. For example, Torikai et al., Blood. 2013; 122: 1341-1349 and Ren et al., Clin. Cancer Res. 2017; 23:2255-2266.

[0244] In some respects, myeloid progenitor cells or myeloid-derived cells can be obtained from a collected blood unit, from bone marrow, or collected from a subject using a variety of techniques known to those skilled in the art, such as Ficoll separation of blood cells. In one respect, cells from an individual's circulating blood can be obtained via apheresis or leukocyte separation. Apheresis products typically contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and platelets. Cells collected via apheresis can be washed to remove plasma fractions and placed in a suitable buffer or culture medium, such as phosphate-buffered saline (PBS) or a wash solution that is calcium-deficient and may be magnesium-deficient, or may be deficient in most (if not all) divalent cations, for subsequent processing steps. After washing, the cells can be resuspended in various biocompatible buffers, such as calcium- and magnesium-free PBS. Alternatively, unwanted components can be removed from the apheresis sample, and the cells can be resuspended directly in a culture medium. In another respect, erythrocytes can be lysed and lymphocytes and erythrocytes consumed, for example by... Gradient centrifugation is used to separate cells from peripheral blood. Alternatively, cells can be separated from the umbilical cord. In any case, specific myeloid cell subsets, typically macrophages, can be further separated using positive or negative selection techniques.

[0245] In one aspect, cells or cell populations containing myeloid-derived cells such as macrophages are cultured for expansion. In another aspect, cells or cell populations containing myeloid progenitor cells are cultured to differentiate and expand into myeloid-derived cells such as macrophages. During cell proliferation, myeloid-derived cells such as macrophages can multiply approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 1000000, 1000000, or more, and any and all integer or non-integer multiples therein. In one respect, cell proliferation is approximately 20 to approximately 50 times.

[0246] After culturing, cells can be incubated in the culture device in cell culture medium for a period of time before being transferred to another culture device, or until the cells reach confluence or high cell density for optimal passage. The culture device can be any culture device commonly used for in vitro cell culture. In some respects, the confluence level is 70% or higher before transferring the cells to another culture device. More preferably, the confluence level is 90% or higher. The confluence period can be any time suitable for in vitro cell culture. The culture medium can be changed at any time during cell culture. In some respects, the culture medium is changed approximately every 2 to 3 days. Cells are treated with an effective amount of MBV and harvested from the culture device, at which point the cells can be used immediately or stored, for example, cryopreserved, for later use.

[0247] The culture steps described herein (including contact with MBV as described herein) can be very short, for example, less than 24 hours, such as about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours. Further culture steps described herein (including contact with MBV as described herein) can be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more.

[0248] In one aspect, myeloid progenitor cells or myeloid-derived cells can be cultured for several hours (about 3 hours) to about 14 days or any integer value of hours in between. Myeloid-derived cells can be cultured for 1–10 days, for example 2–9 days, for example 3–8 days, such as 3, 4, 5, 6, 7, 8, or 9 days. In some aspects, myeloid-derived cells are cultured for 7 days. Suitable conditions for cell culture include appropriate culture media (e.g., macrophage complete medium, DMEM / F12, DMEM / F12-10 (Invitrogen), or DMEM high glucose), which may contain factors required for proliferation and survival, including serum (e.g., fetal bovine or human serum), L-glutamine, insulin, M-CSF, GM-CSF, IL-10, IL-12, IL-15, TGF-β, and TNF-α, or any other additives known to those skilled in the art for cell growth. Other additives for cell growth include, but are not limited to, surfactants, human plasma protein powder (plasmanate), and reducing agents such as N-acetylcysteine ​​and 2-mercaptoethanol. Culture media may include RPMI 1640, AEVI-V, DMEM, MEM, α-MEM, F-12, X-Vivo 15, and X-Vivo 20, or Optimizer supplemented with amino acids, sodium pyruvate, and vitamins. These media may be serum-free or supplemented with adequate amounts of serum (or plasma) or a defined set of hormones, and / or sufficient cytokines for cell growth and expansion. Antibiotics, such as penicillin and streptomycin, are included only in experimental cultures and not in cell cultures to be infused into subjects. Cells are maintained under conditions necessary for growth, such as appropriate temperature (e.g., 37°C) and atmospheric conditions (e.g., air with 5% CO2).

[0249] After this period, MBV can be added to the culture medium at a concentration of, for example, about 1 × 10⁻⁶. 6 MBV / ml to approximately 1×10 20 MBV / ml, such as 1×10 9 MBV / ml to approximately 1×10 14 MBV / ml, approximately 1×10 10 MBV / ml to approximately 1×10 12 MBV / ml, or 1×10 10 MBV / ml to approximately 1×10 11 MBV / ml, or 1×10 11 MBV / ml to approximately 1×10 12 MBV / ml, or 1×10 10 MBV / ml to approximately 1×10 14 MBV / ml, or 1×10 11 MBV / ml to approximately 1×10 14 MBV / ml, or 1×109 MBV / ml to approximately 1×10 11 MBV / ml, for example, approximately 1×10 9 MBV / ml, approximately 1×10 10 MBV / ml, approximately 1×10 11 MBV / ml, approximately 1×10 12 MBV / ml, approximately 1×10 13 MBV / ml, or 1×10 14 MBV / ml. In some cases, the amount of MBV added to the culture medium is approximately 1 × 10⁻⁶. 6 To approximately 1×10 12 MBV / ml. In some instances, the amount of MBV added to the culture medium is approximately 1 × 10⁻⁶. 6 To approximately 1×10 19 MBV / ml, approximately 1×10 6 To approximately 1×10 18 MBV / ml, approximately 1×10 6 To approximately 1×10 17 MBV / ml, approximately 1×10 6 To approximately 1×10 16 MBV / ml, approximately 1×10 6 To approximately 1×10 15 MBV / ml, approximately 1×10 6 To approximately 1×10 14 MBV / ml, approximately 1×10 6 To approximately 1×10 13 MBV / ml, or approximately 1×10 6 To approximately 1×10 12 MBV / ml. In other embodiments, MBV can be approximately 1×10⁻⁶. 7 To approximately 1×10 11 The concentration of MBV / ml was added to the culture medium.

[0250] In some cases, myeloid-derived cells are treated with MBV for approximately 2 to approximately 72 hours, for example, approximately 12 to approximately 48 hours, or approximately 24 to approximately 36 hours. Myeloid progenitor cells or myeloid-derived cells such as macrophages, such as M2 macrophages, can be treated with MBV for approximately 12, approximately 24, approximately 36, or approximately 48 hours. Myeloid-derived cells such as macrophages, such as M2 macrophages, can be treated with MBV for approximately 24 hours.

[0251] This method also relates to treatment methods, particularly adoptive cell therapy, preferably adoptive myeloid-derived cell therapy, comprising administering myeloid progenitor cells or myeloid-derived cells that have been contacted with MBV to a subject in need. For example, the administration may be performed within approximately 2 to 48 hours after the myeloid progenitor cells or myeloid-derived cells have been contacted with MBV, for example, within approximately 12 to approximately 24 hours after contact, for example, within approximately 2, 4, 6, 8, 10, 12, 14, 16, 19, 20, 22, or 24 hours. In other respects, as disclosed herein, the myeloid progenitor cells or myeloid-derived cells may be frozen after contact with MBV for later use.

[0252] In some aspects, an effective amount of myeloid progenitor cells or myeloid-derived cells treated with MBV, or a composition containing such myeloid-derived cells, is administered to a subject, such as a subject suffering from muscular dystrophy. In some aspects, the method thereby treats, for example, improves one or more symptoms of muscular dystrophy.

[0253] In some respects, adoptive cell therapy is performed via autologous transplantation, where myeloid progenitor cells or myeloid-derived cells are isolated and / or otherwise prepared from a subject to receive myeloid-derived cell therapy. Thus, in some respects, the myeloid progenitor cells or myeloid-derived cells are generated from a subject with muscular dystrophy. After isolation and treatment with MBV, the myeloid progenitor cells or myeloid-derived cells are administered to the same subject. In some respects, adoptive cell therapy is performed via allogeneic transplantation, where myeloid progenitor cells or myeloid-derived cells are isolated and / or otherwise prepared from a subject (first subject) who is different from the subject with muscular dystrophy (second subject). In these respects, the myeloid progenitor cells or myeloid-derived cells are treated with MBV and then administered to different subjects with muscular dystrophy, such as subjects of the same species.

[0254] In some respects, the first and second subjects are genetically identical. In some respects, the first and second subjects are genetically similar. In some respects, the second subject expresses the same HLA class or supertype as the first subject. In some respects, HLA matching is less important when immune cells are modified to reduce the expression of endogenous TCR and HLA class I molecules.

[0255] MBV-treated myeloid progenitor cells or myeloid-derived cells may be administered in combination with one or more additional therapeutic agents, or in combination with another therapeutic intervention, either simultaneously or sequentially in any order. In some cases, co-administration of myeloid-derived cells with another therapy when the time is sufficiently close allows the cell population to enhance the effect of one or more additional therapeutic agents, and vice versa. In some respects, the cell population is administered before one or more additional therapeutic agents. In some respects, the cell population is administered after one or more additional therapeutic agents.

[0256] The myeloid progenitor cells or myeloid-derived cells prepared as described herein can be administered to subjects, such as human subjects with muscular dystrophy, to treat muscular dystrophy. Muscular dystrophy can be any of those disclosed herein. The myeloid progenitor cells or myeloid-derived cells can be administered systemically, such as intravenously.

[0257] MBV-treated myeloid progenitor cells or myeloid-derived cells can be administered to subjects weekly, every two weeks, monthly (e.g., approximately every 28 days), every two months (e.g., approximately every 56 days), or every three months (e.g., approximately every 84 days). The number of cells administered and the frequency of administration can be adjusted according to the desired outcome and the type and severity of the subject's muscular dystrophy.

[0258] Conditioned media In some aspects, methods for treating subjects with muscular dystrophy are disclosed, the method comprising administering to the subject a composition comprising an effective amount of a conditioned medium or fraction thereof, said conditioned medium or fraction thereof being obtained from a macrophage culture cultured in the presence of exogenous MBV.

[0259] The isolation of myeloid progenitor cells or myeloid-derived cells, and their treatment in vitro with MBV, have been disclosed above. In some respects, the conditioned medium produced by culturing such cells can be used in the disclosed methods.

[0260] In addition, macrophages, such as M2 macrophages, can be cultured in any medium suitable for mammalian cell culture, such as, but not limited to, RPMI 1640 medium, optionally containing human or fetal bovine serum, or Dulbecco's Modified Eagle Medium / Nutrient Mixture F12 (DMEM-F12), with the addition of MBV to produce a conditioned medium for the treatment of muscular dystrophy.

[0261] MBV can be added to a culture medium containing macrophages at the following concentrations to condition the medium: approximately 1 × 10⁻⁶.6 MBV / ml to approximately 1×10 20 MBV / ml, approximately 1×10 9 MBV / ml to approximately 1×10 14 MBV / ml, approximately 1×10 10 MBV / ml to approximately 1×10 12 MBV / ml, or 1×10 10 MBV / ml to approximately 1×10 11 MBV / ml, or 1×10 11 MBV / ml to approximately 1×10 12 MBV / ml, or 1×10 10 MBV / ml to approximately 1×10 14 MBV / ml, or 1×10 11 MBV / ml to approximately 1×10 14 MBV / ml, or 1×10 9 MBV / ml to approximately 1×10 11 MBV / ml, for example, approximately 1×10 9 MBV / ml, approximately 1×10 10 MBV / ml, approximately 1×10 11 MBV / ml, approximately 1×10 12 MBV / ml, approximately 1×10 13 MBV / ml, or approximately 1×10 14 MBV / ml. In some cases, the amount of MBV added to the culture medium can be approximately 1 × 10⁻⁶. 6 To approximately 1×10 12 MBV / ml. In some embodiments, the amount of MBV added to the culture medium may be approximately 1 × 10⁻⁶. 6 To approximately 1×10 19 MBV / ml, approximately 1×10 6 To approximately 1×10 18 MBV / ml, approximately 1×10 6 To approximately 1×10 17 MBV / ml, approximately 1×10 6 To approximately 1×10 16 MBV / ml, approximately 1×10 6 To approximately 1×10 15 MBV / ml, approximately 1×10 6 To approximately 1×10 14 MBV / ml, approximately 1×10 6 To approximately 1×10 13 MBV / ml, or approximately 1×10 6 To approximately 1×10 12MBV / ml. In other instances, MBV can be approximately 1×10⁻⁶. 7 To approximately 1×10 11 The solution was added to the culture medium at a concentration of MBV / ml.

[0262] In some cases, macrophages are cultured in medium containing MBV for approximately 2 to approximately 72 hours, for example, approximately 12 to approximately 48 hours, or for example, approximately 24 to approximately 36 hours. Macrophages, such as M2 macrophages, can be treated with MBV for approximately 12, approximately 24, approximately 36, or approximately 48 hours. Macrophages, such as M2 macrophages, can be treated with MBV for approximately 24 hours.

[0263] Once the required time for preparing the conditioned medium has been reached—for example, the macrophage secretory molecules present in the medium have reached the desired concentration—the medium can be separated from the cells to isolate the conditioned medium. This can be achieved, for example, by centrifugation and other known techniques. In some instances, when centrifugation is used, the conditioned medium will be the supernatant, and the macrophages will be in the precipitate. Therefore, in some instances, the conditioned medium contains no or substantially no cells. For example, no more than 10%, or even no more than 5%, of the conditioned medium, by weight or volume, may contain cells.

[0264] Conditioned culture media can be lyophilized to preserve and / or concentrate bioactive agents that promote tissue repair. A typical lyophilization process involves three separate but interdependent processes: freezing, primary drying (sublimation), and secondary drying (desorption). Various biocompatible preservatives, cryoprotectants, and stabilizers can be used to maintain activity when needed. Non-limiting examples of biocompatible reagents include glycerol, dimethyl sulfoxide, and trehalose. In some respects, lyophilized products also include one or more excipients, such as buffers, fillers, and osmotic pressure regulators. The lyophilized medium is reconstituted by adding a suitable solution or drug diluent.

[0265] In some respects, conditioned media can be treated by precipitating bioactive agents (such as growth factors, cytokines, and / or Wnt proteins) into the culture medium. Precipitation can be performed using various procedures, such as salting out with ammonium sulfate or using hydrophilic polymers, such as polyethylene glycol.

[0266] In other respects, various selective filters are used to filter conditioned media. Filtering conditioned media helps concentrate tissue-repair-promoting factors and removes small molecules and solutes used in the conditioned media. Filters with specific molecular weight selectivity include <5000 Daltons, <10000 Daltons, and <15000 Daltons. Other filters can be used, and the tissue-repair-promoting activity of the treated media can be detected, as described herein. Exemplary filters and concentration systems include those based on hollow fiber filters, filter discs, and filter probes, etc.

[0267] In other respects, conditioned media are subjected to chromatography to remove salts, impurities, or to fractionate the various components of the media. Various chromatographic techniques can be employed, such as molecular sieving, ion exchange, reversed-phase, and affinity chromatography. To process conditioned media without significant loss of biological activity, mild chromatographic media are used. Non-limiting examples include separation media based on dextran, agarose, or polyacrylamide (e.g., available under various trade names such as SEPHADEX® and SEPHAROSE®). In some respects, the methods disclosed in U.S. Patent Publication No. 2004 / 0248803 are used to remove impurities from conditioned media.

[0268] Conditioned culture media can be used directly without the addition of pharmaceutically acceptable carriers, or can be prepared into pharmaceutical compositions comprising conditioned culture media and various pharmaceutically acceptable carriers. A pharmaceutical composition refers to the form of conditioned culture media and at least one pharmaceutically acceptable carrier. The composition may also contain formulations such as suspensions, stabilizers, or dispersants. Injectable formulations may be in single-dose, multi-volume ampoules, with or without preservatives. Alternatively, the composition may be in powder form to be reconstituted with a suitable solvent, including, but not limited to, sterile pyrogen-free water, saline, buffer, or glucose solution.

[0269] In other respects, conditioned media containing bioactive agents can be introduced or encapsulated into the lumen of liposomes for delivery and to prolong the shelf life of the bioactive agents. Liposomes can be classified into several types: multilayered vesicles (MLV), stable multilayered vesicles (SPLV), small unilamellar vesicles (SUV), or large unilamellar vesicles (LUV). Liposomes can be prepared from a variety of lipid compounds, which can be synthetic or naturally occurring, including phosphatidyl ethers and esters such as phosphatidylserine, phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, and myristoyl phosphatidylcholine; steroids such as cholesterol; cerebrosides; sphingomyelin; glycerides; and other lipids (see, for example, U.S. Patent No. 5,833,948).

[0270] Conditioned culture media can be used alone or in combination with other compatible bioactive agents that can be used to treat muscle atrophy. In some respects, conditioned culture media can be used with other compounds or compositions.

[0271] The conditioned medium as described herein can be administered to subjects, such as human subjects with muscular dystrophy, to treat muscular dystrophy. Muscular dystrophy can be any of those disclosed herein. The conditioned medium can be administered systemically, such as intravenously, intramuscularly, or subcutaneously. Intramuscular administration can target specific muscles of interest that are atrophied, such as muscles that are atrophied or malnourished.

[0272] Conditioned culture medium can be administered to subjects weekly, bi-weekly, monthly (e.g., approximately every 28 days), bi-monthly (e.g., approximately every 56 days), or bi-monthly (e.g., approximately every 84 days). The dosage and frequency of administration can be adjusted according to the desired outcome and the type and severity of the subject's muscular dystrophy.

[0273] Treatment of SMA This article provides a method for treating subjects (e.g., human subjects) with SMA. This method can be used to treat (i.e., prevent, improve, inhibit, and / or alleviate) motor disorders caused by SMA in subjects. In some respects, SMA is type 1 SMA. In other respects, SMA is type 2 SMA. In a further respect, SMA is type 3 or type 4 SMA.

[0274] Any suitable subject with or at risk of motor dysfunction caused by SMA can be treated using the methods described herein. Motor dysfunction may occur in the upper or lower body limbs, such as above or below the elbow, above or below the knee, or encompassing the entire arm or leg. Subjects may have any of SMA types 1-4, such as type 1, 2, 3, or 4. In some implementations, subjects with SMA are selected for treatment. The method can be initiated at any time after the onset of motor dysfunction in the subject, or even before motor dysfunction is detectable in SMA patients at risk.

[0275] SMA can be treated by administering myoblastic vegetative-muscle cells (MBVs), conditioned media, or myeloid progenitor cells prepared as disclosed herein to the patient. Administerment can be direct against the spinal cord or adjacent muscle tissue, or it can be systemic, such as intravenous administration. The dosage and frequency of administration according to the methods disclosed herein can be adjusted as needed to influence the expected outcomes for the subject. For example, treatment outcomes for a particular subject can be assessed by monitoring the metabolic activity of myoblasts in a blood sample collected from the subject, or by monitoring other characteristics of the subject, such as weight gain, improvement in muscle tone and muscle health, or other improvements in quality of life. For example, improvements in functional capacity demonstrated by changes in the Spinal Muscular Atrophy Functional Rating Scale (SMAFRS) can indicate the effectiveness of the methods disclosed herein. In some instances, the treatment methods disclosed herein have resulted in improvements in SMAFRS functional ratings in treated subjects with SMA.

[0276] Combination therapy for SMA The methods described herein can be used in combination with other treatments for SMA. Gene therapy has achieved some success in preventing the need for permanent respiratory support and death in neonatal patients (types 1-2), such as Onasemnogeneabeparvovec (Zolgensma®), an intravenously administered adeno-associated virus vector-based gene therapy that delivers a copy of the motor neuron survival 1 (SMN1) gene. In addition, SMA neurorepair agents, such as Nusinersen (Spinraza®), an intrathecally delivered antisense oligonucleotide (ASO) targeting the SMN2 gene, and Risdiplam (Evrysdi®), an oral motor neuron survival 2 (SMN2) splicing modifier, can be used to slow or prevent motor neuron death caused by SMA. These available treatments differ in their mechanisms of action on the disease and their administration methods, but can be used in combination with the methods protected herein.

[0277] Treatment and combination therapy for FSHD This article provides a method for treating subjects with FSHD (e.g., human subjects). This method can be used to treat (i.e., prevent, improve, suppress, and / or alleviate) movement disorders caused by FSHD in subjects. Subjects may have FSHD type 1 or FSHD type 2.

[0278] FSHD is the third most common inherited myopathy, with an estimated incidence of approximately 1 in 20,000. The disease is characterized by progressive weakness and atrophy of the facial and shoulder girdle muscles, which then spread to the abdominal and pelvic girdle muscles, presenting with highly variable patterns. The genetic defect follows an autosomal dominant inheritance pattern, with new mutations accounting for approximately 10% of recognized cases. FSHD type 1 is the most common form of FSHD, accounting for 95% of cases. FSHD is caused by ectopic expression of the germline transcription factor dual homeobox (DUX)4 gene in muscle cells. FSHD1 is associated with the deletion of a tandem repeat called D4Z4 near the 4q35 position on chromosome 4. The D4Z4 region is a polymorphic array of variable-number tandem repeat sequences (VNTRs) consisting of 3.3 kilobase units, each encoding the DUX4 gene. In unaffected individuals, the D4Z4 array on chromosome 4 spans from 11 to 150 consecutive units. In individuals with FSHD, this D4Z4 repeat array shrinks to 1 to 10 consecutive units. Shrinkage of the D4Z4 repeat array leads to hypomethylation and relaxation of chromatin, thereby activating the expression of the toxic DUX4 gene. Adjacent to the D4Z4 region, towards the distal end of the chromosome, is a polyadenylation site, part of the DUX4 gene, essential for stable gene expression in the most distal D4Z4 unit. Chromosome 4 has two alleles, designated 4qA and 4qB, based on DNA variations at the distal end of the D4Z4 repeat array. Only the 4qA variant combined with the shortened D4Z4 repeat region is associated with FSHD. These subjects are easily treated using the methods disclosed herein.

[0279] Facioscapulohumeral muscular dystrophy type 2 (FSHD2) accounts for approximately 5% of all FSHD cases and is characterized by the absence of D4Z4 repetitive contractions on chromosome 4. FSHD2 is phenotypically almost identical to FSHD1, and both forms of FSHD arise from a common downstream mechanism involving the epigenetic desuppression of the transcription factor DUX4 in skeletal muscle cells. This leads to the expression of DUX4 and target genes responsible for skeletal muscle toxicity. FSHD2 is a bigenic disease; mutations in the SMCHD1, DNMT3B, and most recently, LRIF1 genes can cause FSHD2. These individuals are readily treatable using the methods disclosed herein.

[0280] The disclosed methods can be used in conjunction with other therapies for FSHD. These include, but are not limited to, exercise, dietary modifications, surgical procedures such as shoulder stabilization, and mechanical assistance. The methods disclosed herein can also be used in combination with other therapeutic agents; see, for example, U.S. Patent Application Publication No. 2021 / 0038653, which discloses the use of antibodies in combination with DUX4 inhibitors; PCT Publication No. WO2022 / 115745A1, which discloses the use of DUX4 antisense RNA; and US 10,907,157, which discloses antisense agents and interfering agents that reduce DUX4 and DUX4c expression.

[0281] FSHD can be treated by administering myoblasts, conditioned medium, or myeloid progenitor cells prepared as disclosed herein to the patient. Administration can be systemic, such as intravenous, or directly to the affected muscles, such as via intramuscular administration. The dosage and frequency of administration according to the methods disclosed herein can be adjusted as needed to influence the expected outcomes for the subject. For example, treatment outcomes for a particular subject can be assessed by monitoring the metabolic activity of myoblasts in a blood sample collected from the subject, or by monitoring other characteristics of the subject, such as weight gain, improvement in muscle tone and muscle health, or other improvements in quality of life. For example, changes in the FSHD Comprehensive Outcomes Measurement (FSHD-COM), which indicates improvement in quality of life indicators, or improvements in functional abilities demonstrated by measurements of muscle strength, leg function (timed walking test, stair climbing time test, or time to stand up from a chair), can indicate the effectiveness of the methods disclosed herein. In some instances, the treatment methods described herein have resulted in improvements in FSHD-COM functional scores, timed walking test, timed stair climbing test, and / or standing time test when the treated subject had FSHD.

[0282] Promoting skeletal muscle regeneration This article provides a method for promoting skeletal muscle regeneration or repair in subjects in need. The subjects in need have experienced muscle loss or damage. For example, the subjects may suffer from a muscle degenerative disease disclosed herein, leading to muscle damage or loss. The method provides the administration of an effective amount of a composition comprising exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix, wherein the MBVs do not express CD63 and CD81 or CD63... lo CD81 lo Furthermore, the MBV contained therein does not contain alkaline phosphatase.

[0283] Subjects given MBV may exhibit an increase in satellite cells and / or myoblasts in muscle tissue, particularly in muscle tissue requiring regeneration or repair. Subjects given MBV may also exhibit an increase in myofiber in muscle tissue requiring regeneration or repair. MBV can be administered systemically. MBV can also be applied locally to muscle requiring regeneration or repair. This method may include measuring muscle regeneration, such as measuring an increase in satellite cells and / or myoblasts in a subject sample.

[0284] While these cellular changes in muscle tissue can be observed through biopsy and tissue staining, an increase in muscle mass is another metric that can be used to determine the occurrence of muscle regeneration. Muscle mass gain can be determined by calculating body composition, for example through bioelectrical impedance analysis, dual-energy X-ray absorptiometry (DEXA / DXA) scans, or magnetic resonance imaging (MRI), and by determining the proportions of fat, muscle, water, or bone in body weight.

[0285] The level of muscle regeneration or repair achieved by subjects due to MBV administration can also be functionally assessed using strength tests. For example, peak torque (PT), rate of torque development (RTD), or average torque per contraction (AT) can be used to assess muscle function during isometric contraction. Assessments can be performed before and after treatment to evaluate muscle function, where an increase in muscle function after treatment compared to pre-treatment indicates skeletal muscle regeneration and repair. According to the invention, subjects treated with MBV showed increases in PT, RTD, or AT of 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, or more after MBV treatment compared to pre-treatment levels. This increase can be measured at 1 week, 2 weeks, 1 month, 2 months, or 3 months after MBV administration.

[0286] For example, skeletal muscles undergoing regeneration or repair could be the quadriceps, biceps, gastrocnemius, hamstrings, gluteus maximus, triceps, deltoid, latissimus dorsi, or trapezius. The subjects may be human.

[0287] According to the present invention, subjects treated with MBV experience an increase in muscle mass of 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, or more after MBV treatment. For example, this increase can be measured approximately one month, two months, three months, four months, five months, or six months after the start of MBV treatment. This increase is compared to the subject's muscle mass before the start of MBV treatment.

[0288] MBV can be administered long-term (e.g., indefinitely as long as there is a need for muscle regeneration) or for a limited period of time until the desired level of muscle regeneration is achieved.

[0289] For example, the dosage for the subjects was approximately 1 × 10⁻⁶ per administration. 1 To approximately 1×10 20 MBV / kg body weight. For example, the dosage for a subject is approximately 1 × 10⁻⁶ per administration. 6 To approximately 1×10 20 MBV / kg body weight, for example, approximately 1×10 6 To approximately 1×10 12 MBV / kg body weight. In some instances, the dosage administered to subjects was approximately 1 × 10⁻⁶ per dose. 6 To approximately 1×10 19 MBV / kg body weight, approximately 1×10 6 To approximately 1×10 18 MBV, approximately 1×10 6 To approximately 1×10 17 MBV, approximately 1×10 6 To approximately 1×10 16 MBV, approximately 1×10 6 To approximately 1×10 15 MBV, approximately 1×10 6 To approximately 1×10 14 MBV, approximately 1×10 6 To approximately 1×10 13 MBV, or approximately 1×10 6 To approximately 1×10 12 MBV. In other embodiments, the dosage administered to the subject is approximately 1 × 10⁻⁶ per administration. 7 To approximately 1×10 11 MBV / kg body weight. In another instance, the subject was administered 1×10⁻⁶ MBV per dose. 7 Up to 1×10 8 MBV / kg body weight. In another instance, the subject was administered 1×10⁻⁶ MBV per dose. 8 Up to 1×10 10 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 9 Up to 1×10 10 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 6 Up to 1×10 8 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 7 Up to 1×10 9 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 8 Up to 1×10 11MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 9 Up to 1×10 11 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 10 Up to 1×10 11 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 11 Up to 1×10 12 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 6 Up to 1×10 14 MBV / kg body weight. In another embodiment, the dosage for the subject is 1×10⁻⁶ per administration. 12 Up to 1×10 14 MBV / kg body weight. In one embodiment, the MBV administration at any of the above doses is systemic. For example, in one embodiment, the administration is intravenous. In another embodiment, the administration is subcutaneous injection, such as intramuscular injection. Administration can be, for example, intramuscular, such as administration to muscles requiring regeneration. Intramuscular administration can be a single injection or multiple injections into multiple sites of muscle requiring repair or regeneration.

[0290] MBV can be applied once daily, once weekly, twice weekly, once every two weeks, once monthly, or as needed to achieve the desired level of muscle regeneration or repair.

[0291] The following embodiments are provided to illustrate certain features of certain aspects of this disclosure, but the scope of the claims should not be limited to those features shown.

[0292] Example Matrix-bound nanovesicles (MBVs) are extracellular vesicles present in the extracellular matrix (ECM) of all animal tissues, including muscle. MBVs have been shown to modulate macrophage phenotypes by promoting pro-remodeling phenotypes and downregulating inflammatory responses. Many cell types, such as mesenchymal stem cells, fibroblasts, and neural progenitor cells, take up MBVs and exhibit biological responses to them. The following examples demonstrate the direct effects of MBVs on primary myoblasts of FSHD and their homeostatic effects on macrophages. This article also shows its effects on the secretome of neural progenitor cells and microvascular endothelial cells. Furthermore, MBVs have been shown to be effective in animal models of FSHD and spinal muscular atrophy. These results support the therapeutic use of MBVs as a treatment for the muscular atrophy diseases disclosed in this article.

[0293] Example 1 Materials and Methods MBV isolation: MBV was isolated from decellularized porcine bladder tissue (UBM). MBV isolation was performed by digestion of UBM with Liberase (a mixture of collagenase and dispase), ultracentrifugation, and size exclusion chromatography (SEC). The isolated MBV was quantified by nanotraceability analysis (NTA) and stored at -20°C for later use.

[0294] FSHD2 primary cell treatment: Cell culture was performed under sterile conditions at 37°C and 5% CO2 for all experiments. Myoblasts derived from healthy subjects and patients diagnosed with facioscapulohumeral muscular dystrophy (FSHD) were cultured in 96-well plates using proliferation medium (Ham's F-10, containing 20% ​​FBS and 1% PS). When confluence reached 80%, cells were injected with different doses of MBV (1×10⁻⁶ mcg / mL). 9 1×10 10 Cells were treated with 1×10¹¹ particles / mL for 24 hours. Cells were then washed with PBS and treated with 10%... Solution incubation was used to determine metabolic activity.

[0295] Macrophage secretome preparation: Macrophages were isolated from the bone marrow of C57BL / 6 mice and cultured for 7 days according to standard laboratory protocols. Differentiated macrophages were then treated for 24 hours in complete medium (DMEM high glucose 10% FBS and 1% PS) at 1×10¹¹ MBV / ml. Macrophages treated with LPS and IL-4 served as M1 and M2 controls, respectively. After 24 hours, the medium was aspirated, cells were washed with PBS, and blank DMEM (0% FBS) was added. Cells were incubated for 6 hours, and the medium containing macrophage secretions was collected, filtered, and stored at -20°C.

[0296] Human microvascular endothelial cell (HMEC-1) culture and angiogenesis assay HMEC-1 cells were grown in MCDB131 medium containing 10% FBS and 1% PS and seeded in 24-well plates until 90% confluence was achieved. Straight scratches were then made on the cell monolayer using a 20 μl pipette tip. Cells were washed with PBS and treated with a 1:1 mixture of MCDB131 medium containing 20% ​​FBS and macrophage secretory groups (MBV, M1, and M2). Images of the scratched areas were taken at 0, 2, 4, and 12 hours. The scratch area was calculated using ImageJ software; a decrease in scratch area with increasing cell number indicated cell migration.

[0297] In the metabolic activity assay, cells were seeded in 48-well plates. When 80% confluence was reached, HMEC-1 cells were cultured for 24 and 72 hours in a 1:1 mixture of macrophage secretory groups and complete medium. The medium was then replaced with 10% complete medium. Incubate for 3 hours. After incubation, record fluorescence (excitation wavelength 530 nm, emission wavelength 590 nm), which is correlated with metabolic activity.

[0298] Mouse neuroblastoma cell treatment and differentiation: N1E-155 neuroblastoma cells were cultured in DMEM containing 10% FBS and 1% PS. Cells were seeded in 48-well plates until 80% confluence was achieved. Subsequently, cells were cultured for 24 hours and 72 hours in a 1:1 mixture of macrophage secretory group and complete medium. The medium was then replaced with 10% PS. The cells were incubated for 3 hours. After incubation, fluorescence (excitation wavelength 530 nm, emission wavelength 590 nm) was recorded, and this fluorescence was correlated with metabolic activity.

[0299] In differentiation analysis, cells were seeded at 20% confluence in a 1:1 mixture of macrophage secretory groups and complete culture medium and cultured for 24 and 72 hours. Representative cell images were acquired at each time point and analyzed using CellProfiler software. Single-cell characteristics (such as roundness, eccentricity, and maximum Feret diameter) were measured, and these characteristics correlated with the differentiation stage of neuroblastoma cells.

[0300] Statistical analysis: Data are presented as mean ± standard deviation. Prism GraphPad software was used for graphical and statistical analysis. One-way ANOVA and Tukey's post-hoc tests were performed to assess statistical differences in metabolic activity assays; however, two-way ANOVA and uncorrected Fisher's post-hoc assays were used to assess statistical differences in scratch and differentiation assays.

[0301] Example 2 Direct effects of MBV on FSHD cells The metabolic activity of myoblasts derived from healthy individuals and FSHD2 patients increased linearly with increasing MBV dose. FIG. 1 The results showed that MBV enhanced mitochondrial respiration and / or cell proliferation in both healthy and affected myoblasts. Measurements were performed 24 hours after treatment with different doses of MBV.

[0302] Example 3 Effects of MBV-treated macrophage secretory group on HMEC-1 cells All macrophage-derived secretory groups showed a slight increase in HMEC-1 cell metabolic activity after 24 hours. FIG. 2 (left figure), while the secretion group derived solely from MBV enhanced endothelial cell metabolic activity after 72 hours ( FIG. 2 (See right image). Scratch assays showed no significant difference between 2-hour and 4-hour treatments. However, after 12 hours, cells treated with the MBV-secretion group showed higher migration than the other groups. FIG. 3 These results indicate that the secretome derived from MBV-treated macrophages has an activating effect on endothelial cells, an effect that is associated with angiogenesis.

[0303] Example 4 Effects of MBV-treated macrophage secretory group on NIE-155 cells All macrophage-derived secretory groups (M1, M2, MBV) showed no difference in metabolic activity of N1E-155 cells after 24 hours, while the M2 and MBV-derived secretory groups enhanced the metabolic activity of neuroblastoma cells after 72 hours. This effect was particularly pronounced when cells were treated with the MBV-secreting group. FIG. 4 ).

[0304] When treated with M0, M1, and M2 macrophage secretory groups, neuroblastoma cells showed morphological changes (roundness, eccentricity, and Feret diameter) after 72 hours. FIG. 5 (A-5B). However, when treated with MBV-secreting groups, roundness and Feret diameter remained unchanged after 72 hours. Given that N1E-155 cell morphological changes are highly correlated with their terminal differentiation, these results suggest that MBV-secreting groups derived from macrophages maintain the stemness of neural progenitor cells in vitro.

[0305] Overall, these results support the use of MBV directly and the secretome derived from MBV-treated macrophages or MBV-treated macrophages for the treatment of muscular dystrophy. The results indicate that MBV interacts directly with myoblasts, enhancing their metabolic activity. For FSHD2 myoblasts, given the close association between FSHD and metabolic dysfunction and oxidative stress, enhanced metabolic activity implies an improvement in the metabolic levels of affected cells. These results also show that when macrophages are treated with MBV, they produce a secretome that promotes endothelial cell activity and neural progenitor stemness. Since macrophages are key regulators of innate immune responses and regeneration, the effects of MBV on macrophages in vivo could promote muscle regeneration in this type of dystrophy.

[0306] Example 5 Uptake analysis by flow cytometry This analysis aims to determine whether MBV accumulates in the bone marrow, interacts with myeloid progenitor cells, and may reprogram or alter the phenotype of myeloid innate cells.

[0307] A set of markers was used to assess the interaction between MBV and different cell types in bone marrow. Specifically, bone marrow from BalbC mice was flushed before staining, filtered through a 40 μm filter, and exposed to 1 × 10¹¹ CFSE-labeled MBV / mL in vitro 24 hours and 3 hours before flow cytometry.

[0308] The cells were then labeled using the following set of markers for different immune cell subsets:

[0309] Flow cytometry showed that cells from the bone marrow took up MBV in vitro. After 3 hours, the vast majority of these cells were myeloid cells; while after 24 hours, more cells from other cell lineages were able to take up MBV. (See Figure 6). Among these myeloid cells, a significant proportion were myeloid progenitor cells (CD34 and CD64 positive), while other major myeloid cells taking up MBV were neutrophils (Ly6G positive) and macrophages (F4 / 80 positive).

[0310] Example 6 ATAC-seq analysis Transposase-accessible chromatin sequencing (ATAC-seq) was performed on in vitro bone marrow lavage fluid, in vitro differentiated macrophages, and cells after systemic and local injections to determine whether MBV treatment affected genome-wide chromatin accessibility and whether it translated into stable phenotypic changes. Such changes in progenitor cells may indicate a change in the stability of subsequent cell lineages of the innate immune response.

[0311] ATAC-seq analysis showed that myeloid progenitor cells and terminally differentiated macrophages were affected differently by MBV in vitro. FIG. 7 The study found that 28 genes were specifically upregulated in MBV-treated progenitor cells and 5917 genes were upregulated in MBV-treated macrophages, with 168 of these upregulated genes overlapping (Ven diagram). These results indicate that MBV induces stable phenotypic changes in progenitor cells that can be inherited by offspring myeloid lineages.

[0312] FIG. 9 This diagram shows the distribution of statistically significant regulatory genes at the epigenetic level under different in vitro treatments (macrophages or bone marrow). In the Venn diagram, large circles correspond to data points on the left side of the graph, and small circles correspond to data points on the right side.

[0313] Example 7 MBV accumulation in bone marrow DiD-labeled MBV was injected into Balb / c mice at 3 and 24 hours. At different time points, bone marrow was flushed and the presence of fluorescence signal in the bone marrow was measured in vitro using an IVIS device. In vitro analysis showed that MBV accumulated in the bone marrow after systemic injection, producing a significant signal. Furthermore, this accumulation was associated with phenotypic changes (…). FIG. 10A -B).

[0314] Data from Examples 5, 6, and 7 show that MBV accumulates in the bone marrow and interacts with different myeloid cell types, including progenitor cells. This interaction is associated with changes in chromatin accessibility at the epigenetic level, which may be related to phenotypic alterations. These results suggest that MBV can be used for the stable regulation of myeloid-lineage immune responses.

[0315] Example 8 Results in FSHD and SMA animal models The effects of MBV in two FSHD animal models were tested, see [link to relevant documentation]. FIG. 11 These animal models are disclosed in DeSimone et al., Disease Models & Mechanisms (2020) 13, dmm046904. doi:10.1242 / dmm.046904,2022, which is incorporated herein by reference. The effect of MBV in SMA animal models was also examined, see Feng et al., Human Mol. Gen. 25(5): 964-975, 206, which is incorporated herein by reference.

[0316] For these studies, the intermediate SMA model was constructed by treating delta7 mice with SMN-C3, an SMN upregulating compound. Mice were treated with SMN-C3L (3 mg / kg intraperitoneally, daily) starting on day 1 postnatal day (PND1). On day 21 postnatal day (PND21), MBV saline, MBV hydrogel, or PBS solution was injected intramuscularly into the bilateral gastrocnemius, bilateral tibialis anterior, bilateral quadriceps, bilateral triceps, and bilateral masseter muscles, respectively. Muscle function was measured on day 50 postnatal day (PND50), after which the mice were euthanized and tissues were collected.

[0317] For FSHD, the first study used the iDUX4pA-HSA mouse model. This model uses doxycycline (dox) to induce the expression of the iDUX4pA transgene via a tetracycline-controlled transactivator (rtTA) restricted to myofibrils (Bosnakovski et al., J. Clin. Invest., 2020 13(5): 2465). DUX4 expression was induced by feeding 4-week-old female iDUX4pA-HAS mice with a doxycycline (dox) diet on day 0 and maintained during the study to simulate a “moderate” DUX4 environment. Animals were categorized as follows: FIG. 11 The scheme shown in the figure above involves MBV or brine treatment.

[0318] In the second animal model, the following was adopted: FLExDUX4(+TMX) A mouse model that induces Cre expression via TMX to allow for the expression of Cre during development or adulthood. DUX4-fl Expression of temporal and climatic control (Jones & Jones, 2018, PLoS One, 13(2):e0192657). Animals according to FIG. 11 The scheme shown in the figure below involves MBV or brine treatment.

[0319] Animals were graded according to a severity rating scale: 1 represents normal; 2 indicates an increase in inflammatory cells but with very little satellite cell activation; 3 represents myonecrosis, including satellite cell activation, including myoblasts, a large number of inflammatory cells, and loss of cytoplasmic integrity; 4 is the most severe grade, characterized by diffuse myonecrosis, a large number of inflammatory cells, including myoblasts, fibrosis, and loss of cytoplasmic integrity.

[0320] like FIG. 12 As shown, the mean severity score of FSHD animals treated with MBV (TMX-induced) was approximately 2.2, while the mean severity score of FSHD animals treated with saline alone was approximately 3.7, indicating that MBV has a positive effect on reducing FSHD severity scores compared to the untreated group.

[0321] like FIG. 13 Exemplary tissue images of skeletal muscle samples from mice treated with PBS (saline) TMX (left) and MBV-treated mice (right) show that the PBS-treated animals exhibit skeletal muscle fiber atrophy, focal necrosis, and an increased number of interfibrous inflammatory cells. Conversely, exemplary muscle fiber samples from MBV-treated animals show normal fiber size and evidence of satellite cell activation around the skeletal muscle fibers. This demonstrates that MBV has a positive effect on inducing phenotypic changes indicative of healthy muscle cells in FSHD mice.

[0322] An intermediate SMA model induced by treatment of delta7 mice with SMN-C3, an SMN upregulating compound, was used to investigate the effect of MBV on SMA. From PND1, mice were treated with SMN-C3L (3 mg / kg intraperitoneally, daily). On PND21, MBV saline, MBV hydrogel, or PBS solution was injected intramuscularly into the bilateral gastrocnemius, bilateral tibialis anterior, bilateral quadriceps, bilateral triceps, and bilateral masseter muscles, respectively. FIG. 15 At PND50, muscle function was measured, after which mice were euthanized and tissues were collected. The mean FSHD score of the PBS-treated control group was 3.3 (n=7). The mean FSHD score of the MBV-treated group was 2.5 (n=12). The mean FSHD score of the mice treated with MBV contained in an extracellular matrix hydrogel was 2.2 (n=11).

[0323] like FIG. 14 As shown, control SMA animals exhibited significant muscle fiber atrophy (longitudinal section), accompanied by numerous inflammatory cells between fibers and areas of muscle necrosis. In contrast, MBV-treated animals showed muscle atrophy, but fewer inflammatory cells compared to PBS-treated animals. Individual fiber damage was also less. Therefore, MBV can be used to mitigate the effects of SMA on muscle fibers.

[0324] Example 9 MBV does not express common exosome markers CD63 or CD81.

[0325] use Exosome antibody arrays (System Biosciences) were used to compare the presence and absence of common exosome markers on mouse exosomes, mouse bone matrix vesicles (Bone MV), and mouse matrix-bound nanovesicles (MBV). Results are as follows: FIG. 15 As shown in Figure A, it is clearly evident that MBV has almost no classic and recognized exosome markers such as CD63 and CD81. Furthermore, in FIG. 15 Other signaling molecules identified in A were absent in MBV, while they were present at intermediate to high levels in bone microvesicles and exosomes. Density plots of expression values ​​are shown below. FIG. 15 As shown in B.

[0326] Data showed that while exosomes and bone MVs had similar expression profiles, with these markers exhibiting moderate to high expression, MBVs showed significant differences in the expression of these EV markers. For example, as shown in the blank wells and compared to the dark rings or solid dark spots present at the same location in the exosome wells, and as shown in the graph at the bottom of the table showing the relative expression levels of these markers, MBVs showed almost none, i.e., one or more of EpCAM, ANXA5, TSG101, FLOT1, ICAM1, and ALIX at “low” or “undetectable” levels. Bone matrix vesicles (Bone MVs) also showed higher levels of expression of all these markers compared to MBVs, as shown in the dark spots on the wells and the graph at the bottom of the table showing the relative expression levels of these markers.

[0327] In one implementation, with Compared to a positive control of an exosome antibody array, MBV has low or undetectable levels of one or more of CD63, CD81, EpCAM, ANXA5, TSG101, FLOT1, ICAM1, and ALIX. In one embodiment, compared to exosomes, such as plasma exosomes, MBV has low or undetectable levels of one or more of CD63, CD81, EpCAM, ANXA5, TSG101, FLOT1, ICAM1, and ALIX. In one embodiment, compared to bone MV, MBV has low or undetectable levels of one or more of CD63, CD81, EpCAM, ANXA5, TSG101, FLOT1, ICAM1, and ALIX. In one embodiment, compared to exosomes or bone MV, MBV has low or undetectable levels of ANXA5, TSG101, and ICAM1. In one implementation, MBV has low or undetectable levels of CD81, CD63, ANXA5, TSG101, and ICAM1 compared to bone MV or plasma exosomes.

[0328] Example 10 MBV shows low or no expression of bone marrow markers.

[0329] The expression of bone microvesicle markers Annexin V and tissue-specific alkaline phosphatase (TNAP) was assessed by Western blot analysis. The results are shown in Figure 16. Lysates prepared from 1711A cells were used as a positive control. The results showed that matrix-bound nanovesicles (MBVs) did not express either of the two markers of bone microvesicles, TNAP and Annexin V. Plasma exosomes expressed Annexin V but not TNAP. These results clearly distinguish MBVs from both exosomes and bone microvesicles.

[0330] Example 11 MBV exhibits different immunomodulatory effects compared to exosomes or bone MV.

[0331] Bone marrow-derived macrophages (BMDM) collected from mice, either untreated (M0) or treated with the following test sample for 24 hours: M1 phenotype (M1), IL-4-induced M2-like phenotype (M2), plasma-derived exosomes, 17A cell-derived bone MV, or MBV isolated from muscle were used. Following treatment, fold changes in indicator gene expression were assessed by qPCR. Results are as follows: FIG. 17 As shown, MBV downregulates the pro-inflammatory markers IL-6 and TNF-α in a significantly different manner compared to the downregulation of the same two inflammatory mediators by exosomes and bone microvesicles. MBV exhibits potent anti-inflammatory activity, while exosomes and bone microvesicles do not.

[0332] Example 12 D2.mdx mouse study MATERIALS AND METHODS: Preparation of urinary bladder matrix (UBM): Prepare UBM as previously described. Mase VJ, et al. Orthopedics. 2010; 33(7):511 Porcine bladder tissue from market-weight animals was obtained from Tissue Source, LLC. Briefly, the serosa, outer muscularis propria, submucosa, and muscularis mucosae were mechanically removed. Rinsing with deionized water dissociated the luminal urinary tract epithelial cells of the mucosa from the basement membrane. The remaining tissue, consisting of the basement membrane of the mucosa and the underlying lamina propria, was decellularized by stirring at 300 rpm for 2 hours in 0.1% peracetic acid containing 4% ethanol. The tissue was then thoroughly rinsed with PBS and sterile water. UBM was then lyophilized and granulated using a Wiley Mill with a #60 mesh screen.

[0333] Isolation of matrix-bound nanovesicles: By using at room temperature on the track rocker arm Liberase MBV was isolated from laboratory-produced porcine bladder matrix (UBM) by enzymatic digestion with TL (highly purified collagenase I and collagenase II) in buffer (50 mM Tris pH 7.5, 5 mM CaCl2, 150 mM NaCl) for 24 h. The digested ECM was then centrifuged at 10,000 × g (30 min) to remove ECM fragments. The clear supernatant containing the released MBV was then centrifuged at 100,000 × g (Beckman Coulter Optima L-90K ultracentrifuge) for 2 h at 4 °C to precipitate MBV. The MBV was then resuspended in 1 × PBS and stored at 4 °C for later use.

[0334] D2.mdx mouse model This study used male DBA / 2J strains. mdx Mice (D2). mdx (Jax# 013141), see also Sci Rep 10, 14070 (2020). Mice were randomly assigned to the following groups: 1) saline treatment group; 2) MBV treatment group. 100 µl of a solution containing 4.2 × 10^6 mmol / L was administered intraperitoneally on days 1, 3, and 5 and weekly thereafter. 9 MBV. Record weight weekly.

[0335] Isometric torque measurements Functional analysis was performed by measuring isometric torque generation in the gastrocnemius muscle at weeks 1 and 7 (see Tissue Eng Part A. 2018 Jan;24(1-2):34-46). Animals were anesthetized, with their hind limbs stabilized by a platform support and their feet in a flexed position. The muscles were stimulated at eight different frequencies (25–200 Hz), with a 2-minute rest interval between each frequency. Tic-twitch and tetanic contractions were analyzed using a dynamic muscle analysis program, and the data were normalized relative to the animal's body weight.

[0336] Histological evaluation Animals were sacrificed at week 8. Tissues were collected, fixed in neutral-buffered formalin, and embedded in paraffin. Degenerative and / or regenerative areas were assessed by hematoxylin and eosin (HE) staining, as well as Masson's trichrome staining, which identified the presence of inflammatory cells and myofiber necrosis.

[0337] RESULTS Research plan as follows FIG. 19 As shown. Body weight and muscle mass were assessed in both treatment groups, see [image / description]. FIG. 20 The results of the muscle function test are shown in [the image / document]. FIG. 21 As shown. Histological assessment as follows. FIG. 22 As shown.

[0338] The results strongly suggest that MBV can mitigate the progression of DMD. The D2.mdx model represents a severe form of the disease, and the use of MBV provided unexpectedly superior therapeutic effects. FIG. 20 As shown, the gastrocnemius muscle weight of MBV-treated animals was statistically significantly greater than that of control animals. For other muscles, MBV-treated animals showed a trend of increased muscle mass compared to controls, indicating that MBV contributes to muscle regeneration and repair in the DMD model. FIG. 21 As shown, MBV treatment produced a statistically significant increase in muscle mass in terms of torque generation compared to the control. Torque is a quantitative measure of muscle strength. These results are attributed to greater muscle mass in the MBV-treated groups, rather than greater strength per muscle fiber. The increased torque compared to control animals suggests that MBV contributes to muscle repair and regeneration.

[0339] Furthermore, histological examination revealed reduced muscle necrosis, which, while not theoretically confined, may be a result of decreased pro-inflammatory effects and / or effects on myocyte anabolic metabolism in MBV-treated animals compared to the control group. More surprisingly, satellite cell activation, including the presence of myoblasts, was observed in MBV-treated tissues, indicating that this cellular environment promotes muscle regeneration and repair. These were not found in control tissues. This suggests that MBV can promote the regeneration and repair of skeletal muscle tissue.

[0340] Obviously, the specific details of the described methods or compositions can be altered or modified without departing from the spirit of the aspects described in this disclosure. We claim protection for all modifications and variations that conform to the scope and spirit of the following claims.

Claims

1. A method of treating a subject suffering from muscular dystrophy, the method comprising administering a composition to the subject, the composition comprising an effective amount of: a) Exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix, wherein the MBVs do not express CD63 and CD81 or CD63 lo CD81 lo Furthermore, MBV does not contain alkaline phosphatase; b) Myeloid progenitor cells or myeloid-derived cells treated with exogenous MBV; and / or c) Conditioned culture medium or fractions thereof obtained from macrophages cultured in the presence of exogenous MBV; This will treat the subject's muscular atrophy.

2. The method of claim 1, wherein the subject is administered a composition comprising an effective amount of exogenous MBV derived from the extracellular matrix, wherein the MBV does not express CD63 and CD81 or CD63 lo CD81 lo Furthermore, the MBV in question does not contain alkaline phosphatase.

3. The method of claim 1, wherein the subject is given a composition comprising an effective amount of exogenous MBV-treated myeloid progenitor cells or myeloid-derived cells.

4. The method of claim 1, wherein the subject is administered a conditioned medium or fraction thereof comprising an effective amount of macrophage cultured in the presence of exogenous MBV.

5. A method for promoting skeletal muscle regeneration or repair in a subject in need, the method comprising administering a composition to the subject, the composition comprising an effective amount of exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix, wherein the MBVs do not express CD63 and CD81 or CD63 lo CD81 lo Furthermore, the MBV contained no alkaline phosphatase, thereby promoting skeletal muscle regeneration and repair in the subjects.

6. The method of claim 1, 2 or 5, wherein the exogenous MBV is contained in an extracellular matrix (ECM) hydrogel or a pregel prepared from an extracellular matrix (ECM), and the MBV contained in the hydrogel or pregel is administered to a subject.

7. The method of claim 6, wherein the extracellular matrix hydrogel or pregel is an enzymatic ECM hydrogel or pregel and contains an inactivated protease.

8. The method of claim 6 or 7, wherein the pH of the enzymatic hydrogel or pregel is about 7.0 to about 7.

8.

9. The method of any one of claims 6-8, wherein the enzymatic pregel is formed at a temperature greater than about 25°C.

10. The method of claim 6, wherein the ECM hydrogel is an acoustic hydrogel having a storage modulus (G') of about 50 Pa to about 200 Pa, a loss modulus (G") of about 5 Pa to about 20 Pa, and a ratio of G' to G" of about 4:1 to about 15:1 at 37°C.

11. The method of any one of claims 6-10, wherein the ECM hydrogel or pregel comprises dissolved ECM at a concentration of 1 mg / mL to 500 mg / mL.

12. The method of any one of claims 6-11, wherein the ECM in the hydrogel or pregel is not dialyzed.

13. The method of any one of claims 6-12, wherein the ECM hydrogel or pregel is prepared from the extracellular matrix of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessels, lungs, bones, muscles, pancreas, placenta, stomach, spleen, colon, adipose tissue or esophagus.

14. The composition of any one of claims 6-12, wherein the ECM hydrogel or pregel is prepared from bladder matrix (UBM), small intestinal submucosal layer (SIS), bladder submucosal layer (UBS), or dermis.

15. The method of claims 6-14, wherein the MBV is at least about 1 × 10 5 Up to 1×10 20 The particle / mL concentration exists in the hydrogel or pregel.

16. The method of any one of claims 1-15, wherein the MBV is derived from the extracellular matrix of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessels, lungs, bones, muscles, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus.

17. The method of any one of claims 1-16, wherein the MBV is not derived from bone or cardiac ECM.

18. The method of any one of claims 1-15, wherein the MBV is derived from the extracellular matrix of the bladder, small intestine, dermis, liver, kidney, uterus, brain, blood vessels, lungs, muscles, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus.

19. The method of any one of claims 1-15, wherein the MBV is derived from the bladder matrix (UBM), the small intestinal submucosal layer (SIS), or the bladder submucosal layer (UBS).

20. The method of any one of claims 1-19, wherein the MBV is derived from the extracellular matrix of a mammalian vertebrate selected from humans, monkeys, pigs, cattle, or sheep.

21. The method of any one of claims 1, 2, or 5-20, wherein the MBV is administered to the subject via systemic administration.

22. The method of claim 21, wherein the systemic administration is intravenous administration.

23. The method of claims 1, 2, or 5-20, wherein the MBV is administered to the subject by local administration to the tissue or region of interest.

24. The method of claim 23, wherein the tissue or region of interest is muscle, nerve, or spinal cord.

25. The method of any one of claims 1 or 3, wherein the myeloid-derived cells are macrophages, monocytes, or granulocytes.

26. The method of any one of claims 1, 3 or 24, wherein the myeloid progenitor cell or myeloid-derived cell is the subject's own cell.

27. The method of any one of claims 1, 3, 24 or 25, wherein the myeloid progenitor cells or myeloid-derived cells are administered to the subject via systemic administration.

28. The method of any one of claims 1, 3 or 24-26, wherein the myeloid progenitor cells or myeloid-derived cells are treated with exogenous MBV in a cell culture and isolated from the cell culture after MBV treatment for administration to a subject.

29. The method of any one of claims 1, 3 or 24-27, wherein the myeloid progenitor cells or myeloid-derived cells are administered to the patient via intravenous administration.

30. The method of any one of claims 1 or 4, wherein the macrophages are autologous cells of the subject.

31. The method of claim 29, wherein the conditioned medium is purified by dialysis, size fractionation and / or centrifugation before being administered to the subject.

32. The method of claim 5, wherein the subject suffers from muscular dystrophy.

33. The method of any one of claims 1-4 or 6-32, wherein the muscular atrophy condition is spinal muscular atrophy (SMA).

34. The method of claim 33, wherein the spinal muscular atrophy is infantile progressive spinal muscular atrophy (SMA type I), intermediate spinal muscular atrophy (SMA type II), juvenile spinal muscular atrophy (SMA type III), or adult spinal muscular atrophy (SMA type IV).

35. The method of claims 1-4 or 6-32, wherein the muscle atrophy condition is muscular dystrophy.

36. The method of claim 35, wherein the muscular dystrophy (MD) is Becker's MD, congenital MD, Duchenne MD, distal MD, Emery-Dreifuss MD, facioscapulohumeral MD, Limb-Girdle MD, myotonic MD, oculopharyngeal MD, Bethlem myopathy, or Ullrich congenital muscular dystrophy.

37. The method of any one of claims 1-4 or 6-36, wherein the muscle atrophy disease is facioscapulohumeral muscular dystrophy (FSHD) or SMA.

38. The method of any one of claims 1-4 or 6-32, wherein the muscular atrophy disease is sarcopenia or cachexia.

39. The method of any one of claims 1-38, wherein the composition increases myotube formation in the subject.

40. The method of any one of claims 1-39, wherein the composition keeps neural progenitor cells in the subject's body in an undifferentiated state.

41. The method of any one of claims 1-38, wherein the composition enhances the migration ability of endothelial cells in the subject.

42. The method of any one of claims 1-39, wherein the composition increases the growth of muscle tissue in the subject.

43. The method of any one of claims 1-40, wherein the subject is a human.

44. The method of claim 5 or 32, wherein, after administration of the composition, satellite cell activation and / or myoblast activity are increased in the skeletal muscle of the subject requiring regeneration or repair.

45. The method of claim 5, 32 or 44, wherein, after administration of the composition, the muscle strength of the skeletal muscle in the subject requiring repair or regeneration increases compared to before administration.

46. ​​The method of claim 45, wherein the increase in muscle strength is measured by a change in peak torque, torque development rate, or average torque.

47. The method of claims 5, 32, or 44-46, wherein the subject experiences an increase in muscle mass after administration of the composition compared to before administration.

48. A composition comprising an effective amount of: a) Exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix, wherein the MBVs do not express CD63 and CD81 or CD63 lo CD81 lo Furthermore, MBV does not contain alkaline phosphatase; b) Myeloid progenitor cells or myeloid-derived cells treated with exogenous MBV; and / or c) Conditioned culture medium or fractions thereof obtained from macrophages cultured in the presence of exogenous MBV; The method used in any one of claims 1-47.

Images