Use of a DNAzyme in the preparation of a medicament for the treatment of heat stroke

By targeting and regulating ZBP1 protein expression with DNAzyme and combining it with TPNs vectors, targeted drugs were prepared, which solved the problems of early treatment window failure and organ-targeted therapy for heatstroke, and achieved a highly efficient prevention and treatment effect for heatstroke.

CN121154667BActive Publication Date: 2026-05-12THE SECOND XIANGYA HOSPITAL OF CENT SOUTH UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511335222.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-18
Publication Date
2026-05-12
Estimated Expiration
2045-09-18

AI Technical Summary

Technical Problem

Current heatstroke prevention and treatment technologies lack targeted drugs that address the core mechanisms of heatstroke, cannot resolve the failure of the early treatment window caused by delayed ZBP1 expression, lack effective preventive measures, and lack targeted and precise treatment for key organs such as the liver and lungs.

Method used

By using DNAzyme to target and regulate ZBP1 protein expression, and by combining DNAzyme sequences such as DNAzyme_SEQ_1 and DNAzyme_SEQ_2 with TPNs delivery vectors, targeted drug delivery can be prepared to achieve precise treatment and prevention of liver and lung diseases.

Benefits of technology

It significantly improved the survival rate of heatstroke model mice, reduced liver and kidney function damage, inhibited pan-apoptosis in the liver and lungs, prevented organ structural damage, and enhanced sensitivity to high-temperature environments, providing a novel and effective solution for heatstroke.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121154667B_ABST
    Figure CN121154667B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of heat stroke treatment, and specifically discloses application of DNAzyme in preparation of a medicine for treating heat stroke, wherein the DNAzyme is a DNAzyme for targeted regulation of ZBP1 protein expression. The application also discloses a medicine for preventing and treating heat stroke. The application has important value for fundamentally conquering the prevention and treatment method of heat stroke. The application fully verifies the remarkable efficacy of DNAzyme_SEQ_1 in the prevention and treatment of heat stroke through systematic experiments. The DNAzyme_SEQ_1 delivered by a TPNs carrier presents obvious liver and lung targeting in the mouse body, and the fluorescence intensity is obviously higher than that of other organs, thereby ensuring that the medicine precisely acts on the key damage sites of heat stroke.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of heatstroke treatment technology, specifically relating to the application of a DNAzyme in the preparation of a drug for treating heatstroke. Background Technology

[0002] Heatstroke is a fatal acute illness caused by exposure to hot and humid environments, characterized by a rapid increase in core body temperature (>40°C) and abnormal central nervous system function. Its core pathology lies in the systemic inflammatory response triggered by high temperatures and the resulting mixed programmed cell death (pan-apoptosis) that ultimately leads to multi-organ failure and even death. Studies have shown that activation of Z-DNA binding protein 1 (ZBP1) is a key factor driving pan-apoptosis in heatstroke, particularly in target organs such as the liver and lungs.

[0003] In the early stages of heatstroke, the expression level of the key driver ZBP1 is extremely low, and it is only significantly upregulated by HSF1 a considerable time after high-temperature exposure (12 hours), subsequently triggering fatal PANoptosis (mixed programmed cell death). Traditional small-molecule inhibitors targeting ZBP1 lack sufficient binding targets and are ineffective during the critical early treatment window, making it difficult to prevent PANoptosis and multiple organ dysfunction. However, the current lack of precise means to effectively intervene in this core ZBP1-pan-apoptosis pathway in the early stages of the disease severely hinders the development of effective drugs.

[0004] Current clinical treatments heavily rely on rapid physical cooling (such as cold water immersion, evaporative cooling, and wrapping with ice blankets). While this is crucial for reducing mortality, its effect is limited to lowering body temperature; it is a passive intervention and cannot specifically inhibit ZBP1 expression and its driven pan-apoptotic core mechanism. Even after body temperature decreases, the initiated pan-apoptotic process can still cause organ damage. Physical cooling has no preventative function and its implementation depends on specific equipment.

[0005] In terms of drug treatment, there are currently no specific chemical or biological drugs on the market globally that target the ZBP1-pan-apoptotic core pathway. Although there are explorations of traditional Chinese medicine compositions or active monomers for heatstroke, their mechanisms of action are usually broad and unclear, lacking specific and efficient targeted intervention capabilities for the ZBP1-pan-apoptotic pathway, making it difficult to achieve precise regulation of specific genes in key organs.

[0006] A key mechanistic barrier lies in the spatiotemporal characteristics of ZBP1 expression: basal ZBP1 expression is extremely low in healthy tissues. Following heat stress, ZBP1 expression is delayed, subsequently triggering pan-apoptosis. This delay makes conventional small-molecule inhibitors ineffective during the critical early therapeutic window (several hours after heat exposure) due to a lack of sufficient target protein binding.

[0007] In summary, existing heatstroke prevention and treatment technologies suffer from several core deficiencies and gaps, including a lack of targeted drugs for the core mechanisms of heatstroke, an inability to address the failure of the early treatment window due to delayed ZBP1 expression, a lack of effective preventive measures, and a lack of targeted and precise treatment for critical organs such as the liver and lungs.

[0008] Therefore, there is an urgent need to develop strategies that can effectively suppress ZBP1 levels during the upregulation of ZBP1 expression. Summary of the Invention

[0009] The purpose of this invention is to provide an application of DNAzyme in the preparation of drugs for treating heatstroke, in order to solve the core defects and gaps in the existing heatstroke prevention and treatment technologies mentioned in the background art, such as the lack of targeted drugs for the core mechanism, the inability to solve the failure of the early treatment window caused by delayed ZBP1 expression, the lack of effective prevention methods, and the lack of targeted and precise treatment for key organs such as the liver and lungs.

[0010] To achieve the above objectives, the present invention provides an application of a DNAzyme in the preparation of a drug for treating heatstroke, wherein the DNAzyme is a DNAzyme that targets and regulates the expression of ZBP1 protein.

[0011] In one specific embodiment, the DNAzyme includes at least one of DNAzyme_SEQ_1, DNAzyme_SEQ_2, DNAzyme_SEQ_3, DNAzyme_SEQ_4, DNAzyme_SEQ_5, DNAzyme_SEQ_6, DNAzyme_SEQ_7, and DNAzyme_SEQ_8;

[0012] The DNAzyme_SEQ_1 sequence is:

[0013] GGGACTCTTGTGTGAAAGCTGGCCGAGCCTCCAGAATGAGCTATG;

[0014] The DNAzyme_SEQ_2 sequence is:

[0015] ACGTGAGTGGTAGATAAGCTGGCCGAGCCTTCCACGTCTGTCCGT;

[0016] The DNAzyme_SEQ_3 sequence is:

[0017] TATGTCTTGGCCTTCAAGCTGGCCGAGCCTGACGTGAGTGGTAGA;

[0018] The DNAzyme_SEQ_4 sequence is:

[0019] GAGCTATGTCTTGGCAAGCTGGCCGAGCCTTCCTGAGGTGAGTG;

[0020] The DNAzyme_SEQ_5 sequence is:

[0021] CAGAATGAGCTAGGTAAGCTGGCCGAGCCTATGTCTTGGCCTTCC;

[0022] The DNAzyme_SEQ_6 sequence is:

[0023] TGACTCCAGAATGAGAAGCTGGCCGAGCCTATGTCTTGGCCTTCC;

[0024] The DNAzyme_SEQ_7 sequence is:

[0025] TAATCGCAGGGGACTAAGCTGGCCGAGCCTTGTGTGACTCCAGAA;

[0026] The DNAzyme_SEQ_8 sequence is:

[0027] AATAATCGCAGGAAAGCTGGCCGAGCCTCTTGTGTGACTCCAG.

[0028] In one specific implementation, the DNAzyme is DNAzyme_SEQ_1.

[0029] The present invention also provides a medicament for the prevention and treatment of heatstroke, the medicament comprising DNAzyme, wherein the DNAzyme comprises at least one of DNAzyme_SEQ_1, DNAzyme_SEQ_2, DNAzyme_SEQ_3, DNAzyme_SEQ_4, DNAzyme_SEQ_5, DNAzyme_SEQ_6, DNAzyme_SEQ_7, and DNAzyme_SEQ_8;

[0030] The DNAzyme_SEQ_1 sequence is:

[0031] GGGACTCTTGTGTGAAAGCTGGCCGAGCCTCCAGAATGAGCTATG;

[0032] The DNAzyme_SEQ_2 sequence is:

[0033] ACGTGAGTGGTAGATAAGCTGGCCGAGCCTTCCACGTCTGTCCGT;

[0034] The DNAzyme_SEQ_3 sequence is:

[0035] TATGTCTTGGCCTTCAAGCTGGCCGAGCCTGACGTGAGTGGTAGA;

[0036] The DNAzyme_SEQ_4 sequence is:

[0037] GAGCTATGTCTTGGCAAGCTGGCCGAGCCTTCCTGAGGTGAGTG;

[0038] The DNAzyme_SEQ_5 sequence is:

[0039] CAGAATGAGCTAGGTAAGCTGGCCGAGCCTATGTCTTGGCCTTCC;

[0040] The DNAzyme_SEQ_6 sequence is:

[0041] TGACTCCAGAATGAGAAGCTGGCCGAGCCTATGTCTTGGCCTTCC;

[0042] The DNAzyme_SEQ_7 sequence is:

[0043] TAATCGCAGGGGACTAAGCTGGCCGAGCCTTGTGTGACTCCAGAA;

[0044] The DNAzyme_SEQ_8 sequence is:

[0045] AATAATCGCAGGAAAGCTGGCCGAGCCTCTTGTGTGACTCCAG.

[0046] In one specific implementation, the DNAzyme is DNAzyme_SEQ_1.

[0047] In one specific embodiment, the drug further includes a delivery vector for targeted delivery of the DNAzyme.

[0048] In one specific implementation, the delivery carrier is a TPN.

[0049] In one specific embodiment, the drug is an oral formulation and / or an injectable formulation.

[0050] Compared with the prior art, the present invention has the following beneficial effects:

[0051] This invention is of great value in fundamentally overcoming the prevention and treatment of heatstroke.

[0052] This invention overcomes the limitations of traditional small molecule inhibitors in the early intervention of heatstroke; provides a treatment strategy that can actively prevent the occurrence of PANoptosis; solves the problem of insufficient heat sensitivity of the body to high temperature environments; develops an efficient gene silencing tool with organ targeting; and provides a heatstroke solution that integrates prevention and treatment.

[0053] This invention fully validated the significant efficacy of DNAzyme_SEQ_1 in the prevention and treatment of heatstroke through systematic experiments. DNAzyme_SEQ_1 delivered via TPNs vectors exhibited clear liver and lung targeting in mice, with significantly higher fluorescence intensity than in other organs, ensuring precise drug targeting of key damage sites in heatstroke. In survival analysis experiments, the 7-day survival rate of the heatstroke model group and the blank vector group was only 10%, while the survival rates of the low- and high-dose DNAzyme_SEQ_1 treatment groups increased to 50% and 70%, respectively, demonstrating good dose-dependency.

[0054] Serological markers showed that the liver function indicators ALT and AST, and the kidney function indicators BUN and CREA in mice treated with DNAzyme_SEQ_1 were significantly lower than those in the model group, effectively alleviating liver and kidney damage. Western blotting and histological analysis further revealed that DNAzyme_SEQ_1 can inhibit ZBP1 expression in the liver and lungs, block the activation of pan-apoptotic proteins, and prevent organ structural damage. In addition, infrared monitoring revealed that DNAzyme_SEQ_1 can upregulate the sensitivity of mice to high-temperature environments, prompting the body to activate heat dissipation mechanisms earlier and reducing the risk of heatstroke. This invention provides a novel and effective solution for the prevention and treatment of heatstroke, offering significant advantages over traditional methods, including mechanistic innovation and precise targeting.

[0055] In addition to the objectives, features, and advantages described above, the present invention has other objectives, features, and advantages. The present invention will now be described in further detail. Attached Figure Description

[0056] The accompanying drawings, which form part of this application, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0057] Figure 1 This is a schematic diagram illustrating the principle of DNAzyme blocking ZBP1 protein expression in this invention;

[0058] Figure 2This is a diagram showing the in vivo distribution of the nanocarrier (DNAzyme_SEQ_1) loaded with ZBP1-DNAzyme in this invention;

[0059] Figure 3 The following is an evaluation result of the efficacy of DNAzyme_SEQ_1 in preventing and treating heatstroke in this invention: survival curves of mice in each group (n=10), where n represents the number of mice in each group as 10;

[0060] Figure 4 The following is an evaluation result of the efficacy of DNAzyme_SEQ_1 in the prevention and treatment of heatstroke in this invention: ALT graph of serum liver function indicators in mice of each group (n=10);

[0061] Figure 5 The results of the efficacy evaluation of DNAzyme_SEQ_1 in the prevention and treatment of heatstroke in this invention are as follows: AST diagram of serum liver function indicators in mice of each group (n=10);

[0062] Figure 6 The results of the efficacy evaluation of DNAzyme_SEQ_1 in the prevention and treatment of heatstroke in this invention are as follows: CREA graph of serum renal function index of mice in each group (n=10);

[0063] Figure 7 The results of the efficacy evaluation of DNAzyme_SEQ_1 in the prevention and treatment of heatstroke in this invention are as follows: BUN graph of serum renal function index of mice in each group (n=10);

[0064] Figure 8 The following is an evaluation result of the efficacy of DNAzyme_SEQ_1 in the prevention and treatment of heatstroke in this invention: a graph showing the expression results of liver proteins in mice of each group;

[0065] Figure 9 The results of the efficacy evaluation of DNAzyme_SEQ_1 in the prevention and treatment of heatstroke in this invention are shown in the figure of lung protein expression results in mice of each group;

[0066] Figure 10 The following are the results of the efficacy evaluation of DNAzyme_SEQ_1 in the prevention and treatment of heatstroke in this invention: Immunohistochemical results of Cleavaged Caspase3 and TUNEL in the liver of mice in each group;

[0067] Figure 11 The following are the results of the efficacy evaluation of DNAzyme_SEQ_1 in the prevention and treatment of heatstroke in this invention: Immunohistochemical results of Cleavaged Caspase3 and TUNEL in the lungs of mice in each group;

[0068] Figure 12The results of the efficacy evaluation of DNAzyme_SEQ_1 in the prevention and treatment of heatstroke in this invention are: infrared results of the temperature sensitivity changes of mice in each group. Detailed Implementation

[0069] The embodiments of the present invention will be described in detail below. The specific embodiments described herein are merely illustrative of the present invention and are not intended to limit the present invention.

[0070] This invention provides the application of a DNAzyme in the preparation of a drug for treating heatstroke, wherein the DNAzyme is a DNAzyme that targets and regulates the expression of ZBP1 protein.

[0071] The DNAzyme includes at least one of DNAzyme_SEQ_1, DNAzyme_SEQ_2, DNAzyme_SEQ_3, DNAzyme_SEQ_4, DNAzyme_SEQ_5, DNAzyme_SEQ_6, DNAzyme_SEQ_7, and DNAzyme_SEQ_8;

[0072] The DNAzyme_SEQ_1 sequence is:

[0073] GGGACTCTTGTGTGAAAGCTGGCCGAGCCTCCAGAATGAGCTATG;

[0074] The DNAzyme_SEQ_2 sequence is:

[0075] ACGTGAGTGGTAGATAAGCTGGCCGAGCCTTCCACGTCTGTCCGT;

[0076] The DNAzyme_SEQ_3 sequence is:

[0077] TATGTCTTGGCCTTCAAGCTGGCCGAGCCTGACGTGAGTGGTAGA;

[0078] The DNAzyme_SEQ_4 sequence is:

[0079] GAGCTATGTCTTGGCAAGCTGGCCGAGCCTTCCTGAGGTGAGTG;

[0080] The DNAzyme_SEQ_5 sequence is:

[0081] CAGAATGAGCTAGGTAAGCTGGCCGAGCCTATGTCTTGGCCTTCC;

[0082] The DNAzyme_SEQ_6 sequence is:

[0083] TGACTCCAGAATGAGAAGCTGGCCGAGCCTATGTCTTGGCCTTCC;

[0084] The DNAzyme_SEQ_7 sequence is:

[0085] TAATCGCAGGGGACTAAGCTGGCCGAGCCTTGTGTGACTCCAGAA;

[0086] The DNAzyme_SEQ_8 sequence is:

[0087] AATAATCGCAGGAAAGCTGGCCGAGCCTCTTGTGTGACTCCAG.

[0088] The DNAzyme is DNAzyme_SEQ_1.

[0089] The present invention also provides a medicament for the prevention and treatment of heatstroke, the medicament comprising DNAzyme, wherein the DNAzyme comprises at least one of DNAzyme_SEQ_1, DNAzyme_SEQ_2, DNAzyme_SEQ_3, DNAzyme_SEQ_4, DNAzyme_SEQ_5, DNAzyme_SEQ_6, DNAzyme_SEQ_7, and DNAzyme_SEQ_8;

[0090] The DNAzyme_SEQ_1 sequence is:

[0091] GGGACTCTTGTGTGAAAGCTGGCCGAGCCTCCAGAATGAGCTATG;

[0092] The DNAzyme_SEQ_2 sequence is:

[0093] ACGTGAGTGGTAGATAAGCTGGCCGAGCCTTCCACGTCTGTCCGT;

[0094] The DNAzyme_SEQ_3 sequence is:

[0095] TATGTCTTGGCCTTCAAGCTGGCCGAGCCTGACGTGAGTGGTAGA;

[0096] The DNAzyme_SEQ_4 sequence is:

[0097] GAGCTATGTCTTGGCAAGCTGGCCGAGCCTTCCTGAGGTGAGTG;

[0098] The DNAzyme_SEQ_5 sequence is:

[0099] CAGAATGAGCTAGGTAAGCTGGCCGAGCCTATGTCTTGGCCTTCC;

[0100] The DNAzyme_SEQ_6 sequence is:

[0101] TGACTCCAGAATGAGAAGCTGGCCGAGCCTATGTCTTGGCCTTCC;

[0102] The DNAzyme_SEQ_7 sequence is:

[0103] TAATCGCAGGGGACTAAGCTGGCCGAGCCTTGTGTGACTCCAGAA;

[0104] The DNAzyme_SEQ_8 sequence is:

[0105] AATAATCGCAGGAAAGCTGGCCGAGCCTCTTGTGTGACTCCAG.

[0106] The DNAzyme is DNAzyme_SEQ_1.

[0107] The drug also includes a delivery vector for targeted delivery of DNAzymes.

[0108] The delivery carrier is tea polyphenol nanoparticles (TPNs).

[0109] The drug is an oral preparation and / or an injectable preparation.

[0110] Example 1

[0111] Experimental methods:

[0112] 1.1 Animals: Eight-week-old male C57BL / 6 mice were purchased from Hunan Slack Jingda Experimental Animal Company and placed in an SFP environment with free access to food and water.

[0113] 1.2 In vivo distribution: Mice were administered fluorescently modified DNAzyme_SEQ_1 via intravenous injection. Heart, liver, spleen, lung and kidney were collected from mice at 6, 12, 18 and 24 hours after injection and imaged using an in vivo imaging system.

[0114] 1.3 Heatstroke Model:

[0115] Mice were randomly assigned to different groups and administered PBS, a blank vector, and different doses of DNAzyme_SEQ_1 via tail vein injection one day prior to heat exposure. To induce heatstroke in mice, the animals were placed in a climate chamber at an ambient temperature of 39°C and a relative humidity of 60% ± 5% for 2.5 hours. Core body temperature was monitored using a rectal thermometer and recorded at least every 15 minutes. After heat stress exposure, all mice were immediately returned to their original cages at an ambient temperature of 25°C with free access to food and water. Mice in the normothermic control group received the same procedure without heat stress exposure.

[0116] 1.4 Survival analysis: The survival status of each group of mice was observed and recorded within 7 days after the establishment of the heatstroke model. Each group consisted of 10 mice. The survival rate was calculated and the survival curves were compared using the log-rank test.

[0117] 1.5 Serological marker detection: Mice were anesthetized 24 hours after the establishment of the heatstroke model. Blood was collected by enucleation of the eyeballs, centrifuged, and the serum was stored at 4°C. The fresh serum collected from the mice was used to detect liver function markers (ALT, AST) and kidney function markers (BUN, CREA) on an automated liver function analyzer.

[0118] 1.6 Western Blot Analysis:

[0119] Twenty-four hours after establishing the heatstroke model, mice were anesthetized and euthanized. Liver and lungs were removed, washed with physiological saline, blotted dry with filter paper, and cryopreserved in liquid nitrogen. The dissected liver and lungs were rinsed and drained in pre-chilled PBS, then transferred to 2 mL centrifuge tubes and placed in a pre-chilled homogenizer on ice. An appropriate amount of lysis buffer was prepared according to a ratio of enhanced RIPA lysis buffer to protease inhibitor PMSF of 100:1. Based on the tissue volume, an appropriate amount of lysis buffer (200 μL / 50 mg) was added, ensuring complete coverage of the tissue. The tissue was homogenized on ice using a homogenizer to ensure thorough tissue disruption for effective protein extraction. The homogenized tissue sample was transferred to a pre-chilled centrifuge tube and incubated on ice for 30 min for lysis, gently shaking the tube for a few seconds every 10 min to promote lysis. After lysis, the sample was centrifuged at 4°C and 13000 rpm for 15 min, and proteins were analyzed by Western blotting (WB).

[0120] 1.7 Histological analysis:

[0121] Twenty-four hours after establishing the heatstroke model, mice were anesthetized and euthanized. Liver and lung tissues were removed, washed with physiological saline, blotted dry with filter paper, and fixed with 4% paraformaldehyde for 24 hours. Liver and lung tissues were paraffin-embedded, sectioned, and blocked. The sections were then incubated overnight at 4°C with primary and secondary antibodies of Cleavaged Caspase 3 or TUNEL, followed by incubation at room temperature for 1 hour with HRP-labeled secondary antibody. DAB staining was performed, followed by hematoxylin counterstaining, dehydration, clearing, and mounting with neutral resin. Pathological changes and related protein expression changes were observed using an optical microscope.

[0122] 1.8 Infrared monitoring of surface temperature:

[0123] In the process of establishing the heatstroke model, the surface temperature of mice in each group was monitored using an infrared thermal imager (HIKVISION, K20).

[0124] 1.9 Statistical Analysis:

[0125] All quantitative data are expressed as mean ± standard deviation (SD). Each experiment was performed at least three times independently, and the number of replicates for each independent experiment is indicated in the corresponding legend. GraphPad Prism 8 was used for data visualization and statistical analysis. Student's t-test, one-way ANOVA, and two-way ANOVA were used to compare groups. Significance levels were defined as follows: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0126] Experimental results:

[0127] 2.1 Distribution within the body:

[0128] The results are as follows Figure 2 As shown, after tail vein injection of fluorescently modified DNAzyme_SEQ_1, the fluorescence intensity of the liver and lungs in the isolated organs was significantly stronger than that of other tissues, indicating that the DNAzyme_SEQ_1 of the present invention can accumulate in the liver and lungs and has targeting properties to the liver and lungs.

[0129] 2.2 Survival Analysis:

[0130] The results are as follows Figure 3As shown, the 7-day survival rate of mice in the heatstroke model group and the blank vector group was only 10%, while the 7-day survival rates of the low-dose and high-dose DNAzyme_SEQ_1 treatment groups reached 50% and 70%, respectively, after heatstroke modeling, showing a significant dose-dependent effect. This indicates that DNAzyme_SEQ_1 significantly improved the survival rate of heatstroke model mice, demonstrating that the DNAzyme_SEQ_1 of this invention has a good life-protective effect on heatstroke model mice, and this therapeutic effect is independent of the delivery vector. The low-dose DNAzyme_SEQ_1 treatment group was injected with DNAzyme_SEQ_1 at a dose of 50 nmol / kg based on mouse weight; the high-dose DNAzyme_SEQ_1 treatment group was injected with DNAzyme_SEQ_1 at a dose of 100 nmol / kg based on mouse weight.

[0131] 2.3 Serological marker detection:

[0132] The results are as follows Figure 4-7 As shown, the serum liver function indicators (ALT, AST) and kidney function indicators (BUN, CREA) in the heatstroke model group significantly increased, indicating successful modeling. The corresponding indicators in the low-dose and high-dose DNAzyme_SEQ_1 treatment groups were significantly lower than those in the heatstroke model group, showing a significant dose-dependent effect, while the corresponding indicators in the blank vector group did not show a decreasing trend. Therefore, DNAzyme_SEQ_1 significantly reduced the levels of liver and kidney function indicators in the serum of heatstroke mice, indicating that the DNAzyme_SEQ_1 of this invention can significantly prevent liver and kidney damage in heatstroke model mice, and this therapeutic effect is independent of the delivery vector.

[0133] 2.4 Western Blot Analysis:

[0134] The results are as follows Figure 8-9 As shown, DNAzyme_SEQ_1 can reduce the expression of ZBP1 in the liver and lungs, thereby decreasing the phosphorylation of pan-apoptotic proteins RIPK3 and MLKL, and the cleavage activation of Caspase3, Caspase8, GSDME, and GSDMD. Therefore, DNAzyme_SEQ_1 significantly inhibits the activation of pan-apoptotic proteins in the liver and lungs of heatstroke mice, indicating that DNAzyme_SEQ_1 of the present invention can prevent functional damage to the liver and lungs of heatstroke model mice by inhibiting pan-apoptosis, and this therapeutic effect is independent of the delivery vector.

[0135] 2.5 Histological analysis:

[0136] The results are as follows Figure 10-11As shown, DNAzyme_SEQ_1 can reduce the expression of cleaved caspase3 or TUNEL in the liver and lungs, while preventing structural damage to the liver and lungs. This indicates that DNAzyme_SEQ_1 of the present invention can prevent structural damage to the liver and lungs in a heatstroke model mouse by inhibiting pan-apoptosis, and this therapeutic effect is independent of the delivery vector.

[0137] 2.6 Infrared monitoring of surface temperature:

[0138] The results are as follows Figure 12 As shown, the body surface temperature of mice in the heatstroke model group and the blank vector group increased by about 3°C ​​within two hours of modeling, while the low-dose and high-dose DNAzyme_SEQ_1 treatment groups increased by 5.1°C and 5.2°C, respectively, within two hours of modeling. This indicates that the DNAzyme_SEQ_1 of the present invention can prevent organ damage caused by heatstroke by upregulating the sensitivity of mice to high temperature and high humidity environments, and this preventive effect is independent of the delivery vector.

[0139] The above description, in conjunction with specific preferred embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, various simple deductions and substitutions can be made without departing from the inventive concept, and all such modifications and substitutions should be considered within the scope of protection of the present invention.

Claims

1. The application of a DNAzyme in the preparation of a drug for treating heatstroke, characterized in that, The DNAzyme is a DNAzyme that targets and regulates the expression of ZBP1 protein; the DNAzyme is DNAzyme_SEQ_1; The DNAzyme_SEQ_1 sequence is: GGGACTCTTGTGTGAAAGCTGGCCGAGCCTCCAGAATGAGCTATG.

2. A medicine for the prevention and treatment of heatstroke, characterized in that, The drug includes a DNAzyme, wherein the DNAzyme is DNAzyme_SEQ_1; The DNAzyme_SEQ_1 sequence is: GGGACTCTTGTGTGAAAGCTGGCCGAGCCTCCAGAATGAGCTATG.

3. The medicament for the prevention and treatment of heatstroke according to claim 2, characterized in that, The drug also includes a delivery vector for targeted delivery of DNAzymes.

4. The medicament for the prevention and treatment of heatstroke according to claim 3, characterized in that, The delivery carrier is a TPN.

5. The medicament for the prevention and treatment of heatstroke according to claim 2, characterized in that, The drug is an oral preparation and / or an injectable preparation.