Method for determining biological activity of luteinizing hormone

Abstract

The invention discloses a method for determining the biological activity of luteinizing hormone (LH), the method is used for detecting the biological activity of LH based on an HTRF method of LHCGR (-Ex10)-CRE-luc-HEK293 cells, and the method is simple and convenient to operate, short in time consumption, high in accuracy, good in repeatability and strong in specificity; besides, the method provided by the invention can be used for distinguishing the biological activities of LH and hCG, is higher in specificity, can be used as a conventional detection method and identification method for the in-vitro biological activity of rhLH, and also provides a new method for quality control and stability evaluation of rhLH products.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological activity detection of biological drugs, and particularly relates to a method for determining the biological activity of luteinizing hormone. BACKGROUND

[0002] Luteinizing hormone (LH) is an important reproductive regulatory factor secreted by the anterior pituitary, which coordinates with follicle-stimulating hormone (FSH) to regulate gonadal function. LH exhibits a dual role in the physiological activities of both sexes: in females, LH and FSH work together to promote follicle maturation, secrete estrogen, ovulation, and the generation and maintenance of corpus luteum; in males, LH activates testicular interstitial cells to drive testosterone secretion to ensure spermatogenesis. With the in-depth study of the role of LH in the reproductive process, LH is expected to have a major impact on the fields of assisted reproductive technology innovation and precise treatment of endocrine diseases. In terms of molecular mechanism of action, LH and human chorionic gonadotropin (hCG) act on the common receptor LHCGR, mainly through the activation of the classical cAMP-dependent pathway: LHCGR-Gs protein coupling activates adenylate cyclase to catalyze the generation of second messenger cAMP, and then activates protein kinase A (PKA). Since LH and hCG both act on LHCGR and exert related biological effects, therefore, developing a determination method that can effectively distinguish the biological activity of LH and hCG has become a key technical problem to be solved in the field of in vitro activity determination of LH.

[0003] The commonly used exogenous LH drugs in clinic include recombinant LH (rLH) and human menopausal gonadotropins (hMG). rhLH is a recombinant protein drug expressed in Chinese hamster ovary cells using recombinant DNA technology. rhLH is similar in structure and biology to endogenous gonadotropin, but shows high heterogeneity of glycosylation. Recombinant human luteinizing hormone alpha (Luveris®) as a landmark product is the first and only commercialized rhLH drug. Biological activity is a key quality attribute of rhLH drugs, and the LH activity determination methods currently collected in domestic and foreign pharmacopoeias are all in vivo animal methods. The luteinizing hormone bioassay method in the Chinese Pharmacopoeia 2025 Edition General Chapter 1217 and the young rat seminal vesicle weight gain method specified in the European Pharmacopoeia both determine the potency of luteinizing hormone in the test product by comparing the effects of urinary gonadotropin standard and test product on the seminal vesicle weight gain of young rats. This method was developed in the 1960s and has three major limitations: first, the animal experiment operation is complex and time-consuming, which does not meet the requirements of the "3R principle". Second, the principle of the rat seminal vesicle weight gain method is that LH or hCG activates the LHCGR on the surface of testicular interstitial cells, then activates the cAMP / PKA signaling pathway, and activates Steroidogenic Acute Regulatory Protein (StAR). The activated StAR binds to the transport protein on the outer membrane of mitochondria to accelerate the transport of cholesterol from the outer membrane to the inner membrane of mitochondria, and then cholesterol is catalyzed to testosterone in the mitochondria, and testosterone promotes the development and maturation of rat seminal vesicles. Therefore, this method only evaluates the potential of LH or hCG to promote the generation of testosterone, a steroid hormone, and cannot evaluate the LH and hCG specific non-steroidogenic functions of LH in the female reproductive endocrine environment. Third, hMG contains not only LH but also hCG, and excessive hCG can induce ovarian hyperstimulation syndrome. The in vivo animal method cannot distinguish the activities of LH and hCG, and cannot meet the high-quality development requirements of LH drug quality control. Therefore, it is urgent to establish an efficient and simple in vitro activity determination method that can distinguish the activities of LH and hCG for LH product quality control and release inspection. SUMMARY

[0004] Based on the deficiencies of the prior art, the purpose of the present application is to establish a method that can distinguish the in vitro biological activities of luteinizing hormone and chorionic gonadotropin, and provide a new method for luteinizing hormone drug quality control and safety evaluation.

[0005] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:

[0006] The present application provides a preparation method of a cell strain for determining the biological activity of luteinizing hormone in a first aspect.

[0007] Further, the method comprises the following steps:

[0008] 1) transfecting an effector cell with an expression vector carrying a LHCGR(-Ex10) gene to obtain a cell strain expressing LHCGR(-Ex10), wherein the sequence of the LHCGR(-Ex10) gene is shown in SEQ ID NO. 1;

[0009] 2) transfecting the cell strain expressing LHCGR(-Ex10) with a luciferase expression vector carrying a CRE gene to obtain a cell strain co-expressing LHCGR(-Ex10) and CRE, wherein the sequence of the CRE gene is shown in SEQ ID NO. 2.

[0010] Further, the effector cell is a HEK293 cell.

[0011] Further, the expression vector comprises a plasmid vector, a phage vector, and a viral vector.

[0012] Further, the expression vector is a viral vector.

[0013] Further, the expression vector is a lentivirus vector.

[0014] Further, the transfection method comprises physical mediation, chemical mediation, and biological mediation.

[0015] Further, the transfection method is biological mediation.

[0016] Further, the transfection method is lentivirus infection.

[0017] In some embodiments, the cell types commonly used for transfection are diverse, including but not limited to the following:

[0018] 1) primary cells and their derivatives, which are directly isolated from the tissues of organisms, not subjected to long-term in vitro culture, and maintain high physiological activity and differentiation potential;

[0019] 2) tumor cell lines: such as human breast cancer cells (MCF-7), human lung cancer cells (A549), human cervical cancer cells (HeLa), etc., which have high division speed and stability, and are commonly used for gene function research and drug screening;

[0020] 3) cell lines derived from specific tissues:

[0021] Human embryonic kidney cells (HEK-293): with high transfection efficiency and stability, commonly used for gene cloning and vaccine production;

[0022] Human Embryonic Lung Cells (HEL): Used as recipient cells in certain experiments;

[0023] Human Umbilical Vein Endothelial Cells (HUVEC): Used for studying vascular biology and cardiovascular diseases, etc.

[0024] 4) Animal Cell Lines:

[0025] Baby Hamster Kidney Cells (BHK-21): Widely used in virology research and other biomedical research;

[0026] Mouse Embryonic Fibroblasts (NIH3T3): With low immunogenicity and high division speed, commonly used for gene knockout and drug screening;

[0027] Other Special Cell Types:

[0028] Neuronal Cells: Used for neurobiology research;

[0029] Rat Hepatocytes: Used for drug metabolism and toxicity research;

[0030] Rat Glioma Cells (C6): With high differentiation and stability, commonly used for drug screening and tumor research.

[0031] The skilled person in the art can choose different effector cells according to the prior art. In a specific embodiment of the present application, the effector cell is HEK293.

[0032] In the present application, the term "transfection" refers to the process of introducing exogenous DNA (such as plasmid) into eukaryotic cells, so that the exogenous gene is expressed in the cells. Exogenous DNA transfection is an important technology in genetic engineering, widely used in the fields of gene function research, protein production, etc.

[0033] The methods of cell transfection include physical mediation, chemical mediation, and biological mediation. The physical mediation includes electroporation, microinjection, and gene gun method; the chemical mediation includes calcium phosphate coprecipitation, cationic polymer method, and cationic liposome method; the biological mediation is mainly virus mediation, such as lentivirus and adenovirus, etc. In a specific embodiment of the present application, the transfection method is lentivirus transfection.

[0034] Further, the screening in step 1) includes adding antibiotics for screening.

[0035] Further, the screening in step 1) is adding bleomycin for screening.

[0036] Further, the screening in step 2) includes: adding antibiotics for screening, monoclonal isolation culture, and flow analysis.

[0037] Further, the adding of the antibiotic in step 2) is adding puromycin and blasticidin for screening.

[0038] In cell screening, antibiotics are usually used as a tool for resistance screening to distinguish successfully transfected cells from untransfected cells. These antibiotics allow cells successfully transfected and expressing antibiotic resistance genes to survive by inhibiting the growth or killing untransfected cells.

[0039] Further, the antibiotics include but are not limited to: penicillin-streptomycin mixture, G-418 (Geneticin), Blasticidin, Hygromycin B, Puromycin, 6-thioguanine, Ampicillin, Zeocin. In a specific embodiment of the present application, the antibiotic is Zeocin, Puromycin.

[0040] The second aspect of the present application provides a cell strain for determining the biological activity of luteinizing hormone.

[0041] Further, the cell strain is named LHCGR(-Ex10)-CRE-luc-HEK293, preserved in the China General Microbiological Culture Collection Center, located at No. 1, Beichen West Road, Hua-yuan District, Beijing, with a preservation number of CGMCC No. 46581, a classification name of Human HEK293 cell, and a preservation date of August 28, 2025.

[0042] The third aspect of the present application provides a method for detecting the biological activity of luteinizing hormone by using HTRF technology.

[0043] Further, the method comprises the following steps:

[0044] The luteinizing hormone is added to the cell strain of the second aspect of the present application for incubation, and after incubation, cAMP antibody, cAMP-d2 and cAMP lysis buffer mixture are added for incubation at room temperature for 50 min to 70 min. After incubation, the fluorescence signal value is read by using an enzyme marker, and the biological activity of the luteinizing hormone is determined according to the determined fluorescence signal value.

[0045] Further, the initial concentration of the luteinizing hormone is 150 nmol·mL -1 ~250 nmol·mL -1 .

[0046] Further, the initial concentration of the luteinizing hormone is 200 nmol·mL -1 .

[0047] Further, the dilution factor of the luteinizing hormone is 6 times to 8 times.

[0048] Further, the dilution factor of the luteinizing hormone is 7 times.

[0049] Further, the seeding density of the cells is 24000 cells / well to 36000 cells / well.

[0050] Further, the seeding density of the cells is 24000 cells / well.

[0051] Further, the incubation time is 30 min to 60 min.

[0052] Further, the incubation time is 30 min.

[0053] In the present application, the applicant optimizes the initial concentration of the luteinizing hormone, the dilution factor, the seeding density of the cells and the incubation time, and finds that the optimal initial concentration of the luteinizing hormone is 200 nmol·mL -1 , the optimal dilution factor is 7 times dilution, the optimal seeding density of the cells is 24000 cells / well, and the optimal incubation time is 30 min.

[0054] In the present application, the biological activity of the luteinizing hormone is determined by fitting a four-parameter curve after measuring the fluorescence signal value. The term fitting a four-parameter curve is a mathematical method for describing a set of data by fitting a curve and obtaining a function equation that can describe the relationship of the data in order to predict future data. The four-parameter curve is usually defined by four parameters, which have practical significance in the biological context. For example, in the detection of drug biological activity, the four parameters may represent: the lower limit value of absorbance (D), the upper limit value of absorbance (A), i.e. the minimum and maximum values of absorbance; the half-reaction concentration (C), i.e. the value of drug concentration when it reaches half of the maximum response; and the slope of the curve (B). Through these parameters, the experimental data can be more accurately understood and analyzed, thereby providing deeper insights for biological research.

[0055] The fourth aspect of the present application provides a cell preparation.

[0056] Further, the cell preparation comprises the cell strain of the second aspect of the present application;

[0057] Further, the cell preparation includes a suspension type cell preparation, a solution type cell preparation, and a solid dispersion type cell preparation.

[0058] The fifth aspect of the present application provides an evaluation system.

[0059] Further, the evaluation system includes the following components: the cell strain according to the second aspect of the present application, a luteinizing hormone drug sample, and a reference.

[0060] In the present application, the term "system" refers to a drug quality control system, which refers to a scientific management method for controlling various factors in the production process of a drug to ensure that the quality of the drug meets the predetermined quality standards and requirements.

[0061] In the present application, the term "sample" refers to a test sample to be identified or determined. In the present application, the luteinizing hormone drug sample includes a drug sample produced in industrial production and to be detected for its biological activity.

[0062] The sixth aspect of the present application provides the use of any one of the following.

[0063] Further, the use includes:

[0064] 1) the use of the cell strain according to the second aspect of the present application or the cell preparation according to the fourth aspect of the present application in the preparation of a product for detecting the biological activity of luteinizing hormone;

[0065] 2) the use of the cell strain according to the second aspect of the present application, the method according to the third aspect of the present application, the cell preparation according to the fourth aspect of the present application, or the evaluation system according to the fifth aspect of the present application in the quality control of a luteinizing hormone drug;

[0066] 3) the use of the evaluation system according to the fifth aspect of the present application in the evaluation of the biological activity of a luteinizing hormone drug. Further, the type of the product is a kit.

[0067] In some embodiments, the components of the kit can be packaged in an aqueous medium or in lyophilized form. Suitable containers for the kit generally include at least one vial, test tube, flask, bottle, syringe or other container, in which one component can be placed, and preferably, suitably aliquoted. Where more than one component is present in the kit, the kit will also contain a second, third, or additional containers to hold the additional components, in separate storage containers. However, components of different compositions can be included in one vial. The kit of the present application will also typically include a container for containing the reagents, sealed to prevent contamination or evaporation, for commercial sale. Such containers can include injection or blow molded plastic containers into which the desired vials are retained.

[0068] Advantages and beneficial effects of the present application:

[0069] The application provides an HTRF method for detecting the in-vitro biological activity of rhLH based on LHCGR(-Ex10)-CRE-luc-HEK293 cells, which is simple to operate, short in time consumption, high in accuracy, good in repeatability and strong in specificity; in addition, the method provided by the application can distinguish the biological activity of LH and hCG, is more specific, can be used as a conventional detection method and identification of the in-vitro biological activity of rhLH, and provides a new method for quality control and stability evaluation of rhLH products. BRIEF DESCRIPTION OF DRAWINGS

[0070] Figure 1 It is a flow cytometry diagram for detecting the expression of the receptor of the polyclonal LHCGR(-Ex10)-CRE-luc-HEK293 cell strain;

[0071] Figure 2 It is a flow cytometry diagram for detecting the expression of the receptor of the monoclonal LHCGR(-Ex10)-CRE-luc-HEK293 cell strain;

[0072] Figure 3 It is a parameter optimization result diagram; wherein, Figure 3 A is an initial concentration optimization result diagram; Figure 3 B is a dilution multiple optimization result diagram; Figure 3 C is a cell inoculation density optimization result diagram; Figure 3 D is an incubation time optimization result diagram; Figure 3 E is a biological activity detection result diagram based on LHCGR(-Ex10)-CRE-luc-HEK293 cells; Figure 3 F is a biological activity detection result diagram based on LHCGR-CRE-luc-HEK293 cells;

[0073] Figure 4 It is a methodological verification result diagram; wherein Figure 4 A is a cell function stability result diagram; Figure 4 B is a specificity result diagram; Figure 4 C is a heat-damaged sample activity determination result diagram;

[0074] Figure 5 It is a result diagram (3 times) for determining the biological activity of rhLH and rhCG based on HTRF technology;

[0075] Figure 6 It is a result diagram (3 times) for determining the biological activity of rhLH and rhCG based on a reporter gene method;

[0076] Figure 7 It is a result diagram for determining the activity of a rhLH and rhCG mixture; Figure 7A is the bioactivity determination result chart of rhLH and rhCG mixture in different proportions; Figure 7 B, C are the bioactivity determination result charts of HMG samples. DETAILED DESCRIPTION

[0077] The technical solutions of the present application are further described and explained below through specific examples. It should be understood that the specific examples described herein are only used to help understand the present application and are not used to specifically limit the present application. If not specifically stated, the raw materials used in the examples of the present application are all commonly used raw materials in the art, and the methods used in the examples are all conventional methods in the art.

[0078] The reagents used in the following examples are as follows:

[0079] DMEM medium (batch number 11995065), 0.05% trypsin-EDTA (batch number 25300054), phosphate buffer (PBS, batch number 2647463), puromycin (Puromycin, batch number A1113803) were all purchased from Gibco Company, USA; fetal bovine serum (FBS, batch number 012C0221A) was purchased from ExCell Company, China; zeocin (batch number 450430) was purchased from Invitrogen Company, USA; 3-isobutyl-1-methylxanthine (IBMX, batch number 102606487) was purchased from Merck-SigmaAldrich Company, Germany; HTRF cAMP Gs Dynamic kit (batch number 38B) was purchased from Revvity Company, USA. Recombinant human luteinizing hormone stock solution (r-hLH), recombinant human chorionic gonadotropin national standard (r-hCG), recombinant human thyroid stimulating hormone injection stock solution (r-hTSH), and recombinant human follicle stimulating hormone injection stock solution (r-hFSH) were all left over by the laboratory.

[0080] Preparation of reagents:

[0081] Complete medium: DMEM medium + 10% FBS + 3 μg·mL -1 Puromycin+200 μg·mL -1 Zeocin;

[0082] Sample diluent / base medium: DMEM medium + 10% FBS + 0.5 mmol·ml -1 IBMX.

[0083] Example 1 Construction of cell lines

[0084]

[0085] 2, CRE-luc lentivirus vector construction: The sequence of CRE-mini needs to be constructed in front of the luciferase gene, which contains the regulatory region and the promoter region, which is used to regulate the expression of the luciferase gene. The sequence of CRE is TGACGTCAGCTGCCAGATCCCATGGCCGTCATACTGTGACGTCTTTCAGACACCCCATTGACGTCA (SEQ ID NO. 2), the sequence of minipromoter is TAGAGGGTATATAATGGAAGCTCGACTTCCAG (SEQ ID NO. 3), and the sequence of CRE-mini is TGACGTCAGCTGCCAGATCCCATGGCCGTCATACTGTGACGTCTTTCAGACACCCCATTGACGTCAATGGGAGAACAGATCTGGCCTCGGCGGCCAAGCTTAGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG (SEQ ID NO. 4).

[0086] 3, Screening process: After the LHCGR(-Ex10) lentivirus vector is transferred into HEK293 cells, 200 μg / ml Zeocin-containing selection medium is used for continuous screening for 3 weeks, and a stable polyclonal LHCGR(-Ex10)-HEK293 cell strain is obtained. Then the CRE-luc lentivirus vector is transferred into the polyclonal LHCGR(-Ex10)-HEK293 cell strain, and 3 μg / ml of puromycin and 200 μg / ml of Zeocin-containing selection medium is used for continuous screening for 3 weeks, and a stable polyclonal LHCGR(-Ex10)-CRE-luc-HEK293 cell strain is obtained. The polyclonal LHCGR(-Ex10)-CRE-luc-HEK293 cell strain is intracellularly stained and subjected to flow cytometry detection, and the results are shown in Figure 1 . The positive rate of the cells reaches 97.9%. The polyclonal cell strain is subjected to monoclonal screening, and a stable monoclonal cell strain is screened. The results of flow cytometry intracellular staining are shown in Figure 2 . The positive rates of the receptors of the 4 LHCGR(-Ex10)-CRE-luc-HEK293 cell strains screened by monoclonal screening are 50.9%, 98.5%, 97.9% and 96.6%, respectively. The positive rates of the receptors of 3 cell strains constructed all reach more than 95%, and the cell with the highest positive rate is selected for preservation and subsequent experimental research. The final culture medium formula for the monoclonal cells is: MEM culture medium + 10% FBS + 3 μg·ml -1Puromycin + 200 μg·ml -1 Zeocin

[0087] Example 2 Method establishment and parameter optimization

[0088] I. Experimental method

[0089] 1. In vitro biological activity detection by HTRF method:

[0090] The LHCGR(-Ex10)-CRE-luc-HEK293 cells in logarithmic growth phase were digested with 0.05% trypsin-EDTA, and the cell density was adjusted to 1.2×10 6 cells·ml -1 . The cell suspension was inoculated into a 96-well semi-hole cell culture whiteboard at 20 μL per well (about 24 000 cells per well). The rhLH was diluted to 200 nmol·mL -1 with the basic culture solution, and then 7-fold gradient dilution was performed in a transparent 96-well plate, with a total of 10 gradients. The diluted solution was added to the inoculated cell culture plate at 20 μL per well, with 2 replicate holes for each drug concentration (the initial concentration of drug action was 100 nmol·mL -1 ). The reaction plate was centrifuged at 300 rpm for 30 sec, and then incubated at 25 ℃±2 ℃ for 30 min±8 min. After incubation, 40 μL of cAMP antibody, cAMP-d2 and cAMP lysis buffer mixture was added to the culture plate per well, and incubated at room temperature for 60 min±9 min. The detection parameters of the microplate reader were set (Lm1-Ex 314 nm &620 nm&Cut off 570nm; Lm2-Ex 314 nm &668 nm&Cut off 630nm), and the fluorescence signal value was read.

[0091] The urinary menotropin national standard only has the in vivo animal method assigned value of the effective value, and no accurate content value of LH and CG, so the urinary menotropin in vitro biological activity determination uses the potency unit, and the starting concentration is determined to be 200 IU·mL -1 after optimization of experimental conditions. Other operations are consistent with the above steps.

[0092] 1.6 Data analysis

[0093] The test data were analyzed by SoftMax Pro software (Molecular Devices, USA, software version 7.1) according to the four-parameter regression calculation method in Chinese Pharmacopoeia 2020 edition General Rule 1431, and the graph was drawn by GraphPad Prism software (GraphPad, USA, software version 8.0.2). The logarithm of sample concentration was used as the abscissa, and the corresponding luminescence signal intensity (Relative Light Unit, RLU) was used as the ordinate. The four-parameter curve of dose-response reaction (error line representing the standard error of RLU average value) was fitted, the experimental data were processed according to the four-parameter regression calculation method in General Rule 1431, and the reliability test was performed on the analysis results by using variance analysis and F test. The reliability test requirements were as follows: the fitting four-parameter curve R 2 ≥0.98, the regression term should be very significant (P<0.01), and the deviation from parallel should not be significant (P≥0.01). The results passing the reliability test were calculated according to the following formula to calculate the relative potency (Relative Potency): sample relative potency (%) = control EC 50 / measured sample EC 50 × 100%. The half-effect concentration (50% of maximal effect, EC 50 ) was the C value of the control and the measured sample fitting the four-parameter curve in the constrained model.

[0094] 1.7 Optimization of experimental parameters

[0095] The LHCGR(-Ex10)-CRE-luc-HEK293 cells in the logarithmic growth phase were digested with 0.05% trypsin-EDTA, and then the cell density was adjusted to 1.2×10 6 cells·ml-1 with the basic culture medium. After the cells were inoculated according to the above method, r-hLH and r-hCG were diluted to 200 nmol·mL -1 -1 with the basic culture medium, 10 gradients of 6-fold gradient dilution were carried out in a transparent 96-well plate, each gradient had 2 duplicate wells, and the activity determination was carried out according to the above detection method. The initial r-hLH concentration was preliminarily determined to be 200 nmol·mL -1 -1. The r-hLH and r-hCG were diluted to 200 nmol·mL -1r-hLH and r-hCG were serially diluted 7-fold and 8-fold, respectively, and the fitted curves of different dilutions were compared to determine the optimal drug dilution. Cell densities were adjusted to 20,000, 24,000, 30,000, and 36,000 cells per well using basal culture medium and seeded into 96-well half-well white plates. Cell viability was determined according to the above detection method to determine the optimal cell seeding density. Four different drug incubation times of 30, 40, 50, and 60 min were set, and the optimal drug incubation time was selected according to the above detection method.

[0096] II. Experimental Results

[0097] To verify the biological activity of LHCGR(-Ex10)-CRE-luc-HEK293 cells in distinguishing between r-hLH and r-hCG, this study first explored the activity of 200 nmol·mL⁻¹ cells. -1 The ability of r-hLH and r-hCG to induce cMAP at initial concentrations. Figure 3 As shown in Figure A, the initial concentration of r-hLH and r-hCG was 200 nmol·mL⁻¹, with 10 concentration points obtained through a 6-fold serial dilution and two replicates. The four-parameter curve of rhCG failed to reach the upper plateau, while the four-parameter curve of rhLH covered both the upper and lower plateaus well, and the two curves showed a clear trend of difference. Therefore, 200 nmol·mL⁻¹ was chosen. -1 The initial concentration was used. To ensure the rhCG four-parameter curve effectively covered the upper and lower plateaus for subsequent comparison of rhLH and rhCG curves, two dilution factors, 7-fold and 8-fold, were selected, each with 10 dilution gradients. The curves at different dilution ratios were compared, and the results are shown in [Figure number missing]. Figure 3 B. When the dilution factor is 7-fold and 8-fold, the dose-response curves can well cover the upper and lower plateaus and the linear portion, and can clearly distinguish between rhLH and rhCG. To reduce the error generated during serial dilution, a dilution factor of 7-fold is sufficient. Cell density optimization results ( Figure 3 C) shows that the slopes of the four-parameter curves for the four cell densities are basically the same, and the trends of the curves are basically parallel, indicating that the amount of seeded cells has little impact on the experimental results. According to R... 2 The optimal cell density was selected as 24,000 cells / well. Drug treatment times were set at 30, 40, 50, and 60 min, and the results were (…). Figure 3 D) indicates that the signal-to-noise ratio decreases with increasing incubation time. Therefore, considering both the signal-to-noise ratio and R... 2 The value is selected to be incubated for 30 min after adding the sample.

[0098] The bioactivity was determined in LHCGR(-Ex10)-CRE-luc-HEK293 cells and LHCGR-CRE-luc-HEK293 cells, respectively, using the optimized experimental conditions, and the results are shown in Figures Figure 3 Figures E and F show that rhLH and rhCG can be distinguished in LHCGR(-Ex10)-CRE-luc-HEK293 cells, while the two curves are essentially coincident and rhLH and rhCG cannot be distinguished in LHCGR-CRE-luc-HEK293 cells.

[0099] Example 3 Methodology verification experiment

[0100] I. Experimental methods

[0101] According to the General Principles of Chinese Pharmacopoeia 9401, the relative accuracy, intermediate precision, linearity and range of the method were verified using a combined design. The r-hLH reference standard was diluted to 128, 160, 200, 250, 312 nmol·mL -1 The theoretical concentration of the sample to be tested, and the 5 samples to be tested corresponded to 64%, 80%, 100%, 125% and 156% of the relative potency level, respectively. In addition, a 200 nmol·mL -1 concentration of r-hLH was prepared as a control. The above-mentioned samples to be tested were diluted by 7-fold gradient in a transparent 96-well plate, a total of 10 gradients. The relative potency was detected by two experimenters on four different dates.

[0102] Method relative accuracy and linearity analysis: according to General Principles 9401, a linear regression equation of the potency theoretical value and the measured value was fitted, and the relative bias (RB) and confidence interval (CIRB) of the relative potency measured value at each potency level were calculated: RB=(potency measured value / potency theoretical value-1) x 100%; CIRB={(anti Ln(LCI) / potency theoretical value-1) x 100%, (anti Ln(UCI) / potency theoretical value-1) x 100%}. LCI is the 90% confidence lower limit of the natural logarithm average of the potency measured value at each potency level; UCI is the 90% confidence upper limit of the natural logarithm average of the potency measured value at each potency level.

[0103] Method intermediate precision analysis: according to General Principles 9401, the geometric standard deviation (GSD) and geometric coefficient of variation (GCV%) of the relative potency measured value at each potency level were calculated: GSD=anti Ln(SD), SD is the logarithmic standard deviation of the potency measured value at each potency level; GCV%=(GSD-1) x 100%.

[0104] Cell function stability experiment: the 5th generation and the 40th generation of cells were frozen respectively in continuous cell culture. The above-mentioned cells were recovered at the same time, and after continuous passage to stable cell state, the cells were used to determine the biological activity of r-hLH to verify the stability of the function of cells of different generations.

[0105] Specificity: To verify the specificity of the method, three kinds of glycoprotein hormones r-hTSH, r-hFSH and r-hLH were selected for testing. r-hLH, r-hTSH and r-hFSH were diluted to 200 nmol·mL -1 , and then 7-fold gradient dilution was performed, a total of 10 concentration gradients, 2 replicate wells for each concentration.

[0106] Preparation of r-hLH heat-damaged samples: r-hLH was taken and divided into 1.5 mL centrifuge tubes at 200 μL per tube. After sealing with sealing film, it was heated at 60 ℃ water bath for 0 h, 1 h, 5 h, 9 h, 24 h and 72 h respectively. The relative potency of the treated samples was determined to verify the specificity of the method.

[0107] Content determination: high performance liquid chromatography was used to detect the content change of the main component in r-hLH samples heated at 60 ℃ for different times. Chromatographic conditions: Shodex Protein KW-803 1000Å 5μm (8.0 mm × 300 mm) gel chromatographic column was used, 0.1M phosphoric acid-0.1M sodium sulfate buffer (pH 6.7) was used as the mobile phase, the flow rate was 1 mL·min -1 , the column temperature was 25℃, the detection wavelength was 214 nm, and the injection volume was 10 μL.

[0108] II. Experimental results

[0109] The activity of samples corresponding to 64%, 80%, 100%, 125% and 156% relative potency levels respectively was determined, and 8 relative potency determination values for each potency level were shown in Table 1.

[0110] Table 1. Results of rhLH biological activity determined by HTRF method

[0111]

[0112] Relative accuracy: the relative bias and its confidence interval of 8 relative potency determination values for each potency level were calculated. As shown in Table 2, the average relative bias of the relative potency determination values of the 5 potency levels was in the range of-3.0% to 2.1%. It met the requirement that the relative bias of the relative potency determination value should be within ±12%, and the relative accuracy was good.

[0113] Table 2 Relative bias and confidence interval of relative potency at different potency levels

[0114]

[0115] Linearity: The regression equation of 5 potency levels was y = 1.054 * x + 0.010 16, R 2 = 0.9839. It met the requirement that the slope of the linear regression equation should be between 0.80 and 1.25, and the correlation coefficient should not be less than 0.98.

[0116] Intermediate precision: The geometric standard deviation (GSD) and geometric coefficient of variation (GCV%) of 8 relative potencies measured at each potency level were calculated. The GCV% of each potency level was used to evaluate the intermediate precision, and the results are shown in Table 3. The GCV% ranged from 2.7% to 7.1%. It met the requirement that the GCV% of the relative potency determination value of each potency level should not be greater than 20%, and the intermediate precision was good.

[0117] Table 3 GSD, GCV and upper confidence limit of relative potency at different potency levels

[0118]

[0119] Range: The relative accuracy, linearity and intermediate precision verification results of 5 potency levels showed that within the range of 64% to 156%, the method detection results met the requirements of general rule 9401, and the relative potency range of the method was 64% to 156%.

[0120] Cell function stability: As shown in Figure 4 A, there was no significant difference in EC 50 values and signal-to-noise ratios of different generations of cells. It showed that LHCGR(-Ex10)-CRE-luc-HEK293 cells had functional passage stability in this method, and could be used for rhLH bioactivity determination. When the cells were passed to the 49th generation, there was no significant effect on the activity determination results.

[0121] Specificity: As shown in Figure 4 B, there was no dose-dependent effect curve for detecting r-hTSH and r-hFSH, but there was a significant dose-effect curve for detecting r-hLH, indicating that the method had good specificity.

[0122] Activity determination of heat-damaged samples: When the r-hLH sample was heated at 60 ℃, the LH content decreased with the prolongation of heating time. The biological activity of the heated sample was detected, and it was found that the activity of the heated sample showed a significant downward trend ( Figure 4C), which was consistent with the trend of LH content, indicating that the decrease of monomer content led to the change of biological activity. This method can sensitively detect the change of biological activity of rhLH sample with structural change.

[0123] Comparison with reporter gene method: When using LHCGR(-Ex10)-CRE-luc-HEK293 cells, the EC 50 ratio of rhLH to rhCG in HTRF method was in the range of 3-5, with an average of 4.2 (n≥3, Figure 5 ), while in the reporter gene method, the value was in the range of 1-2, with an average of 1.37 (n≥3, Figure 6 ). This shows that the difference in biological activity of rhLH and rhCG is amplified in HTRF method, indicating that HTRF method can distinguish rhLH and rhCG.

[0124] Urinary menotropin activity assay: To supplement the activity of luteinizing hormone in urinary menotropin (human menopausal gonadotropin, HMG), the marketed urinary menotropin product usually adds hCG. The existing in vivo animal method cannot distinguish the activity of LH and hCG. To verify whether the newly established HTRF method can be used to show the activity difference of different proportions of LH and hCG in urinary menotropin, first, the activity of rhLH mixed with different proportions of rhCG sample was detected by HTRF method, as shown in Figure 7 A, the four-parameter curve moves to the left and the upper platform decreases with the increase of the proportion of rhCG, and the EC 50 value also decreases, indicating that rhCG has higher activity than rhLH in HTRF. Subsequently, rhLH and HMG national standard were used as control, respectively, to detect the in vitro activity of three urinary menotropin products. Since the LH content in urinary menotropin product is unknown, only the potency unit concentration measured by in vivo animal can be used as the starting concentration. Taking urinary menotropin sample 1 as an example, the activity measured by rhLH as control was 47 IU, while the activity measured by HMG national standard as control was 238 IU, and the biological activity results of urinary menotropin determined by the two control methods were quite different (Fig. Figure 7 B). The results of determining urinary menotropin sample 2 and highly purified human menopausal gonadotropin (HP-HMG) by rhLH as control also showed that the activity of the two urinary menotropins was much lower than that of rhLH, and also lower than that of rhCG (Fig. Figure 7 C).

[0125] In summary, in this paper, a HTRF method for detecting the in vitro bioactivity of rhLH based on LHCGR(-Ex10)-CRE-luc-HEK293 cells was established. This method is simple, time-saving, accurate, reproducible and specific. In addition, the HTRF method established in this study can distinguish the biological activity of LH and hCG by detecting the difference in the amount of cAMP induced by LH and hCG. The method is more specific and can be used as a routine method for detecting the in vitro bioactivity of rhLH and identifying. It also provides a new method for quality control and stability evaluation of rhLH products.

[0126] The above description of the embodiments is only for the purpose of understanding the method of the present application and its core idea. It should be noted that for those skilled in the art, without departing from the principles of the present application, some improvements and modifications can be made to the present application, and these improvements and modifications will also fall within the protection scope of the claims of the present application.

Claims

1. A method for preparing a cell line for determining the biological activity of luteinizing hormone, characterized in that, The method includes the following steps: 1) Transfect effector cells with an expression vector carrying the LHCGR(-Ex10) gene and screen to obtain cell lines expressing LHCGR(-Ex10), the sequence of which is shown in SEQ ID NO.1; 2) Transfect the cells expressing LHCGR(-Ex10) with the luciferase expression vector carrying the CRE gene, and screen to obtain cell lines that co-express LHCGR(-Ex10) and CRE; the sequence of the CRE gene is shown in SEQ ID NO.

2.

2. The method according to claim 1, characterized in that, The effector cells were HEK293 cells; Preferably, the expression vector includes a plasmid vector, a bacteriophage vector, or a viral vector; Preferably, the expression vector is a viral vector; Preferably, the expression vector is a lentiviral vector; Preferably, the transfection method includes physical-mediated, chemical-mediated, and biological-mediated methods; Preferably, the transfection method is biologically mediated; Preferably, the transfection method is lentiviral infection.

3. The method according to claim 1, characterized in that, The screening described in step 1) includes screening with the addition of antibiotics; Preferably, the screening in step 1) involves adding bleomycin for screening; Preferably, the screening in step 2) includes: antibiotic screening, monoclonal isolation culture, and flow cytometry analysis; Preferably, the antibiotic screening in step 2) involves adding puromycin and bleomycin for screening.

4. A cell line for determining the biological activity of luteinizing hormone, characterized in that, The cell line was named LHCGR(-Ex10)-CRE-luc-HEK293, deposited with the China Microbial Culture Collection Committee (CGMCC) under accession number CGMCC No. 46581, classified as Human HEK293 cells, and deposited on August 28, 2025.

5. A method for detecting the biological activity of luteinizing hormone using HTRF technology, characterized in that, The method includes the following steps: The luteinizing hormone was added to the cell line described in claim 4 and incubated. After incubation, a mixture of cAMP antibody, cAMP-d2 and cAMP lysis buffer was added and incubated at room temperature for 50 min to 70 min. After incubation, the fluorescence signal value was read using an ELISA reader, and the biological activity of luteinizing hormone was determined based on the measured fluorescence signal value.

6. The method according to claim 5, characterized in that, When the luteinizing hormone is incubated with the cell line of claim 4, its initial concentration is 150 nmol·mL. -1 ~250 nmol·mL -1 ; Preferably, when the luteinizing hormone is incubated with the cell line of claim 4, its initial concentration is 200 nmol·mL⁻¹. -1 ; Preferably, the luteinizing hormone is diluted by 6 to 8 times; Preferably, the luteinizing hormone is diluted 7 times.

7. The method according to claim 5, characterized in that, The cell seeding density is 24,000 cells / well to 36,000 cells / well; Preferably, the cell seeding density is 24,000 cells / well; Preferably, the incubation time is 30 min to 60 min; Preferably, the incubation time is 30 minutes.

8. A cell preparation, characterized in that, The cell preparation includes the cell line described in claim 4; Preferably, the cell preparation includes suspension-type cell preparations, solution-type cell preparations, and solid dispersion-type cell preparations.

9. An evaluation system, characterized in that, The evaluation system includes the following components: the cell line described in claim 4, the luteinizing hormone drug sample, and the reference product.

10. The application of any of the following aspects, characterized in that, The applications include: 1) The use of the cell line of claim 4 or the cell preparation of claim 8 in the preparation of products for detecting the biological activity of luteinizing hormone; 2) The application of the cell line of claim 4, the method of any one of claims 5-7, the cell preparation of claim 8, or the evaluation system of claim 9 in the quality control of luteinizing hormone drugs; 3) The application of the evaluation system described in claim 9 in evaluating the biological activity of luteinizing hormone drugs.

Images