Virus vector carrying SMN gene expression cassette and application thereof

Abstract

The invention discloses an SMN gene expression cassette, a virus vector carrying the SMN gene expression cassette and application of the virus vector in treatment of spinal muscular atrophy, and relates to the field of gene therapy. The SMN1 gene in a gene expression cassette is subjected to codon optimization, so that the expression quantity of SMN protein after SMN1 gene transduction is improved, and the clinical dosage is expected to be effectively reduced. Meanwhile, a regulatory element such as a miRNA target sequence is also introduced into the gene expression cassette, so that the immune response of an organism to an adeno-associated virus vector and a transgenic product is relieved, and the safety problem possibly caused by a gene therapy is expected to be reduced.

Description

A viral vector carrying an SMN gene expression cassette and its use Technical Field

[0001] The present application relates to the field of gene therapy, and in particular to a gene expression cassette comprising a polynucleotide encoding human SMN protein, a viral vector carrying the gene expression cassette, and use thereof in the treatment of spinal muscular atrophy. Background Art

[0002] Spinal muscular atrophy (SMA) is a severe neuromuscular disease characterized by the loss of spinal motor neurons, leading to muscle weakness and atrophy. With an incidence of approximately 1 in 6,000 to 1 in 10,000 births, SMA is the leading genetic cause of infant mortality worldwide. SMA has diverse clinical manifestations and a wide age range of onset. Based on age of onset and clinical manifestations, it is divided into five types: type 0, type 1, type 2, type 3, and type 4. The prevalence of types 1 to 3 ranges from 2.78 to 6.56 per 100,000 individuals, while the prevalence of type 4 SMA is 0.32 per 100,000 individuals. Type 1 is the most common and most severe type (also known as Werdnig-Hofffmann disease, machine-type SMA, infantile SMA), which usually develops within 6 months of birth. Subjects with this type often die of respiratory failure within 2 years of birth, ranking first among fatal genetic diseases in children under 2 years old, among which respiratory failure caused by disease involving the respiratory system is the most common cause of death; Type 2 is an intermediate type (also known as juvenile SMA, chronic SMA), which develops 6-18 months after birth; Type 3 is a mild SMA (also known as Kugelberg-Welander disease, Wohlfart-Kugelberg-Welander disease), which usually develops after 18 months of birth; Type 4 is also known as adult-onset SMA, which usually develops after the age of 35. In fact, SMA has a very broad clinical spectrum, and there is overlap between the various types.

[0003] The pathogenesis of SMA is associated with defects in the survival motor neuron (SMN) gene, which produces the SMN protein essential for motor neuron survival. The SMN gene is located at 5q13.2 and contains two highly homologous copies, SMN1 and SMN2, differing by only five bases: two located in exons 7 and 8, and three in introns 6 and 7. SMN protein is primarily encoded by the SMN1 gene. Homozygous deletions or point mutations in SMN1 exons 7 or 7 and 8 result in a loss of SMN protein expression, leading to degeneration of α-motor neurons in the anterior horn of the spinal cord, decreased neurotransmitter release, and ineffective transmission of nerve signals to skeletal muscle contraction. Ultimately, these symptoms, such as muscle atrophy, weakness, and paralysis, are typical clinical manifestations of SMA. Studies have shown that only approximately 10% to 15% of SMN2 genes express the full-length SMN protein, leading to its purported role as the compensatory gene for SMA. The number of copies of the SMN1 and SMN2 genes is variable in the human population, and the number of SMN2 copies is negatively correlated with the severity of SMA. The more SMN2 copies a patient has, the later their onset and the milder their condition.

[0004] Therefore, the most fundamental and promising treatment strategy for SMA is to increase SMN protein expression. Currently, there are two main approaches to treating SMA: one is to directly introduce a gene encoding a functioning SMN1 gene via a vector to replace the defective SMN1 gene; the other is to modify the splicing of SMN2 mRNA to promote normal SMN2 expression. Both approaches aim to increase SMN protein expression. There are also treatment strategies that do not rely on increasing SMN protein, such as stem cell therapy and neuromuscular protective drugs.

[0005] Over the past few decades, gene therapy based on adeno-associated virus (AAV) vectors has shown great potential in treating genetic diseases. Gene therapy for SMA involves introducing an exogenous SMN1 gene via a viral vector, allowing normal SMN protein expression in the body, thereby addressing the root cause of the disease. Compared to antisense oligonucleotides or small molecule drugs, which require multiple doses, gene therapy drugs offer the advantages of a single dose and long-term benefits, making them more promising. However, issues such as the efficacy and safety of these SMA gene therapies require further optimization and resolution. For example, AAV vectors carrying the SMN1 gene have low expression efficiency and are ineffective in treating SMA. Recombinant viral vectors can trigger T cell immune responses in the human body, potentially leading to liver damage and elevated transaminases. Furthermore, previous studies have shown that AAV vectors can cause toxicity in the dorsal root ganglia (DRG) of nonhuman primates (NHPs) when introduced into the central nervous system through the blood or cerebrospinal fluid. The most severe manifestation of toxicity is ataxia. Conventional immunosuppressive regimens fail to protect against this toxicity, possibly because it may be caused by high transduction rates, which in turn induce cellular stress due to excessive transgene product in target cells.

[0006] Given the low one-year survival rate for type 1 SMA patients both domestically and internationally, patients face significant life-threatening situations. There is an urgent need to develop long-lasting, effective, safe, and affordable SMA treatments to save the lives of SMA patients and improve their quality of life. Therefore, there is an urgent need to develop a safer and more effective gene therapy for the treatment of SMA.

[0007] It should be noted that the approaches described in this section are not necessarily approaches that have been previously conceived or employed. Unless otherwise indicated, it should not be assumed that any approach described in this section is prior art simply because it is included in this section. Similarly, unless otherwise indicated, the issues mentioned in this section should not be considered to have been recognized in any prior art.

[0008] Summary of the Invention

[0009] Based on this, the present application provides a gene expression cassette, characterized in that the gene expression cassette includes a polynucleotide encoding a human SMN protein, wherein the polynucleotide encoding the human SMN protein comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity to the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3. The gene expression cassette in the present application increases the expression level of the SMN protein after SMN1 gene transduction by codon optimization, thereby reducing the clinical dosage.

[0010] In some embodiments, the gene expression frame also introduces a miRNA target sequence, which utilizes the characteristics of miRNA to inhibit gene expression in specific locations to reduce the body's immune response to AAV vectors and transgenic products, thereby reducing safety issues that may be caused by gene therapy. In some preferred embodiments, the human miRNA target sequence includes at least one of the miR-183 target sequence, miR-182 target sequence, miR-96 target sequence, miR23b target sequence, miR-145 target sequence, miR-148a target sequence, miR-22 target sequence, miR-122 target sequence, miR-143 target sequence, miR-21 target sequence, or miR-192 target sequence, in order to reduce the expression of SMN protein in DRG and / or liver, thereby achieving the purpose of alleviating DRG toxicity and liver toxicity caused by AAV vectors.

[0011] According to one embodiment of the present application, a recombinant vector is also provided, characterized in that the recombinant vector comprises the gene expression cassette described herein. In some embodiments, the SMN1 gene expression cassette described herein is carried by an AAV vector, and the effects of different AAV vector serotypes, different gene therapy drug dosages, and different administration routes on therapeutic efficacy are compared, providing more options for addressing issues such as the safety and effectiveness of gene therapy.

[0012] According to one embodiment of the present application, a pharmaceutical composition is further provided, characterized in that the pharmaceutical composition comprises the gene expression cassette described in the present application and the recombinant vector described in the present application.

[0013] According to one embodiment of the present application, an aqueous pharmaceutical preparation is also provided, characterized in that the aqueous pharmaceutical preparation comprises the gene expression cassette described in the present application and the recombinant vector described in the present application.

[0014] According to one embodiment of the present application, provided is the use of the gene expression cassette described herein, the recombinant vector described herein, the pharmaceutical composition described herein, or the aqueous pharmaceutical preparation described herein for expressing SMN protein in cells.

[0015] According to one embodiment of the present application, there is also provided the use of the gene expression cassette described in the present application, the recombinant vector described in the present application, the pharmaceutical composition described in the present application, or the aqueous pharmaceutical preparation described in the present application in the preparation of a drug for preventing, alleviating or treating a disease.

[0016] According to one embodiment of the present application, a method for preventing, alleviating or treating a disease is also provided, comprising administering the gene expression cassette described herein, the recombinant vector described herein, the pharmaceutical composition described herein, or the aqueous pharmaceutical preparation described herein to a subject in need thereof.

[0017] It should be understood that the content described in this section is not intended to identify the key or important features of the embodiments of the present application, nor is it intended to limit the scope of the present application. Other features of the present application will become easily understood through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The accompanying drawings illustrate exemplary embodiments and constitute a part of the specification. Together with the description of the specification, they serve to explain exemplary implementation of the embodiments. The illustrated embodiments are for illustrative purposes only and do not limit the scope of the claims. Throughout the drawings, the same reference numerals designate similar, but not necessarily identical, elements.

[0019] FIG1 is a schematic diagram of the scAAV-CMV / CBA-SMN1 vector structure prepared in Example 1.

[0020] Figure 2 is a schematic diagram of the scAAV-CMV / CBA-coSMN1-1 vector structure prepared in Example 1.

[0021] Figure 3 is a schematic diagram of the scAAV-CMV / CBA-coSMN1-2 vector structure prepared in Example 1.

[0022] Figure 4 is a schematic diagram of the scAAV-CMV / CBA-coSMN1-2-TmiR vector structure prepared in Example 1.

[0023] Figure 5 is a schematic diagram of the scAAV-CMV / CBA-coSMN1-3 vector structure prepared in Example 1.

[0024] Figure 6 is a schematic diagram of the scAAV-CMV / CBA-coSMN1-3-TmiR vector structure prepared in Example 1.

[0025] Figure 7 is a Western blot result showing the expression of SMN protein in Example 2. Lane 0 is a blank control group without transfection of any vector; lanes 1, 2, 3, 4, 5, and 6 are experimental groups transfected with scAAV-CMV / CBA-SMN1, scAAV-CMV / CBA-coSMN1-1, scAAV-CMV / CBA-coSMN1-2, scAAV-CMV / CBA-coSMN1-2-TmiR, scAAV-CMV / CBA-coSMN1-3, and scAAV-CMV / CBA-coSMN1-3-TmiR plasmids, respectively.

[0026] Figure 8 is a Western blot result showing the expression of SMN protein in Example 2. Lane 0 is a blank control group without any transfection vector; lanes 1, 2, 3, 4, 5, and 8 are transfected with scAAV-CMV / CBA-SMN1, scAAV-CMV / CBA-coSMN1-1, scAAV-CMV / CBA-coSMN1-2, scAAV-CMV / CBA-coSMN1-3, scAAV-CMV / CBA-coSMN1-2-TmiR, or scAAV-CMV / CBA-coSMN1-3-TmiR, respectively. Lanes 6 and 9 are the experimental groups transfected with scAAV-CMV / CBA-coSMN1-2-TmiR or scAAV-CMV / CBA-coSMN1-3-TmiR plasmids, and miR-183 was also transferred into them at the same time; lanes 7 and 10 are the experimental groups transfected with scAAV-CMV / CBA-coSMN1-2-TmiR or scAAV-CMV / CBA-coSMN1-3-TmiR plasmids, and miR-122 was also transferred into them at the same time.

[0027] Figure 9 is a Western blot result chart characterizing SMN protein expression in Example 2. Lane 0 is a blank control group without transfection of any vector; lanes 1, 2, and 3 are experimental groups transfected with scAAV-CMV / CBA-SMN1, scAAV-CMV / CBA-coSMN1-3-TmiR, or scAAV-CMV / CBA-coSMN1-3 plasmids, respectively; lanes 4 and 6 are experimental groups transfected with scAAV-CMV / CBA-coSMN1-3-TmiR or scAAV-CMV / CBA-coSMN1-3 plasmids, respectively, and miR-183 is also transfected therewith; lanes 5 and 7 are experimental groups transfected with scAAV-CMV / CBA-coSMN1-3-TmiR or scAAV-CMV / CBA-coSMN1-3 plasmids, respectively, and miR-122 is also transfected therewith.

[0028] Figure 10 is a Western blot result chart characterizing SMN protein expression in Example 3. Lane 0 is a blank control group not infected with any vector; lanes 1, 2, 3, and 4 are infected with viruses of different serotypes, scAAV1-CMV / CBA-coSMN1-3-TmiR, scAAV8-CMV / CBA-coSMN1-3-TmiR, scAAV9-CMV / CBA-coSMN1-3-TmiR, and scAAV9-CMV / CBA-coSMN1-3-TmiR, respectively, and the experiments were performed at a multiplicity of infection of 150K, 150K, 150K, and 300K, respectively; lanes 5, 6, 7, 8, and 9 are infected with the virus scAAV9-CMV / CBA-SMN1 at a multiplicity of infection of 300K, 150K, 75K, 37.5K, and 18.75K, respectively.

[0029] Figure 11 is a Western blot result showing the expression of SMN protein in Example 3. Lane 0 is a blank control group without any vector transfection; lanes 1, 2, 3, and 4 are infected with different serotypes of viruses, scAAV1-CMV / CBA-coSMN1-3-TmiR, scAAV8-CMV / CBA-coSMN1-3-TmiR, scAAV9-CMV / CBA-coSMN1-3-TmiR, and scAAV9-CMV / CBA-SMN1, respectively. The experiments were conducted at multiplicities of infection (MOIs) of 60K, 150K, 150K, and 150K, respectively.

[0030] FIG12 is a line graph showing the life span and survival rate of mice injected with recombinant viruses of different serotypes in Example 4.

[0031] FIG13 is a graph showing the body weight-survival time of mice injected with recombinant viruses of different serotypes in Example 4.

[0032] FIG14 is a graph showing the height-survival time of mice injected with recombinant viruses of different serotypes in Example 4.

[0033] FIG15 is a graph showing the tail length-survival time of mice injected with recombinant viruses of different serotypes in Example 4.

[0034] FIG16 is a statistical graph showing the results of the righting reflex test of mice injected with recombinant viruses of different serotypes in Example 4.

[0035] FIG17 is a statistical graph showing neurological function scores of mice injected with recombinant viruses of different serotypes in Example 4.

[0036] FIG18 is a statistical graph showing the results of the rotarod test on mice injected with recombinant viruses of different serotypes in Example 4.

[0037] FIG19 is a statistical graph showing the gripping strength test results of mice injected with recombinant viruses of different serotypes in Example 4.

[0038] FIG20 is a line graph showing the life span and survival rate of mice injected with different doses of the recombinant virus in Example 4.

[0039] Figure 21 is a graph showing the body weight-survival time of mice injected with different doses of recombinant virus in Example 4.

[0040] FIG22 is a graph showing the height-survival time of mice injected with different doses of the recombinant virus in Example 4.

[0041] FIG23 is a graph showing the tail length-survival time of mice injected with different doses of the recombinant virus in Example 4.

[0042] FIG24 is a statistical graph showing the results of the righting reflex test in mice injected with different doses of the recombinant virus in Example 4.

[0043] FIG25 is a statistical graph showing neurological function scores of mice injected with different doses of recombinant virus in Example 4.

[0044] FIG26 is a statistical graph showing the results of the rotarod test on mice injected with different doses of the recombinant virus in Example 4.

[0045] FIG27 is a statistical graph showing the gripping strength test results of mice injected with different doses of recombinant virus in Example 4.

[0046] FIG28 is a statistical graph showing the Western blot results of SMN protein expression in the brain, spinal cord, liver, and quadriceps muscle tissues of mice in Example 4.

[0047] FIG29 is a statistical graph showing the relative expression levels of SMN DNA content in the brain, spinal cord, DRG, and liver tissues of rhesus monkeys in Example 5.

[0048] Figure 30 is a statistical graph of the relative expression levels of SMN mRNA content in the brain, spinal cord, DRG, and liver tissues of rhesus monkeys in Example 5.

[0049] Figure 31 shows the expression results of target proteins after Neuro-2a (N2a) cells were transfected with different plasmid vectors in Example 2.4. Among them, different labels in the figure represent the use of different plasmid vectors for transfection: blank represents the untransfected blank group, PC represents the control vector without miR-183 and miR-122 target sequences, 14 represents the vector containing miR-183 and miR-122 target sequences, Let-7a-1 represents the vector containing the let-7a-1 target sequence, 802 represents the vector containing the miR-802 target sequence, 99a-5p represents the vector containing the miR-99a-5p target sequence, 100-5p represents the vector containing the miR-100-5p target sequence, and 1200 represents the vector containing the miR-1200 target sequence. DETAILED DESCRIPTION

[0050] Unless otherwise indicated, all numbers used in this specification and claims to represent content, concentration, ratio, weight, particle size, percentage, technical effect, etc. should be understood as being modified by the term "about" or "approximately" under any circumstances. Therefore, unless otherwise indicated, the numerical parameters listed in the following specification and the appended claims are approximate values. Unless otherwise indicated, the terms used herein have the usual understanding meanings for those skilled in the art. For those skilled in the art, it can vary according to the desired properties and effects sought to be obtained through this application, and each numerical parameter should be interpreted according to the number of significant digits and conventional rounding methods or in a manner understood by those skilled in the art.

[0051] Although the numerical ranges and parameters setting forth the broad scope of this application are approximations, the numerical values ​​set forth in the specific examples are provided as precisely as possible. However, any numerical value inherently contains certain errors necessarily resulting from the standard deviation found in its respective testing measurements. Every numerical range given herein will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were expressly written herein.

[0052] Unless otherwise specified or contradicted by the context, the terms or expressions used in this article should be read in conjunction with the entire content of this article and as understood by one of ordinary skill in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0053] As used herein, the expression "A and / or B" includes three cases: (1) A; (2) B; and (3) A and B. The expression "A, B, and / or C" includes seven cases: (1) A; (2) B; (3) C; (4) A and B; (5) A and C; (6) B and C; and (7) A, B, and C. The meanings of similar expressions can be deduced analogously.

[0054] As used herein, "nucleic acid" and "polynucleotide" are used interchangeably to refer to a polymeric form of nucleotides of any length, including deoxyribonucleotides, ribonucleotides, combinations thereof, and analogs thereof.

[0055] As used herein, "polypeptide" and "peptide" are used interchangeably to refer to amino acid polymers of any length. Thus, polypeptides, oligopeptides, proteins, antibodies, and enzymes are all included within the definition of polypeptide.

[0056] It should be noted that in the context of this application, upstream refers to the 5' end of the gene or the N-terminus of the protein, and downstream refers to the 3' end of the gene or the C-terminus of the protein, and from upstream to downstream is from 5' end to 3' end or N-terminus to C-terminus.

[0057] As used herein, "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid molecule to which it has been linked. Examples of vectors include, but are not limited to, plasmids, viruses, bacteria, phages, and insertable DNA segments.

[0058] As used herein, "adeno-associated viral vectors" are derived from adeno-associated viruses. An "adeno-associated viral vector" is derived from the wild-type genome of the virus by removing all or part of the wild-type genome from the adeno-associated viral genome using molecular methods and replacing it with a heterologous (non-natural) nucleic acid (e.g., a nucleic acid encoding a therapeutic protein or polynucleotide sequence). Typically, for adeno-associated viral vectors, one or two inverted terminal repeats (ITRs) in the adeno-associated viral genome are retained in the adeno-associated viral vector. Adeno-associated viral vectors can be used as gene therapy vectors because they can introduce nucleic acid / genetic material into cells so that the nucleic acid / genetic material can remain in the cells.

[0059] When used herein, " serotype " refers to an adeno-associated virus with a capsid that is serologically different from other adeno-associated virus serotypes. Serological specificity is based on the cross-reactivity between the lack of antibodies to a kind of adeno-associated virus compared with another adeno-associated virus to determine. Such cross-reactivity differences are usually due to the difference in capsid protein sequence / antigenic determinants (for example, due to VP1, VP2 and / or VP3 sequence differences of adeno-associated virus serotypes). Under the traditional definition, serotype means that the virus of interest has been tested for neutralizing activity with serum specific for all existing and characterized serotypes, and no antibodies to neutralize the virus of interest have been found. As more naturally occurring virus isolates are discovered and / or capsid mutants are generated, there may or may not be serological differences with any one of the currently existing serotypes. Therefore, in the case where a new virus (such as an adeno-associated virus) does not have serological differences, this new virus (such as an adeno-associated virus) will be a subgroup or variant of the corresponding serotype. In many cases, serological testing for neutralizing activity has not been performed on mutant viruses with modified capsid sequences to determine whether they are of another serotype according to the traditional serotype definition. Therefore, for convenience and to avoid repetition, the term "serotype" is used broadly to refer to serologically distinct viruses (e.g., adeno-associated viruses) as well as viruses that are not serologically distinct (e.g., adeno-associated viruses) that may be within a subgroup or variant of a given serotype.

[0060] As used herein, "miRNA target sequence" and "miRNA binding site" are used interchangeably to refer to a nucleotide sequence that can bind to a specific miRNA. In some non-limiting embodiments of the present application, a miRNA target sequence is designed at the 3' end of the SMN gene, which can bind to a specific miRNA to inhibit the expression level of the SMN gene.

[0061] As used herein, "operably linked" refers to the connection of multiple nucleic acid segments in a functional relationship. A nucleic acid is "operably linked" when it forms a functional relationship with another nucleic acid sequence. For example, a promoter or other transcriptional regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence (or gene), and the promoter is connected in such a way that it can induce transcription of the gene. Operably linked means that the nucleotide sequences being linked may be contiguous or discontinuous.

[0062] As used herein, the terms "relieve," "treat," and their synonyms refer to the improvement of a disease, disorder, and / or condition. "Relieve," "treat," can be an improvement in at least one measurable physical parameter, which is not necessarily recognizable by the patient. "Relieve," "treat," can also be the inhibition of the development of a disease, disorder, and / or condition physically (e.g., stabilizing recognizable symptoms), physiologically (e.g., stabilizing physical parameters), or both. "Relieve," "treat," can also be the slowing down of the development or reversal of a disease, disorder, and / or condition.

[0063] As used herein, the term "prevent," "prevent," and its synonyms refer to delaying the onset of or reducing the risk of acquiring a particular disease, disorder, and / or condition, or symptoms associated with such disease, disorder, and / or condition.

[0064] In order to make the above-mentioned objects, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are described in detail below.

[0065] Gene expression cassette

[0066] According to one embodiment of the present application, a gene expression cassette is provided, characterized in that the gene expression cassette comprises a polynucleotide encoding a human SMN protein, wherein the polynucleotide encoding the human SMN protein comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity to the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3, such as 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or other unlisted values ​​within a range of greater than or equal to 80%. In some embodiments, the polynucleotide encoding the human SMN protein comprises the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3. In some preferred embodiments, the nucleotide sequence of the polynucleotide encoding the human SMN protein is selected from the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3.

[0067] In some embodiments, the gene expression cassette further comprises a human miRNA target sequence. In some embodiments, the human miRNA target sequence is operably linked to the 3' end of the polynucleotide encoding the human SMN protein. miRNA (microRNA) is a single-stranded non-coding RNA with a length of approximately 19 to 25 nucleotides that is widely present in humans and animals. The RNA-induced silencing complex formed by miRNA and protein factors can recognize the target sequence in mRNA, reduce the expression level of mRNA by degrading mRNA molecules, promoting deadenylation of the 3' end of mRNA molecules and inhibiting translation, and regulate gene expression at the post-transcriptional level (Kim VN. Nat Rev Mol Cell Biol. 2005; 6(5): 376-385.). By using a miRNA that is highly expressed in a certain cell, inserting the target sequence of the miRNA into the 3'UTR of an exogenous gene can effectively inhibit the expression of the exogenous gene in the cell. Therefore, the characteristics of miRNA in inhibiting gene expression can be used to reduce the body's immune response to AAV vectors and transgenic products, and reduce the safety issues that may be caused by gene therapy.

[0068] In some embodiments, the human miRNA target sequence comprises at least one of a miR-183 target sequence, a miR-182 target sequence, a miR-96 target sequence, a miR23b target sequence, a miR-145 target sequence, a miR-148a target sequence, a miR-22 target sequence, a miR-122 target sequence, a miR-143 target sequence, a miR-21 target sequence, or a miR-192 target sequence. In some preferred embodiments, the human miRNA target sequence comprises at least one of a miR-183 target sequence or a miR-122 target sequence. In some more preferred embodiments, the human miRNA target sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 21-22. In some more preferred embodiments, the miR-183 target sequence comprises the nucleotide sequence shown in SEQ ID NO: 21. In some more preferred embodiments, the miR-122 target sequence comprises the nucleotide sequence shown in SEQ ID NO: 22. In some embodiments, the human miRNA target sequence can reduce the expression efficiency of the polynucleotide encoding the human SMN protein in liver tissue. In some embodiments, the human miRNA target sequence can reduce the expression efficiency of the polynucleotide encoding the human SMN protein in dorsal root ganglion tissue. The gene expression cassettes provided herein carry one or more miRNA target sequences, which can effectively reduce DRG toxicity and liver toxicity that may be caused by AAV vectors carrying the SMN gene expression cassette.

[0069] In some embodiments, the number of the human miRNA target sequence is 1. In some embodiments, the number of the human miRNA target sequence is greater than 1. In some embodiments, the greater than 1 human miRNA target sequence is operably linked via at least one spacer sequence. In some embodiments, the spacer sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 4-6. In some preferred embodiments, the human miRNA target sequence comprises 2 miR-183 target sequences and 2 miR-122 target sequences, and the 2 miR-183 target sequences and the 2 miR-122 target sequences are sequentially linked via a spacer sequence as shown in SEQ ID NO: 4, a spacer sequence as shown in SEQ ID NO: 5, and a spacer sequence as shown in SEQ ID NO: 6. In the gene expression frame of the present application, the endogenous sequence shown in any one of SEQ ID NOs: 4-6 is selected as the spacer sequence to enhance the synergistic effect of different miRNAs.

[0070] In some embodiments, the gene expression cassette further comprises a promoter. The promoter can be any suitable promoter sequence, i.e., a nucleic acid sequence recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains transcriptional regulatory sequences that mediate protein or polypeptide expression. The promoter can be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutant, truncated, and hybrid promoters, and can be derived from genes encoding extracellular or intracellular proteins or polypeptides that are homologous or heterologous to the host cell. In some non-limiting embodiments, the host cell is a neural cell, and the promoter can be a nucleic acid sequence that is transcriptionally active in neural cells. In some embodiments, the promoter includes the CMV enhancer, CBA promoter, CAG promoter, CBh promoter, hSyn promoter, CamKII promoter, EF1α promoter, UBC promoter, or the SMN endogenous promoter.

[0071] In some embodiments, the gene expression cassette further comprises an enhancer. In some embodiments, the enhancer comprises a human cytomegalovirus (CMV) enhancer.

[0072] In some embodiments, the gene expression cassette further comprises a poly A sequence. Transcription termination sequences known in the art can be used in the present application.

[0073] Recombinant vector, pharmaceutical composition, aqueous pharmaceutical preparation

[0074] According to one embodiment of the present application, a recombinant vector is provided, characterized in that the recombinant vector comprises the gene expression cassette described in the present application. In some embodiments, the recombinant vector comprises a recombinant plasmid expression vector or a recombinant viral vector. In some embodiments, the recombinant viral vector comprises a recombinant adenoviral vector, a recombinant adeno-associated viral vector, a recombinant retroviral vector, a recombinant herpes simplex viral vector, or a recombinant vaccinia viral vector. In some embodiments, the recombinant viral vector is a recombinant adeno-associated viral vector. In some embodiments, the serotype of the recombinant adeno-associated viral vector comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh10, AAV11, AAV12, or AAV13. In some preferred embodiments, the serotype of the recombinant adeno-associated viral vector comprises AAV1, AAV8, or AAV9. In some non-limiting embodiments, the recombinant viral vector is a serotype that targets neural cells. The nucleotide sequence of the genome of the AAV serotype is known in the art. In some embodiments, the gene expression cassette is located downstream of the 5' inverted terminal repeat sequence of the adeno-associated viral vector.

[0075] Virion particles containing the gene expression cassettes described herein are typically produced in packaging cells that are capable of replicating the viral genome, expressing viral proteins, and assembling virion particles. Techniques for producing AAV vector particles in packaging cells are well known in the art. In some non-limiting embodiments, packaging cells can be produced by simply transforming suitable cells with one or more plasmids encoding the AAV genome, AAV proteins, and any desired helper virus functions, a so-called "triple transfection" approach: using three plasmids, each of which carries a set of such genes. See Grieger et al., Nature Protocols, 2006, 1(3): 1412-28.

[0076] According to one embodiment of the present application, a pharmaceutical composition is also provided, characterized in that the pharmaceutical composition includes the gene expression cassette described in the present application and the recombinant vector described in the present application. In some embodiments, the form of the pharmaceutical composition includes intracerebroventricular injection of drugs, intravenous injection of drugs or intrathecal injection of drugs. In some embodiments, the pharmaceutical composition of the present application, in addition to the gene expression cassette and / or recombinant vector provided herein, may also include a pharmaceutically, nutritionally or physiologically acceptable carrier, such as a liquid, gel or solid carrier, an aqueous vehicle, a non-aqueous vehicle, an antimicrobial agent, an isotonic agent, a buffer, an antioxidant, a suspending agent, a dispersant, a chelating agent, a diluent, an adjuvant, an excipient or a non-toxic auxiliary substance, other components known in the art or various combinations thereof.

[0077] According to one embodiment of the present application, an aqueous pharmaceutical preparation is also provided, characterized in that the aqueous pharmaceutical preparation includes the gene expression cassette described in the present application or the recombinant vector described in the present application. In some embodiments, the aqueous pharmaceutical preparation is in the form of a drug for intracerebroventricular injection, an intravenous injection, or an intrathecal injection. In some embodiments, the aqueous pharmaceutical preparation further includes one or more of poloxamer 188, sodium chloride, potassium chloride, calcium chloride, magnesium chloride, and sodium phosphate buffer. In some embodiments, the aqueous pharmaceutical preparation further includes 0.001% poloxamer 188, 150mM sodium chloride, 3mM potassium chloride, 1.4mM calcium chloride, 0.8mM magnesium chloride, and 1mM sodium phosphate buffer. In some embodiments, the pH value of the aqueous pharmaceutical preparation is 6.4 to 7.6. In some embodiments, the pH value of the aqueous pharmaceutical formulation can be 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, or a value in a range consisting of any two of the above points.

[0078] use

[0079] According to one embodiment of the present application, the use of the gene expression cassette, the recombinant vector, the pharmaceutical composition, or the aqueous pharmaceutical formulation described herein for expressing SMN protein in a cell is provided. The cell can be any cell of interest. In some embodiments, the cell is an animal cell. In some embodiments, the animal cell includes a neural cell.

[0080] According to one embodiment of the present application, further provided is the use of the gene expression cassette, the recombinant vector, the pharmaceutical composition, or the aqueous pharmaceutical formulation described herein in the preparation of a medicament for preventing, alleviating, or treating a disease. In some embodiments, the disease is an SMN-related disease. In some embodiments, the SMN-related diseases include: diseases associated with insufficient SMN protein expression, diseases associated with SMN protein deficiency, diseases associated with SMN1 gene deletion, and diseases associated with SMN1 gene mutation. In some preferred embodiments, the SMN-related disease is spinal muscular atrophy. In some embodiments, the spinal muscular atrophy includes SMA type 1, SMA type 2, SMA type 3, and SMA type 4. In some embodiments, the medicament includes a drug for intracerebroventricular injection, intravenous injection, or intrathecal injection.

[0081] Disease treatment methods

[0082] According to one embodiment of the present application, a method for preventing, alleviating, or treating a disease is also provided, comprising administering the gene expression cassette, the recombinant vector, the pharmaceutical composition, or the aqueous pharmaceutical formulation described herein to a subject in need thereof. In some embodiments, the disease is an SMN-related disease. In some embodiments, the SMN-related diseases include: diseases associated with insufficient SMN protein expression, diseases associated with SMN protein deficiency, diseases associated with SMN1 gene deletion, and diseases associated with SMN1 gene mutation. In some preferred embodiments, the SMN-related disease is spinal muscular atrophy. In some embodiments, the spinal muscular atrophy includes SMA type 1, SMA type 2, SMA type 3, and SMA type 4.

[0083] The various embodiments and preferences for the present application described above can be combined with each other (as long as they are not inherently contradictory to each other) and are applicable to the purposes of the present application. The various embodiments formed by such combination are all considered as part of the present application.

[0084] Example

[0085] The following describes exemplary embodiments of the present application in conjunction with the accompanying drawings, including various details of the embodiments of the present application to facilitate understanding. It should be understood that they are considered merely exemplary and are in no way intended to limit the scope of protection of the present application. The scope of protection of the present application is defined solely by the claims. Therefore, it should be appreciated by those skilled in the art that various changes and modifications may be made to the embodiments described herein without departing from the scope of the present application. Similarly, for the sake of clarity and conciseness, descriptions of well-known functions and structures are omitted in the following description.

[0086] Unless otherwise stated, all reagents and instruments used in the following examples are commercially available conventional products. Unless otherwise stated, experiments were performed under conventional conditions or conditions recommended by the manufacturer.

[0087] Example 1: Plasmid vector construction

[0088] 1.1 Construction of scAAV-CMV / CBA-SMN1, scAAV-CMV / CBA-coSMN1-1, scAAV-CMV / CBA-coSMN1-2-TmiR, and scAAV-CMV / CBA-coSMN1-3-TmiR plasmid vectors

[0089] The SMN1 gene mRNA sequence (GenBank: NM_000344.4) was searched through the NCBI GenBank database (https: / / www.ncbi.nlm.nih.gov / gene). The SMN protein coding region sequence was analyzed from this mRNA sequence, resulting in the SMN1 sequence (SEQ ID NO:8). Codon optimization of the SMN protein coding region sequence yielded the coSMN1-1 (SEQ ID NO:1), coSMN1-2 (SEQ ID NO:2), and coSMN1-3 sequences (SEQ ID NO:3).

[0090] The miR-183 (SEQ ID NO: 21) and miR-122 target sequences (SEQ ID NO: 22) were introduced at the 3' end of the coSMN1-2 and coSMN1-3 sequences, and the miR-183 and miR-122 target sequences were repeated once (SEQ ID NO: 7), wherein the miR-183 and miR-122 target sequences were connected in series through spacer sequences (SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6).

[0091] The scAAV-CMV / CBA-SMN1 sequence (SEQ ID NO: 9), scAAV-CMV / CBA-coSMN1-1 sequence (SEQ ID NO: 10), scAAV-CMV / CBA-coSMN1-2-TmiR sequence (SEQ ID NO: 11), and scAAV-CMV / CBA-coSMN1-3-TmiR sequence (SEQ ID NO: 12) were synthesized by Nanjing GenScript Biotechnology Co., Ltd. The resulting vector structures are as follows:

[0092] The schematic diagram of the scAAV-CMV / CBA-SMN1 plasmid vector structure is shown in Figure 1. The plasmid contains inverted terminal repeats (ITRs), with a modified 5' end and an unmodified 3' end. It has a chicken β-actin promoter (CBA promoter), a human cytomegalovirus (CMV) enhancer, an SMN1 gene sequence (SEQ ID NO: 8), and a bovine growth hormone (BGH) polyadenylation signal (polyA).

[0093] The schematic diagram of the scAAV-CMV / CBA-coSMN1-1 plasmid vector structure is shown in Figure 2. The plasmid contains an inverted terminal repeat sequence with a modified 5' end and an unmodified 3' end. It has a chicken β-actin promoter (CBA promoter), a human cytomegalovirus (CMV) enhancer, coSMN1-1 (SEQ ID NO: 1), and a bovine growth hormone (BGH) polyadenylation signal (polyA).

[0094] The schematic diagram of the scAAV-CMV / CBA-coSMN1-2-TmiR vector structure is shown in Figure 4. The plasmid contains an inverted terminal repeat sequence with a modified 5' end and an unmodified 3' end. It has a chicken β-actin promoter (CBA promoter), a human cytomegalovirus (CMV) enhancer, coSMN1-2 (SEQ ID NO: 2), miR-183 and miR-122 target sequences (SEQ ID NO: 7), and a bovine growth hormone (BGH) polyadenylation signal (polyA).

[0095] The schematic diagram of the scAAV-CMV / CBA-coSMN1-3-TmiR vector structure is shown in Figure 6. The plasmid contains an inverted terminal repeat sequence with a modified 5' end and an unmodified 3' end. It has a chicken β-actin promoter (CBA promoter), a human cytomegalovirus (CMV) enhancer, coSMN1-3 (SEQ ID NO: 3), miR-183 and miR-122 target sequences (SEQ ID NO: 7), and a bovine growth hormone (BGH) polyadenylation signal (polyA).

[0096] 1.2 Construction of scAAV-CMV / CBA-coSMN1-2 and scAAV-CMV / CBA-coSMN1-3 plasmid vectors

[0097] The following primers were synthesized by Qingke Biotechnology Co., Ltd.: p101-line-F (SEQ ID NO: 15) and p101-line-R (SEQ ID NO: 16).

[0098] The scAAV-CMV / CBA-coSMN1-2-TmiR sequence and scAAV-CMV / CBA-coSMN1-3-TmiR synthesized in Example 1.1 were used as templates, p101-line-F / R primers were added, and KOD enzyme (#KOD-201B, TOYOBO) was used to amplify the fragments by PCR. The PCR products were subjected to agarose gel electrophoresis, and the target bands were recovered. The recovered products were ligated using Seamless Assembly (#C5891-50, Clone Smarter), and the ligated products were transformed with stble3 competent cells (#CD521-02, Beijing Quanshijin Biotechnology Co., Ltd.). The transformation products were spread on plates containing kanamycin and incubated overnight at 37°C. Colonies were picked and the bacterial suspension was sent to Qingke Biotechnology for sequencing. Plasmids were extracted from colonies with correct sequences to obtain the scAAV-CMV / CBA-coSMN1-2 plasmid vector (SEQ ID NO: 13) and the scAAV-CMV / CBA-coSMN1-3 plasmid vector (SEQ ID NO: 14). The resulting vector structures are as follows:

[0099] The schematic diagram of the structure of the scAAV-CMV / CBA-coSMN1-2 plasmid vector is shown in Figure 3. The plasmid contains an inverted terminal repeat sequence with a modified 5' end and an unmodified 3' end, and has a chicken β-actin promoter (CBA promoter), a human cytomegalovirus (CMV) enhancer, coSMN1-2 (SEQ ID NO: 2), and a bovine growth hormone (BGH) polyadenylation signal (polyA).

[0100] The schematic diagram of the structure of the scAAV-CMV / CBA-coSMN1-3 plasmid vector is shown in Figure 5. The plasmid contains an inverted terminal repeat sequence with a modified 5' end and an unmodified 3' end, and has a chicken β-actin promoter (CBA promoter), a human cytomegalovirus (CMV) enhancer, coSMN1-3 (SEQ ID NO: 3), and a bovine growth hormone (BGH) polyadenylation signal (polyA).

[0101] Example 2: Evaluation of SMN protein expression in vitro using plasmid vectors

[0102] 2.1 Evaluation of codon optimization effects

[0103] (1) Experimental steps

[0104] The non-codon-optimized SMN1 gene plasmid vector scAAV-CMV / CBA-SMN1, and the codon-optimized SMN1 gene plasmid vectors scAAV-CMV / CBA-coSMN1-1, scAAV-CMV / CBA-coSMN1-2, scAAV-CMV / CBA-coSMN1-2-TmiR, scAAV-CMV / CBA-coSMN1-3 and scAAV-CMV / CBA-coSMN1-3-TmiR were respectively introduced into the HEK 293 (purchased from ATCC) cell line using PEIpro (#115-100, Polyplus) transfection reagent. The blank group without plasmid transfection was used as the negative control group. After incubation for 48 hours, the cells were harvested and protein samples were prepared. The expression levels of SMN protein of the above plasmid vectors at the same dose were verified by Western blot.

[0105] The specific steps for Western blotting are as follows: Prepare an SDS-PAGE gel using the YAZYME PAGE Gel Quick Preparation Kit (#PG112, Shanghai YAZYME Biopharmaceutical Technology Co., Ltd.). Remove the comb teeth, add the protein sample to the comb teeth, and perform electrophoresis. Stop electrophoresis when bromophenol blue reaches the bottom edge of the glass plate and prepare for membrane transfer. After transfer, remove the PVDF membrane (#10600023, Amersham) and rinse once with 1× TBST for 3 minutes. Place the membrane in a small box, add an appropriate amount of 5% skim milk to cover the membrane surface, and incubate on a shaker at room temperature for 1 hour. Incubate the primary antibody using 1× TBST. Remove the blocked PVDF membrane, rinse once with TBST, and place the membrane in an incubation box. Add the corresponding antibodies: SMN antibody (#60154-1-Ig, Proteintech) and β-tubulin antibody (#66240-1-1g, Proteintech) and incubate overnight at 4°C. The antibody was removed by aspiration, and the PVDF membrane was rinsed three times with 1× TBST. Secondary antibody was applied using a mouse secondary antibody (#115-035-003, Jackson Immuno) prepared in 1× TBST and incubated on a shaker at room temperature for 1 hour. The antibody was removed by aspiration, and the PVDF membrane was rinsed three times with 1× TBST. The membrane was developed with ECL (#SB-WB102, Shanghai Shenger Biotechnology Co., Ltd.) and photographed.

[0106] (2) Experimental results

[0107] The experimental results of Example 2.1 are shown in Figure 7. The results in Figure 7 show that compared with the blank control and the non-codon-optimized scAAV-CMV / CBA-SMN1, the SMN protein expression of the scAAV-CMV / CBA-coSMN1-1, scAAV-CMV / CBA-coSMN1-3 and scAAV-CMV / CBA-coSMN1-3-TmiR plasmid vectors was significantly increased, while the SMN protein expression of scAAV-CMV / CBA-coSMN1-2 and scAAV-CMV / CBA-coSMN1-2-TmiR was not significantly increased. The above results indicate that the codon-optimized coSMN1-1 and coSMN1-3 sequences significantly improved the expression efficiency of the SMN protein, but the codon-optimized coSMN1-2 sequence did not achieve an improvement in expression efficiency. In addition, in addition to coSMN1-2, the applicant also found a large number of optimized sequences that could not improve expression efficiency during the screening process, confirming that the strategy of improving expression efficiency through codon optimization will be affected by multiple factors such as protein type, protein length, secondary structure, species type, etc., and is unpredictable. Therefore, the preferred sequences in the vector provided by this application that can efficiently express SMN1 are coSMN1-1 and coSMN1-3.

[0108] 2.2 Evaluation of the effect of introducing miRNA target sequences

[0109] (1) Experimental steps

[0110] The experimental process was the same as that of Example 2.1, except that the experimental subjects were replaced by: scAAV-CMV / CBA-SMN1, scAAV-CMV / CBA-coSMN1-1, scAAV-CMV / CBA-coSMN1-2, scAAV-CMV / CBA-coSMN1-3, scAAV-CMV / CBA-coSMN1-2-TmiR, and scAAV-CMV / CBA-coSMN1-3-TmiR were respectively transferred into HEK 293 cells; scAAV-CMV / CBA-coSMN1-2-TmiR, scAAV-CMV / CBA-coSMN1-3-TmiR were respectively transferred into HEK 293 cells; 2-TmiR, scAAV-CMV / CBA-coSMN1-3-TmiR, and miR-122 were co-transfected into HEK 293 cells. A blank group without plasmid transfection was also used as a negative control group.

[0111] (2) Experimental results

[0112] The experimental results of Example 2.2 are shown in Figure 8. The results in Figure 8 show that when miRNA is present in the cell (for example, when miR-183 or miR-122 is present), and when miRNA target sequences are simultaneously introduced into the plasmid vector scAAV-CMV / CBA-coSMN1-3 (specifically, the miR-183 target sequence and the miR-122 target sequence are introduced), the expression level of SMN protein in the cell can be significantly inhibited; however, when the miRNA target sequence is not introduced into the plasmid vector, the expression level of SMN protein in the cell cannot be inhibited.

[0113] 2.3 Evaluation of the effect of introducing miRNA target sequences

[0114] (1) Experimental steps

[0115] The experimental process was the same as that of Example 2.1, except that the experimental subjects were replaced by: scAAV-CMV / CBA-SMN1, scAAV-CMV / CBA-coSMN1-3, and scAAV-CMV / CBA-coSMN1-3-TmiR were respectively transferred into Huh7 cells; scAAV-CMV / CBA-coSMN1-3, scAAV-CMV / CBA-coSMN1-3-TmiR and miR-183 were co-transfected into Huh7 cells (gift from Shanghai Institute of Materia Medica); scAAV-CMV / CBA-coSMN1-3, scAAV-CMV / CBA-coSMN1-3-TmiR and miR-122 were co-transfected into Huh7 cells. A blank group without transfection of plasmid was also used as a negative control group.

[0116] (2) Experimental results

[0117] The experimental results of Example 2.3 are shown in Figure 9. The results in Figure 9 show that when miRNA is present in the cell (for example, when miR-183 or miR-122 is present), by comparing bands 3 with 4 and 5, 4 with 6, and 5 with 7, it is shown that when the miRNA target sequence is introduced into the plasmid vector scAAV-CMV / CBA-coSMN1-3-TmiR (specifically, when the miR-183 target sequence and the miR-122 target sequence are introduced), the expression level of SMN protein in the cell can be significantly inhibited; whereas, when the miRNA target sequence is not introduced into the plasmid vector, the expression level of SMN protein in the cell cannot be inhibited.

[0118] 2.4 Comparison of the effects of different miRNA target sequences

[0119] (1) Experimental steps

[0120] A control scAAV vector containing a control miRNA target sequence was constructed using the same method as in Example 1. The construction method is briefly described as follows:

[0121] Amplification primers for control miRNAs (hsa-let-7a-1, hsa-miR-99a-5p, hsa-miR-100-5p, hsa-miR-802, and hsa-miR-1200) were synthesized as long primers. The primer sequences are shown in Table 1. Circular PCR was performed on the vector scAAV-MeP426-Mecp2-pA1-pA2 (SEQ ID NO: 38) to introduce the miRNA target sequence. The amplified fragments were circularized by seamless cloning, and the ligated products were transformed into recombinase-deficient Escherichia coli stabl3 cells (#CD521-01, Beijing Quanshijin Biotechnology Co., Ltd.) for amplification to obtain various control scAAV vectors containing the control miRNA target sequences.

[0122] Table 1 PCR primer sequences for control miRNA

[0123] After the construction was completed, the control scAAV vector containing the control miRNA target sequence was transfected into N2a cells according to the method in Example 2.1, and the expression level of the target protein was then detected by Western blot. The results are shown in Figure 31. The different labels in the figure represent the use of different vectors for transfection:

[0124] Blank represents the untransfected blank group.

[0125] PC represents a control vector (scAAV-MeP426-Mecp2-pA1-pA2, the sequence of the exogenous nucleic acid fragment between its ITR sequences is shown in SEQ ID NO: 38) that does not contain miR-183 and miR-122 target sequences.

[0126] 14 represents a vector containing miR-183 and miR-122 target sequences (scAAV-MeP426-Mecp2-pA1-pA2-183-483-122-130, the sequence of the exogenous nucleic acid fragment between its ITR sequences is shown in SEQ ID NO: 39),

[0127] Let-7a-1 represents a vector containing the let-7a-1 target sequence (scAAV-MeP426-Mecp2-pA1-pA2-let-7a-1, the sequence of the exogenous nucleic acid fragment between its ITR sequences is shown in SEQ ID NO: 33),

[0128] 802 represents a vector containing the miR-802 target sequence (scAAV-MeP426-Mecp2-pA1-pA2-802, the sequence of the exogenous nucleic acid fragment between its ITR sequences is shown in SEQ ID NO: 36),

[0129] 99a-5p represents a vector containing the miR-99a-5p target sequence (scAAV-MeP426-Mecp2-pA1-pA2-99a-5p, the sequence of the exogenous nucleic acid fragment between its ITR sequences is shown in SEQ ID NO: 34),

[0130] 100-5p represents a vector containing the miR-100-5p target sequence (scAAV-MeP426-Mecp2-pA1-pA2-100-5p, the sequence of the exogenous nucleic acid fragment between its ITR sequences is shown in SEQ ID NO: 35),

[0131] 1200 represents a vector containing the miR-1200 target sequence (scAAV-MeP426-Mecp2-pA1-pA2-1200, the sequence of the exogenous nucleic acid fragment between its ITR sequences is shown in SEQ ID NO: 37).

[0132] (2) Experimental results

[0133] The results in Figure 31 show that different miRNA target sequence combinations have different effects on reducing the expression of the target gene.

[0134] Example 3: Preparation of AAV recombinant virus and in vitro validation

[0135] 3.1 Preparation of AAV recombinant virus

[0136] Recombinant AAV virus was packaged using a three-plasmid packaging system and purified using affinity chromatography and anion exchange / multimodal chromatography. AAV vector plasmids (scAAV-CMV / CBA-SMN1, scAAV-CMV / CBA-coSMN1-3-TmiR), AAV Rep and Cap protein expression plasmids (pAAV-R2C1, pAAV-R2C8, or pAAV-R2C9), and a helper plasmid (pHelper) were mixed in appropriate proportions and transfected into HEK293 cells using PEI Pro. Cells and culture supernatant were harvested 48 hours after transfection. First, add MaxNuclease universal nuclease (#NUC-SE101, Kaixia Biotechnology Co., Ltd.) to a final concentration of 100U / mL, then add 1 / 10 volume of culture medium HEPES (1% Tween 20, 2mM MgCl2) lysis solution to a final concentration of 50mM, pipet until the cells are completely suspended and then transfer to a shake flask. Continue shaking at 37°C for 2 hours to allow the nucleic acid to be fully degraded. Then add 1 / 10 volume of 5M NaCl, 10% sucrose solution, mix well, and obtain the lysed virus sample. Use a 0.45μm pore size Sartopure PP3 deep filter (#5051306P4, Sartorius) to filter the lysed virus sample. Use TFF to concentrate and replace the filtered virus sample. Use POROS TM CaptureSelect TM AAVX Affinity Resin (#A36740, Thermo Fisher) was used to capture viruses from viral samples after medium exchange. After affinity purification, empty AAV capsids were removed using Prima T (#311.5121-2, Sartorius), resulting in the generation of recombinant viruses scAAV9-CMV / CBA-SMN1, scAAV1-CMV / CBA-coSMN1-3-TmiR, scAAV8-CMV / CBA-coSMN1-3-TmiR, and scAAV9-CMV / CBA-coSMN1-3-TmiR.

[0137] 3.2 Genome copy number detection

[0138] The ddPCR method was used to determine the genome titer of the purified AAV virus. ddPCR primers and probes were designed for SMN1 and coSMN1-3:

[0139] SMN1-F: 5'-AGAGGAGCAAAATCTGTCCGA-3'

[0140] SMN1-probe:5'-FAM-CCAGGAGACCTGGAGTTCTCAC-MGB-3'

[0141] SMN1-R: 5'-GGGTGGTGGAGGGAGAAAAG-3'

[0142] coSMN1-3-F: 5'-TACACAGGCTACGGCAACAG-3'

[0143] coSMN1-3-probe:5'-FAM-ACCTCGCAAATTGGGCTCAGCA-MGB-3'

[0144] coSMN1-3-R: 5'-CTCGTTCTCTTGGGCGTTCT-3'

[0145] Primers and probes were synthesized by Genewise Biotechnology Co., Ltd.

[0146] Prepare a mixture of DNA samples, primers, probes, and ddPCR premix in proportion, add them to a 96-well plate, mix well, and centrifuge briefly. Vortex to mix well, and centrifuge at 2000 rpm for 1-2 minutes. Turn on the automatic droplet generator, place the 96-well plate in it, prepare the pipette tip, and start the run after confirmation to generate droplets. After the droplet generation is completed, take out the newly generated 96-well plate containing oil and samples and perform droplet PCR amplification. After the PCR reaction is completed, take out the 96-well plate, place it in the droplet reader, and set the relevant parameters: ddPCR supermix (no dUTP), FAM, etc. After the settings are completed, run the droplet reading program. The reading unit is copies / μL. Calculate the sample copy number copies / mL based on the dilution factor.

[0147] 3.3 Verification of the effectiveness of AAV recombinant virus in vitro

[0148] (1) Experimental steps

[0149] HEK293 cells and N2a cells were infected with scAAV9-CMV / CBA-SMN1, scAAV1-CMV / CBA-coSMN1-3-TmiR, scAAV8-CMV / CBA-coSMN1-3-TmiR and scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant viruses.

[0150] After HEK293 cells were plated on a 24-well plate, the extra cells from two wells were taken for cell counting on the next day to calculate the average number of cells in each well. Based on the cell number, the scAAV9-CMV / CBA-SMN1 virus was diluted with complete culture at a multiplicity of infection (MOI) of 300K, 150K, 75K, 37.5K, and 18.75K; the scAAV1-CMV / CBA-coSMN1-3-TmiR and scAAV8-CMV / CBA-coSMN1-3-TmiR viruses were diluted at an MOI of 150K; the scAAV9-CMV / CBA-coSMN1-3-TmiR virus was diluted at an MOI of 300K and 150K, respectively; the cell culture medium in the well plate was aspirated, and the virus dilutions were added to each well. A blank group without virus was used as a negative control group. After 72 hours, cells were collected and protein samples were prepared. The expression of SMN protein after virus infection of cells was verified by Western blot as described in Example 2.

[0151] After N2a cells were plated on a 24-well plate, the extra cells from two wells were taken the next day for cell counting. The average number of cells in each well was calculated. Based on the cell number, the scAAV9-CMV / CBA-SMN1, scAAV8-CMV / CBA-coSMN1-3-TmiR, and scAAV9-CMV / CBA-coSMN1-3-TmiR viruses were diluted with complete culture medium at an infection multiplicity (MOI) of 150K. The scAAV1-CMV / CBA-coSMN1-3-TmiR virus was diluted at an MOI of 60K. The cell culture medium in the well plate was aspirated and the virus dilutions were added to each well. The blank group without plasmid transfection was used as a negative control group. After 72 hours, the cells were collected and protein samples were prepared. The expression of SMN protein after virus infection of the cells was verified by Western blot as described in Example 2.

[0152] (2) Experimental results

[0153] The results of HEK293 cell infection are shown in Figure 10. Compared with the blank control and the non-codon-optimized scAAV9-CMV / CBA-SMN1 recombinant virus with an infection multiplicity of 300K, the scAAV1-CMV / CBA-coSMN1-3-TmiR and scAAV8-CMV / CBA-coSMN1-3-TmiR recombinant viruses significantly increased the expression of SMN protein at an MOI of 150K. Compared with the negative control, the scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant virus significantly increased the expression of SMN protein at an MOI of 300K. Among them, at the same MOI, the scAAV1-CMV / CBA-coSMN1-3-TmiR recombinant virus had the highest SMN protein expression.

[0154] The results of N2a cell infection are shown in Figure 11. Compared with the blank control and the scAAV9-CMV / CBA-SMN1 recombinant virus with the same infection multiplicity but without codon optimization, the expression of SMN protein was significantly increased after scAAV1-CMV / CBA-coSMN1-3-TmiR, scAAV8-CMV / CBA-coSMN1-3-TmiR and scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant viruses infected N2a cells.

[0155] In summary, the scAAV1-CMV / CBA-coSMN1-3-TmiR, scAAV8-CMV / CBA-coSMN1-3-TmiR and scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant virus infection of the present application can significantly increase the expression level of SMN protein in cells in vitro.

[0156] Example 4: In vivo efficacy evaluation experiment of recombinant AAV

[0157] FVB.cg-SMN2 + / + ;SMNΔ7 + / + ;Smn + / - (abbreviated as Smn + / - ) mice were purchased from Jackson Laboratory, USA (#005025) and bred to obtain FVB.cg-SMN2 + / + ;SMNΔ7 + / + ;Smn - / - (abbreviated as Smn - / -) mice were used as an animal model for evaluating the in vivo efficacy and safety of the recombinant virus. SMN genotyping was performed according to the Jackson Laboratory's protocol. PCR amplification was performed using primers oIMR3439: TTTTCTCCCTCTTCAGAGTGAT (SEQ ID NO: 17); oIMR3440: CTGTTTCAAGGGAGTTGTGGC (SEQ ID NO: 18); oIMR7208: CTCCGGGATATTGGGATTG (SEQ ID NO: 19); and oIMR7210: GGTAACGCCAGGGTTTTCC (SEQ ID NO: 20). The amplified product was subjected to agarose gel electrophoresis, and the mouse genotype was determined by band size: the wild-type band was 420 bp; the homozygous band was 500 bp; and the heterozygous bands were both 500 bp and 420 bp.

[0158] 4.1 Evaluation of the effectiveness of different serotypes of AAV recombinant viruses in SMA model mice

[0159] (1) Experimental steps

[0160] scAAV9-CMV / CBA-SMN1 was used as a positive control, and 0-1 day old SMN1 were intravenously injected at a dose of 5E+11 vg / mouse (virus genome, vg). - / - Mice were injected with 9 mice (1.5 g per mouse). The vehicle group was used as the negative control (untreated group). The experimental groups were treated with recombinant AAV viruses scAAV1-CMV / CBA-coSMN1-3-TmiR, scAAV8-CMV / CBA-coSMN1-3-TmiR and scAAV9-CMV / CBA-coSMN1-3-TmiR. A microinjector (#10 μL, Shanghai Gaoge Industry and Trade Co., Ltd.) was used to inject 0-1 day old Smn into the bilateral ventricles at a dose of 5E+10 vg. - / - Mice were injected with 10 mice in the negative control group, 13 mice in the scAAV1-CMV / CBA-coSMN1-3-TmiR group, 10 mice in the scAAV8-CMV / CBA-coSMN1-3-TmiR group, and 11 mice in the scAAV9-CMV / CBA-coSMN1-3-TmiR group. After virus injection, the body weight, body and tail length of the mice were recorded daily (only the information of surviving mice was recorded), and the survival rate and life span of the mice were observed.

[0161] In order to observe the improvement effects of different serotypes of recombinant AAV on the motor function, muscle weakness and muscle atrophy of SMA model animals, righting reflex tests were performed every day on the 3rd, 5th and 7th to 21st days after injection, and the time required for the SMA model mice to right themselves from an abnormal position to a normal position was recorded; neurological score assessment (see Hatzipetros, et al. J. Vis. Exp. (104), e53257, doi: 10.3791 / 53257 (2015) for the scoring method) was performed on the SMA model mice from the 21st to the 63rd day. Based on the scoring results, behavioral experiments were performed on the SMA model mice starting from the 29th day and tested once a week. Behavioral experiments included the Rotarod test, which assessed the motor coordination and balance of rodents using a rotarod apparatus (#LE8205, Harvard Apparatus) and recorded the time required for the animals to fall off the rotarod. The Grip Strength Measurement test was performed using a Grip Strength Tester (#BIO-GS3, BIOSEB) to quantify the muscle grip strength of the animals.

[0162] (2) Experimental results

[0163] The survival rate and life cycle results are shown in Figure 12. Compared with the negative control vehicle group and the positive control group scAAV9-CMV / CBA-SMN1, injection of scAAV1-CMV / CBA-coSMN1-3-TmiR, scAAV8-CMV / CBA-coSMN1-3-TmiR, and scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant viruses significantly prolonged the life cycle of SMA model mice and improved the survival rate of mice. Among them, the survival rate of SMA model mice injected with scAAV8-CMV / CBA-coSMN1-3-TmiR and scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant viruses was more significantly improved.

[0164] According to the results in Figures 13-15, compared with the negative control group and the positive control group, the weight and body shape of SMA model mice injected with scAAV1-CMV / CBA-coSMN1-3-TmiR, scAAV8-CMV / CBA-coSMN1-3-TmiR and scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant viruses recovered to a certain extent, approaching the level of wild-type mice.

[0165] In summary, the three serotypes of recombinant AAV viruses carrying codon-optimized SMN genes and introducing miR-183 and miR-122 target sequences into the SMN gene expression frame were able to effectively restore the growth and development of SMA model mice, increase their body weight, prolong the life span of SMA model mice, and improve their survival rate. Among them, the survival rate of SMA model mice injected with scAAV8-CMV / CBA-coSMN1-3-TmiR and scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant viruses was more significantly improved.

[0166] As shown in Figure 16, the results of the righting reflex test show that with the extension of the survival period, the time required for SMA model mice in the scAAV1-CMV / CBA-coSMN1-3-TmiR, scAAV8-CMV / CBA-coSMN1-3-TmiR and scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant virus injection groups to right themselves from an abnormal position to a normal position gradually shortened and returned to a level comparable to that of wild-type mice. This result shows that the recombinant viruses of different serotypes of the present application can restore the motor behavior ability of SMA model mice.

[0167] As shown in the neurological function score results in Figure 17, 49 days ago, compared with the positive control group scAAV9-CMV / CBA-SMN1, the neurological function scores of SMA model mice in the recombinant virus injection groups scAAV1-CMV / CBA-coSMN1-3-TmiR, scAAV8-CMV / CBA-coSMN1-3-TmiR and scAAV9-CMV / CBA-coSMN1-3-TmiR were all lower, indicating that the recombinant viral vector provided in the present application can better restore the neurological function of SMA model mice. After 49 days, almost all mice injected with the scAAV9-CMV / CBA-SMN1 recombinant virus in the positive control group had died. Among the three serotype recombinant virus injection experimental groups, the scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant virus injection group had the lowest score, followed by the scAAV8-CMV / CBA-coSMN1-3-TmiR recombinant virus injection group, and the scAAV1-CMV / CBA-coSMN1-3-TmiR recombinant virus injection group had a relatively high score. These experimental results indicate that the scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant virus has minimal impact on abnormal hind limb function in mice.

[0168] As shown in Figure 18 , the results of the rotarod experiment showed that compared with the positive control group scAAV9-CMV / CBA-SMN1, the duration of mice on the rotarod in the recombinant virus injection groups scAAV1-CMV / CBA-coSMN1-3-TmiR, scAAV8-CMV / CBA-coSMN1-3-TmiR and scAAV9-CMV / CBA-coSMN1-3-TmiR was significantly increased. Compared with the time required for wild-type mice to fall off the rotating rod, the scAAV1-CMV / CBA-coSMN1-3-TmiR recombinant virus injection group had a significantly longer duration on the rotating rod than wild-type mice in the first two tests, and in the weekly tests during the subsequent survival period, the time required for mice to fall off the rotating rod was comparable to that of wild-type mice, with no significant difference; the scAAV8-CMV / CBA-coSMN1-3-TmiR recombinant virus injection group had a significantly longer duration on the rotating rod than wild-type mice in the first two tests, but in the weekly tests during the subsequent survival period, the time required for mice to fall off the rotating rod was significantly longer than that of wild-type mice, and the delay time continued to increase; the scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant virus injection group had a significantly longer time on the rotating rod than wild-type mice, and the difference became greater as the survival period prolonged. The above results show that the three serotypes of recombinant AAVs in this application carrying codon-optimized SMN genes and introducing miR-183 and miR-122 target sequences into the SMN gene expression frame can effectively restore the motor coordination ability of SMA model mice; and the effects of scAAV8-CMV / CBA-coSMN1-3-TmiR and scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant viruses are better than those of untreated wild-type mice.

[0169] As shown in the gripping strength test results in Figure 19, with the extension of the survival period, the gripping strength of the SMA model mice in the scAAV1-CMV / CBA-coSMN1-3-TmiR, scAAV8-CMV / CBA-coSMN1-3-TmiR and scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant virus injection groups continued to increase. After about 50 days of administration, the gripping strength had returned to a level similar to that of wild-type mice, and there was no significant difference between the three serotypes. The above results show that the three serotypes of the present application, which carry codon-optimized SMN genes and introduce miR-183 and miR-122 target sequences into the SMN gene expression frame, can effectively reverse the muscle weakness of SMA model mice.

[0170] In summary, the three serotype codon-optimized SMN genes of the present application and the AAV recombinant viruses that introduced the miR-183 and miR-122 target sequences into the SMN gene expression frame were injected into the central nervous system through the lateral ventricle, which restored the growth and development of SMA model mice, increased their weight, body length and tail length, prolonged the life cycle of SMA model animals, and improved the survival rate. At the same time, it also restored their motor coordination ability and reversed their muscle weakness and muscle atrophy. Among them, scAAV9-CMV / CBA-coSMN1-3-TmiR had the best effect.

[0171] 4.2 Evaluation of the effectiveness of different doses of recombinant AAV in SMA model mice

[0172] (1) Experimental steps

[0173] Three different dosages (high, medium, and low) of the scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant virus were designed, namely 5E+10 vg / mouse, 2.5E+10 vg / mouse, and 1E+10 vg / mouse. The recombinant virus was injected into the 0-1 day old Smn1-3 mice by a single intracerebroventricular injection. - / - Mice, 6 to 8 Smn per group - / - Mice. After the injection, the weight, body and tail length of the mice were recorded every day (only the information of surviving mice was recorded), and the survival period of the mice was observed. In order to observe the improvement effect of the recombinant vector on the motor coordination ability, muscle weakness and muscle atrophy of SMA model animals, the righting reflex test was performed every day on the 3rd day, 5th day, and 7th to 21st day after virus injection, and the time required for the SMA model mice to right themselves from an abnormal position to a normal position was recorded; neurological score assessment was performed on the SMA model mice from the 21st to the 63rd day, and behavioral experiments were performed on the SMA model mice starting from the 29th day based on the score, and the test was conducted once a week. Behavioral experiments include the Rotarod test: a rotarod instrument is used to assess the motor coordination and balance ability of rodents, and the time required for the animals to fall off the rotarod is recorded; the grip strength measurement: a grip strength tester is used to quantify the muscle grip strength of the animals.

[0174] (2) Experimental results

[0175] As shown in Figure 20, the survival rate and life span results show that compared to SMA model mice not injected with the recombinant virus, all three doses of the scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant virus prolonged the survival of SMA model mice. However, the extent of the survival extension varied among the different doses. The low dose had a weaker effect, while the medium and high doses were equally effective, effectively extending the survival of SMA model mice.

[0176] As shown in Figures 21 (body weight), 22 (body length), and 23 (tail length), after injection of three different doses of scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant virus, the weight and size of mice gradually increased over time. Among them, the weight gain of mice administered with a low dose of scAAV9-CMV / CBA-coSMN1-3-TmiR was slower. Medium and high doses of scAAV9-CMV / CBA-coSMN1-3-TmiR were more effective in restoring the growth and development of SMA model mice.

[0177] As shown in the righting reflex test results in Figure 24, the time required for SMA model mice to right themselves from an abnormal position to a normal position gradually decreased with the extension of the survival period in the three doses of scAAV9-CMV / CBA-coSMN1-3-TmiR injection group, and recovered to a level comparable to that of wild-type mice 12 days after administration. These results indicate that all three doses of the scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant virus can restore the motor behavior ability of SMA model mice.

[0178] As shown in the neurological function score results in Figure 25, the neurological function scores of SMA model mice in the three doses of scAAV9-CMV / CBA-coSMN1-3-TmiR virus injection groups were slightly higher than those of wild-type mice, which means that the hind limb status of the mice was affected to varying degrees.

[0179] As shown in Figure 26, the rotarod test results show that compared with the time required for wild-type mice to fall off the rotarod, the duration of the rotarod in the medium- and high-dose scAAV9-CMV / CBA-coSMN1-3-TmiR virus injection groups recovered to a level similar to that of wild-type mice. These results indicate that both medium- and high-dose scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant viruses can more effectively restore the motor coordination ability of SMA model mice.

[0180] As shown in Figure 27, the gripping strength test results show that the weight that SMA model mice were able to grasp increased with the extension of survival period in the medium- and high-dose scAAV9-CMV / CBA-coSMN1-3-TmiR virus injection groups, with no significant difference between the medium and high doses. These results indicate that both medium- and high-dose scAAV9-CMV / CBA-coSMN1-3-TmiR administration can effectively reverse the muscle weakness in SMA model mice.

[0181] In summary, intracerebroventricular injection of low, medium, and high doses of the scAAV9-CMV / CBA-coSMN1-3-TmiR recombinant virus into SMA model mice restored growth and development, increased body weight, body length, and tail length, prolonged the animals' lifespan, restored motor coordination, and reversed muscle weakness and atrophy. The medium and high doses were more effective.

[0182] 4.3 Effects of recombinant AAV on SMN protein expression in different tissues of SMA model mice

[0183] (1) Experimental steps

[0184] The recombinant AAV viruses scAAV9-CMV / CBA-SMN1 and scAAV9-CMV / CBA-coSMN1-3-TmiR were injected into the bilateral cerebroventricular cavity of 0-1 day old Smn1 mice at a dose of 2.5E+10vg using a microinjector. - / - Three mice were injected. Untreated mice were given vehicle as a negative control. Seven days later, brain, spinal cord, liver, and quadriceps muscle tissues were collected from wild-type mice in the vehicle, scAAV9-CMV / CBA-SMN1, and scAAV9-CMV / CBA-coSMN1-3-TmiR groups.

[0185] Take an appropriate amount of tissue sample, add Ripa lysis buffer (#P0013B, Beyotime Biotech), and grind the tissue using a grinder (#scientz-48, Ningbo Xinzhi Biotechnology Co., Ltd.). Prepare protein samples. Western blot analysis was performed on protein samples from different tissues using the procedures described in Example 2 to measure SMN protein expression levels in different tissues after virus injection.

[0186] (2) Experimental results

[0187] As shown in Figure 28, compared with the untreated group, the SMN protein expression levels in the brain, spinal cord, and quadriceps muscle tissues of the scAAV9-CMV / CBA-SMN1 and scAAV9-CMV / CBA-coSMN1-3-TmiR injection groups were significantly increased, returning to or exceeding the SMN expression levels of wild-type mice; however, in the liver, the SMN protein expression level in the scAAV9-CMV / CBA-SMN1 group was significantly higher than that in the scAAV9-CMV / CBA-coSMN1-3-TmiR and wild-type mouse groups, suggesting that the scAAV9-CMV / CBA-coSMN1-3-TmiR viral targeting reduced the SMN protein expression level in the liver, that is, adding miRNA target sequences to the viral vector can overcome the overexpression of SMN protein in the liver, thereby avoiding the liver toxicity problem that may be caused by AAV treatment.

[0188] Example 5: Evaluation of the biodistribution of recombinant AAV after a single intrathecal injection in young rhesus monkeys

[0189] (1) Experimental steps

[0190] Young rhesus macaques received a single intrathecal injection of vehicle, scAAV9-CMV / CBA-coSMN1-3 (3E+13 vg / animal), or scAAV9-CMV / CBA-coSMN1-3-TmiR (3E+13 vg / animal), with three males per group, and were observed for 13 weeks. At day 92, brain, spinal cord, DRG, and liver tissues (only two DRG samples were collected) were collected from the vehicle, scAAV9-CMV / CBA-SMN1, and scAAV9-CMV / CBA-coSMN1-3-TmiR groups.

[0191] Tissue DNA extraction: Take an appropriate amount of tissue sample and place it in a 1.5 ml EP tube. Use DNeasy Blood & Tissue Kit (#69506, Qiagen) to extract tissue DNA, and use Nanodrop instrument (#nanodrop one, Thermo Fisher) to detect DNA concentration.

[0192] Tissue RNA extraction: Take an appropriate amount of tissue sample, place it in a 1.5 ml EP tube, add Trizol (#15596018, Thermo Fisher), extract RNA, and reverse transcribe the RNA into cDNA by reverse transcription.

[0193] qPCR was used to determine the copy number of tissue DNA and cDNA samples. The qPCR primers and probes were as follows:

[0194] coSMN1-3-F: 5'-TACACAGGCTACGGCAACAG-3'

[0195] coSMN1-3-probe:5'-FAM-ACCTCGCAAATTGGGCTCAGCA-MGB-3'

[0196] coSMN1-3-R: 5'-CTCGTTCTCTTGGGCGTTCT-3'

[0197] Primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0198] Combine the standard, DNA or cDNA sample, primers, probe, ROX Reference Dye Ⅱ (#AM41818A, TaKaRa) and Premix Ex Taq TM Prepare the mixture of 50 μg of 50 μg of 5 μg of 1 ...

[0199] (2) Experimental results

[0200] As shown in Figure 29, compared to the vehicle group, the SMN DNA levels in the brain, spinal cord, DRG, and liver tissues of the scAAV9-CMV / CBA-coSMN1-3 and scAAV9-CMV / CBA-coSMN1-3-TmiR injection groups all showed an increased trend compared to wild-type rhesus macaques. This result demonstrates that intrathecal viral vector injection can deliver target genes to both the central nervous system and peripheral tissues.

[0201] As shown in Figure 30, compared with the vehicle group, the SMN mRNA levels in the brain, spinal cord, DRG and liver tissues of the scAAV9-CMV / CBA-coSMN1-3 and scAAV9-CMV / CBA-coSMN1-3-TmiR injection groups showed an increased trend compared with the wild-type rhesus monkeys. There was no significant difference in mRNA expression; however, in DRG and liver tissues, the SMN mRNA expression level in the scAAV9-CMV / CBA-coSMN1-3 group was higher than that in the scAAV9-CMV / CBA-coSMN1-3-TmiR group, suggesting that the scAAV9-CMV / CBA-coSMN1-3-TmiR viral targeting reduced SMN mRNA expression in the liver and DRG, while not affecting SMN mRNA expression in the brain and spinal cord. These results indicate that incorporating miRNA target sequences into viral vectors can overcome overexpression of the SMN gene in the liver and DRG, thereby avoiding the problems of hepatotoxicity and DRG toxicity caused by AAV therapy.

[0202] It should be noted that the above are only preferred embodiments of the present application and are not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Although specific implementation methods have been described, for the applicant or other skilled in the art, there may be or are currently no alternatives, modifications, changes, improvements and substantial equivalents of the above implementation methods. Therefore, the attached claims submitted and the claims that may be amended are intended to cover all such alternatives, modifications, changes, improvements and substantial equivalents. It is important to note that as technology evolves, many of the elements described herein may be replaced by equivalent elements that appear after the present application.

Claims

1. A gene expression cassette, characterized in that The gene expression cassette includes a polynucleotide encoding a human SMN protein, and the polynucleotide encoding a human SMN protein comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity with the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO:

3.

2. The gene expression cassette according to claim 1, wherein the polynucleotide encoding human SMN protein comprises the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO:

3.

3. The gene expression cassette according to claim 1, wherein the gene expression cassette further comprises a human miRNA target sequence. 4 . The gene expression cassette according to claim 3 , wherein the human miRNA target sequence is operably linked to the 3′ end of the polynucleotide encoding the human SMN protein.

5. The gene expression cassette according to claim 3, wherein: The human miRNA target sequence can reduce the expression efficiency of the polynucleotide encoding the human SMN protein in liver tissue; and / or The human miRNA target sequence can reduce the expression efficiency of the polynucleotide encoding the human SMN protein in the dorsal root ganglion tissue.

6. The gene expression cassette of claim 5, wherein the human miRNA target sequence comprises at least one of a miR-183 target sequence, a miR-182 target sequence, a miR-96 target sequence, a miR23b target sequence, a miR-145 target sequence, a miR-148a target sequence, a miR-22 target sequence, a miR-122 target sequence, a miR-143 target sequence, a miR-21 target sequence, or a miR-192 target sequence.

7. The gene expression cassette according to claim 5, wherein the human miRNA target sequence comprises at least one of a miR-183 target sequence or a miR-122 target sequence.

8. The gene expression cassette according to claim 7, wherein the human miRNA target sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 21-22.

9. The gene expression cassette according to claim 7, wherein the number of the human miRNA target sequence is 1.

10. The gene expression cassette according to claim 7, wherein the number of the human miRNA target sequence is greater than 1.

11. The gene expression cassette according to claim 10, wherein the human miRNA target sequence comprises 2 miR-183 target sequences and 2 miR-122 target sequences.

12. The gene expression cassette according to claim 10, wherein the more than one human miRNA target sequence is operably linked via at least one spacer sequence, and the spacer sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 4-6.

13. The gene expression cassette according to any one of claims 1 to 12, wherein the gene expression cassette further comprises a promoter and a poly A sequence.

14. The gene expression cassette according to claim 13, wherein the promoter comprises a CMV enhancer, a CBA promoter, a CAG promoter, a CBh promoter, a hSyn promoter, a CamKII promoter, an EF1α promoter, a UBC promoter or an endogenous SMN promoter.

15. A recombinant vector, characterized in that: The recombinant vector comprises the gene expression cassette according to any one of claims 1 to 14. The recombinant vector according to claim 15 , wherein the recombinant vector comprises a recombinant plasmid expression vector or a recombinant viral vector.

17. The recombinant vector according to claim 16, wherein the recombinant viral vector comprises a recombinant adenoviral vector, a recombinant adeno-associated viral vector, a recombinant retroviral vector, a recombinant herpes simplex viral vector, or a recombinant vaccinia viral vector. The recombinant vector according to claim 17 , wherein the recombinant viral vector is a recombinant adeno-associated viral vector.

19. The recombinant vector of claim 18, wherein the serotype of the recombinant adeno-associated virus vector comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh10, AAV11, AAV12, or AAV13.

20. The recombinant vector according to claim 19, wherein the serotype of the recombinant adeno-associated virus vector comprises AAV1, AAV8, or AAV9.

21. The recombinant vector according to any one of claims 18 to 20, wherein the gene expression cassette is located downstream of the 5' inverted terminal repeat sequence of the adeno-associated virus vector.

22. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the gene expression cassette according to any one of claims 1 to 14, or the recombinant vector according to any one of claims 15 to 21.

23. The pharmaceutical composition according to claim 22, wherein the pharmaceutical composition is in the form of intraventricular injection of the drug, intravenous injection of the drug or intrathecal injection of the drug.

24. An aqueous pharmaceutical preparation, characterized in that The aqueous pharmaceutical preparation comprises the gene expression cassette according to any one of claims 1 to 14, or the recombinant vector according to any one of claims 15 to 21.

25. The aqueous pharmaceutical formulation of claim 24, wherein the aqueous pharmaceutical formulation further comprises 0.001% poloxamer 188, 150 mM sodium chloride, 3 mM potassium chloride, 1.4 mM calcium chloride, 0.8 mM magnesium chloride and 1 mM sodium phosphate buffer.

26. The aqueous pharmaceutical formulation according to claim 25, wherein the aqueous pharmaceutical formulation is in the form of intraventricular injection of drugs, intravenous injection of drugs or intrathecal injection of drugs.

27. Use of the gene expression cassette according to any one of claims 1 to 14, the recombinant vector according to any one of claims 15 to 21, the pharmaceutical composition according to any one of claims 22 to 23, or the aqueous pharmaceutical preparation according to any one of claims 24 to 26 for expressing SMN protein in cells.

28. The use according to claim 27, wherein the cell is an animal cell.

29. The use according to claim 28, wherein the animal cells comprise neural cells.

30. Use of the gene expression cassette according to any one of claims 1 to 14, the recombinant vector according to any one of claims 15 to 21, the pharmaceutical composition according to any one of claims 22 to 23, or the aqueous pharmaceutical preparation according to any one of claims 24 to 26 in the preparation of a medicament for preventing, alleviating or treating a disease.

31. The use according to claim 30, wherein the disease is a SMN-related disease.

32. The use according to claim 31, wherein the SMN-related disease comprises: Diseases related to insufficient SMN protein expression, diseases related to SMN protein deficiency, diseases related to SMN1 gene deletion, and diseases related to SMN1 gene mutation.

33. The use according to claim 32, wherein the SMN-related disease is spinal muscular atrophy.

34. The use according to claim 33, wherein the spinal muscular atrophy comprises SMA type 1, SMA type 2, SMA type 3, SMA type 4.

35. The use according to claim 30, wherein the drug comprises an intraventricular injection drug, an intravenous injection drug or an intrathecal injection drug.

36. A method for preventing, alleviating or treating a disease, the method comprising administering to a subject in need thereof the gene expression cassette of any one of claims 1 to 14, the recombinant vector of any one of claims 15 to 21, the pharmaceutical composition of any one of claims 22 to 23, or the aqueous pharmaceutical preparation of any one of claims 24 to 26.

37. The method of claim 36, wherein the disease is a SMN-related disease.

38. The method of claim 37, wherein the SMN-related disease comprises: Diseases related to insufficient SMN protein expression, diseases related to SMN protein deficiency, diseases related to SMN1 gene deletion, and diseases related to SMN1 gene mutation.

39. The method of claim 38, wherein the SMN-related disease is spinal muscular atrophy.

40. The method of claim 39, wherein the spinal muscular atrophy comprises SMA Type 1, SMA Type 2, SMA Type 3, SMA Type 4.

Images