Application of PD-L1 as pseudorabies virus infection resistant therapeutic drug target

Abstract

The invention discloses application of PD-L1 as a drug target for resisting pseudorabies virus infection, the invention discloses PD-L1 as a key host limiting factor for pseudorabies virus infection for the first time, and knockout of PD-L1 can significantly promote replication of pseudorabies virus and induce apoptosis and inflammatory response of host cells. And PD-L1 overexpression can effectively inhibit proliferation of the pseudorabies virus and induce apoptosis and inflammatory response of host cells. Mechanism research results show that PD-L1 can be combined with envelope proteins gB and gD of the pseudorabies virus, and the effect of resisting pseudorabies virus infection is achieved through a cGAS-STNG-IFN pathway. The further research finds that the 125th arginine (ARG125) and the 271th lysine (LYS271) of the PD-L1 protein play a key role in the anti-pseudorabies virus infection effect of the PD-L1. The invention provides a new target spot for drugs for preventing or treating pseudorabies virus infection, and has a good application prospect in the aspect of resisting pseudorabies virus.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of PD-L1 as an anti-pseudorabies virus infection therapeutic drug target. BACKGROUND

[0002] Pseudorabies (PR) is an acute, severe, and highly contagious zoonosis caused by Pseudorabies virus (PRV), which has a wide host range, with pigs being the only natural host but can cross-species infection (including humans). PRV infection can cause pregnant sows to abort and produce stillbirths, and the mortality rate of newborn piglets is as high as 100%. Adult pigs are latently infected and carry the virus for life, causing huge economic losses to the pig industry. In recent years, PRV variants have occurred frequently, and the protective efficacy of the traditional Bartha-K61 vaccine has significantly decreased. At present, there is no specific antiviral drug for PRV, and the prevention and control situation is severe.

[0003] Pseudorabies virus is closely related to human pathogens such as herpes simplex virus type 1 (HSV-1) and varicella-zoster virus (VZV). Pseudorabies virus (PRV) belongs to the Varicellovirus genus of the Alphaherpesvirinae subfamily of the Herpesviridae family. The core of PRV virus is actually a spool-shaped double-stranded DNA, and the virion is mainly composed of a core, a capsid, a protein inner membrane, and a lipid bilayer membrane. The viral particles can enter the sensory nerve endings by infecting the mucosal epithelial cells, causing acute damage to the central nervous system and neuroinflammation and other pathological changes.

[0004] According to the different functions of genes, the PRV genes can be divided into structural genes, virulence genes, and regulatory genes. The main virulence genes include gD and gB. The gD and gB genes are located in the US region. gB is essential for viral entry into cells and intercellular transmission, while gD is essential for receptor binding, stable virion-cell interaction, and further activation of gB into fusion ability. Both of them are important genes for PRV proliferation, and antibodies against gB and gD can protect pigs from fatal PRV infection.

[0005] The process of PRV infection in natural hosts follows a specific invasion and spread path: the virus first invades through the oral or nasal cavity, spreads and falls off in the respiratory epithelium, penetrates the lamina propria after destroying the basement membrane with the help of proteases; then it is planted in the nerve endings of the peripheral nervous system such as glossopharyngeal nerve, olfactory nerve and trigeminal ganglion through draining lymph nodes and blood circulation, and then it spreads to the sensory neuron cell body through the axon and establishes latent infection. With the progression of the disease, the virus replicates in the draining lymph nodes, relies on peripheral blood mononuclear cells (mainly monocytes) to form cell-free or cell-associated viremia, and realizes the spread to multiple organs; finally, the infected monocytes adhere to the placental vascular endothelial cells and initiate secondary replication, causing pregnant sows to abort and completing vertical transmission.

[0006] In non-natural hosts, PRV infection is characterized by short course of disease, severe itching and 100% mortality. Its pathogenic process is as follows: the virus first replicates and spreads in the respiratory epithelium, activates the axon endings of the peripheral nervous system (PNS) neurons, triggers the inflammatory signaling pathway and releases pro-inflammatory factors; then it replicates and releases progeny viruses in the PNS neuron cell body, enhances neuron firing and axon electrical coupling, induces itching and exacerbates PNS neuron inflammation, while inflammatory factors recruit immune cells such as neutrophils to spread the neuritis; then the activated PNS neurons release neuropeptides, which are transmitted to the brain through the interneurons of the dorsal horn of the spinal cord and the neurons of the spinothalamic tract, and finally, after processing in the somatosensory cortex, the persistent itching is caused by the dysfunction of the central pruritus inhibition pathway.

[0007] Programmed death-ligand 1 (PD-L1, also known as CD274) is an immune checkpoint molecule, which is usually expressed on the surface of tumor cells, and can inhibit the activity of T cells by binding to PD-1 on immune cells, so that tumor cells escape the attack of the immune system. PD-L1 inhibitors are an important means for the treatment of various cancers. However, the role of PD-L1 in anti-animal virus has not been reported. The present application first found that PD-L1 plays a key role in anti-PRV infection as a host restriction factor, and PD-L1 can bind to the virulence protein of PRV to promote the anti-viral effect of host cells, which not only expands the understanding of the function of PD-L1, but also provides a new target and treatment strategy for the prevention and control of PRV infection. SUMMARY

[0008] The existing PRV prevention and control methods have limitations, and there is a lack of efficient targets and specific drugs. The primary purpose of the present application is to provide PD-L1 as a new target for anti-PRV infection prevention and / or treatment drugs and its application in the preparation or screening of anti-PRV infection prevention and / or treatment drugs.

[0009] A second object of the present application is to provide a kind of drug for preventing and / or treating pseudorabies virus infection, specifically, the drug is the drug that can enhance PD-L1 activity or promote PD-L1 gene / protein expression.

[0010] A third object of the present application is to provide the use of PD-L1 agonist in the preparation of drug for preventing or treating pseudorabies virus infection.

[0011] Further, the PD-L1 agonist includes any one or more of the following: compound that can enhance PD-L1 activity or promote PD-L1 gene / protein expression, PD-L1 protein, PD-L1 overexpression vector.

[0012] Further, the PD-L1 protein is encoded by PD-L1 gene, and the gene includes pig PD-L1 gene (GenBank No. NM_001025221.1), mouse PD-L1 gene (GenBank No. NM_021893.3), human PD-L1 gene (GenBank No. NM_001267706.2) and African green monkey PD-L1 gene (GenBank No. XM_007969332.3).

[0013] Further, the PD-L1 overexpression vector is constructed from pig PD-L1 gene (GenBank No. NM_001025221.1), mouse PD-L1 gene (GenBank No. NM_021893.3), human PD-L1 gene (GenBank No. NM_001267706.2) or African green monkey PD-L1 gene (GenBank No. XM_007969332.3).

[0014] A fourth aspect of the present application provides a kind of drug composition for preventing and / or treating pseudorabies virus infection.

[0015] Further, the drug composition includes the PD-L1 agonist.

[0016] The drug composition contains a prophylactically or therapeutically effective amount of PD-L1 agonist and pharmaceutically acceptable carrier.

[0017] The pharmaceutically acceptable carrier described above refers to a pharmaceutical carrier in the field of pharmacy. For example: diluents, excipients such as water, physiological saline, glucose, mannitol, glycerol, ethanol and mixtures thereof; fillers such as starch, sucrose, etc.; binders such as cellulose derivatives, alginate, gelatin and polyvinylpyrrolidone, etc.; humectants such as glycerol, etc.; disintegrants such as calcium carbonate and sodium bicarbonate, etc.; absorption promoters such as quaternary ammonium compounds, etc.; surfactants such as Tween-80, etc.; lubricants such as talc, calcium stearate, magnesium stearate and polyethylene glycol, etc. In addition, other adjuvants such as flavoring agents, sweeteners, etc. can also be added to the composition.

[0018] The pharmaceutical composition is administered to a subject in need of such prevention or treatment by oral, nasal inhalation, rectal, parenteral or transdermal administration. For oral administration, it can be prepared into conventional solid preparations such as tablets, powders, granules, capsules, pills, sustained-release pellets, solid dispersions, inclusions, etc., liquid preparations such as suspensions, emulsions, sols, syrups, mixtures, solutions, etc.; for parenteral administration, it can be prepared into injection solutions, aqueous or oily suspensions, emulsions, lyophilized powders, liposomes, microcapsules, microspheres, nanocapsules, nanospheres, etc. The preferred form is tablets, coated tablets, capsules, pellets, suppositories and injections, and more preferably, it is prepared into a preparation for specific site-targeted release.

[0019] The various dosage forms of the pharmaceutical composition of the present application can be prepared according to the conventional production method in the field of pharmacy. For example, the active ingredient is mixed with one or more carriers, and then prepared into the desired dosage form.

[0020] The pharmaceutical composition of the present application preferably contains a PD-L1 agonist in an amount of 0.01% to 99.9% by weight of the total weight. Most preferably, it contains a PD-L1 agonist in an amount of 0.5% to 95% by weight of the total weight.

[0021] The amount of the PD-L1 agonist used in the present application can be determined according to various factors such as animal species, prophylactic / therapeutic use, etc., and the daily dose can be 0.01 g / kg to 10 g / kg of body weight, preferably 0.1 g / kg to 1 g / kg of body weight. It can be used once or multiple times.

[0022] A fifth object of the present application is to provide a method for screening a candidate drug for preventing and / or treating pseudorabies virus (PRV) infection.

[0023] Further, the method comprises the following steps: a. Constructing a binding system of PD-L1 protein and pseudorabies virus gB or / and gD protein; b. Adding a test substance; c. detecting the binding rate of the substance to the binding of PD-L1 to pseudorabies virus gB or / and gD protein; d. screening the substance with a promotion rate of ≥ 50% as a candidate drug.

[0024] The binding system in step a above includes but is not limited to: a cell system, a subcellular system, a solution system, a tissue system, an organ system or an animal system.

[0025] The substance to be tested in step b above includes but is not limited to: small molecule entity compounds, natural products, etc.

[0026] The method for detecting the binding of PD-L1 to pseudorabies virus gB or / and gD protein in step c above includes but is not limited to: co-immunoprecipitation detection (Co-IP), BiFC experiment, etc.

[0027] The sixth object of the present application is to provide the use of a PD-L1 gene / protein expression inhibitor in the preparation of a porcine pseudorabies virus or a porcine pseudorabies virus vaccine production cell line.

[0028] The inhibitor described above includes siRNA interfering with PD-L1 gene expression, shRNA knocking down PD-L1 gene, sgRNA knocking out PD-L1 gene, or small molecule compounds down-regulating PD-L1 gene / protein expression.

[0029] Preferably, the inhibitor is sgRNA knocking out PD-L1 gene expression.

[0030] Preferably, the sgRNA is sgRNA1, sgRNA2 or sgRNA3, the sgRNA1 is a double-stranded fragment formed by annealing sgRNA1-F and sgRNA1-R, and the target sequence is: ATGGTGGTGCCGACTACAAG. Wherein, the specific sequences of the primers are as follows: sgRNA1-F: 5'-caccgATGGTGGTGCCGACTACAAG-3'; sgRNA1-R: 5'-aaacCTTGTAGTCGGCACCACCATC-3'; sgRNA2 is a double-stranded fragment formed by annealing sgRNA2-F and sgRNA2-R, and the target sequence is: TATTCAATTTGTGAATGGCG. Wherein, the specific sequences of the primers are as follows: sgRNA2-F: 5'-caccgTATTCAATTTGTGAATGGCG-3'; sgRNA2-R: 5'-aaacCGCCATTCACAAATTGAATAC-3'; sgRNA3 is a double-stranded fragment formed by annealing sgRNA3-F and sgRNA3-R, and the target sequence is: GTATGGCAGCAATGTAACAT. The specific sequences of the primers are as follows, sgRNA3-F: 5'-caccgGTATGGCAGCAATGTAACAT-3'; sgRNA3-R: 5'-aaacATGTTACATTGCTGCCATACC-3'.

[0031] A seventh object of the present application is to provide a PD-L1 mutant and its application in preparing a PRV virus vaccine or as a research tool for the mechanism of PRV virus and host interaction.

[0032] Further, the PD-L1 mutant mutates the 125th arginine (ARG125) and / or the 271st lysine (LYS271) in the amino acid sequence of the PD-L1 protein into other amino acids.

[0033] Preferably, the other amino acid is alanine (Ala).

[0034] The present application first discovers that PD-L1 is a key host limiting factor for PRV infection by constructing PD-L1 gene knockout and overexpression cell lines, and that knocking out PD-L1 can significantly promote PRV replication and its induction of host cell apoptosis and inflammatory response, while overexpression of PD-L1 can effectively inhibit PRV proliferation and its induction of host cell apoptosis and inflammatory response. Mechanism research results show that PD-L1 can bind to PRV envelope proteins gB and gD, and play an anti-PRV infection role through the cGAS-STING-IFN pathway. Further research shows that the 125th arginine (ARG125) and the 271st lysine (LYS271) of the PD-L1 protein play a key role in the anti-PRV infection effect of PD-L1. The present application clarifies that PD-L1 can be used as a new target for anti-PRV infection therapeutic drugs, provides a completely new idea for the treatment and / or prevention of PRV infection, and provides practical experimental evidence and scientific basis for the clinical treatment of PRV infection, and has good application prospects in anti-PRV infection. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 PD-L1 inhibitor BMS202 promotes PRV replication.

[0036] Figure 2 Construction of PD-L1 gene knockout cell lines and verification of knockout effect.

[0037] Figure 3 Knocking out PD-L1 gene promotes the replication of pseudorabies virus.

[0038] Figure 4 Knocking out PD-L1 gene promotes the apoptosis induced by pseudorabies virus.

[0039] Figure 5 Knocking out PD-L1 gene enhances the inflammation response and inhibits the anti-virus immune response induced by pseudorabies virus.

[0040] Figure 6 Construction of cell line with overexpression of PD-L1 gene and verification of the effect.

[0041] Figure 7 Overexpression of PD-L1 gene inhibits the replication of pseudorabies virus.

[0042] Figure 8 Overexpression of PD-L1 gene inhibits the apoptosis induced by pseudorabies virus.

[0043] Figure 9 Overexpression of PD-L1 gene inhibits the inflammation response and enhances the anti-virus immune response induced by pseudorabies virus.

[0044] Figure 10 Interaction of PD-L1 with gB and gD proteins of pseudorabies virus.

[0045] Figure 11 Molecular docking and molecular dynamics simulation of PD-L1 with gB and gD molecules of pseudorabies virus.

[0046] Figure 12 Effect of amino acid mutation on the anti-pseudorabies virus infection of PD-L1. DETAILED DESCRIPTION

[0047] The specific embodiments of the present application are described below to enable those skilled in the art to understand the present application, but it should be clear that the present application is not limited to the scope of the specific embodiments. The specific conditions are not specified in the examples, and the conventional conditions or the conditions recommended by the manufacturer are used. The reagents or instruments used are not specified by the manufacturer, and are all conventional products that can be purchased on the market.

[0048] Example 1: Inhibition of PD-L1 expression can promote the replication of pseudorabies virus BV2 cells were adherent cultured for 24 h, and PD-L1 inhibitor BMS202 pretreatment group and control group were set. The BMS202 pretreatment group was pretreated with BMS202 for 2 h before virus infection, and the control group was added with the corresponding volume of DMEM. After 2 h, PRV was added for 2 h, the medium was changed, and the culture was continued for 24 h. DNA in the supernatant was extracted according to the whole blood / cell culture DNA extraction kit instructions, and the gD copy number was detected by RT-qPCR method. From Figure 1 It can be seen that the inhibitor treatment significantly promotes the replication of pseudorabies virus.

[0049] Example 2: Construction and effect verification of PD-L1 gene knockout cell line The sgRNA targeting the PD-L1 gene was first synthesized, and then the PD-L1 gene was knocked out by the CRISPR / Cas9 specific knockout method, using BV2 cells and PK15 cells as target cells, to obtain the PD-L1 gene knockout cell line.

[0050] The PD-L1 gene sequence was queried by NCBI database (GenBank number of pig is NM_001025221.1, GenBank number of mouse is NM_021893.3), according to the design principle of CRISPR / Cas9, the CG content is about 5060%, the sgRNA with higher effectiveness is selected, 3 pairs of sgRNA sequences are designed in the coding region of PD-L1 gene, in order to promote the transcription of sgRNA, CACCG is added at the 5' end of the coding strand of sgRNA sequence, and AAAC is added at the 3' end of the template strand, so as to form sticky ends. According to the method, 3 pairs of sgRNA primers are designed, which are synthesized by Sheng Wu Biotechnology Co., Ltd. The primer sequences are shown in Table 1: Table 1 sgRNA primer sequence of mouse Table 2 sgRNA primer sequence of pig The CRISPR V2 vector was single-enzyme cut by restriction enzyme Esp3I, the linearized vector was recovered by gel electrophoresis, and the synthesized upstream and downstream primers were annealed. The linearized CRISPR V2 vector was connected with T4 DNA ligase for 1 h, transformed into Stbl3 competent cells, coated with AMP agar plates at 37℃ overnight, and the single colonies were selected and cultured in AMP LB. The plasmid was extracted, and the plasmid was sent for identification. The correct plasmid was prepared for standby.

[0051] The packaging lentivirus auxiliary plasmid psPAX2, pMD2.g and three sgRNA plasmids were co-transfected in 6-well plates when the density of 293T cells was 60-70%, and the original culture medium was discarded after 6 h, and replaced with DMEM culture medium containing 10% FBS for 18 h. The virus liquid was filtered with a 0.45 μm filter, infected into BV2 cells, and polybrene was added to increase the infection efficiency, and the infection was performed twice. The BV2 cells were placed in an incubator for 24 h, and the cells were screened with DMEM medium containing 3 μg / mL puromycin, and the wild type cells were removed, and the surviving cells were subcultured again, and the cells were frozen or plated for experiments, and the PD-L1 gene knockout cell line was obtained, which was referred to as PD-L1KO, and was verified by Western Blotting. The construction of the PD-L1 gene knockout cell line and the verification results of the PD-L1 gene knockout BV2 cell line are shown in Figure 2 .

[0052] Example 3: PD-L1 gene knockout promotes pseudorabies virus replication The WT type and PD-L1 gene knockout BV2 cells were infected with the pseudorabies virus Bartha K61 strain, and the virus titer in the culture supernatant 48 h after infection and the virus copy number in the cell and culture supernatant mixture were detected. At the same time, the WT type and PD-L1 gene knockout BV2 cells were infected with the pseudorabies virus (PRV-GFP) carrying the green fluorescent protein reporter gene, and the intracellular fluorescence intensity was detected by flow cytometry and observed by fluorescence microscope.

[0053] As shown in Figure 3 , compared with the WT type cells, the PRV copy number, virus titer and intracellular fluorescence intensity of the PD-L1 gene knockout BV2 cells were significantly increased, indicating that the PD-L1 gene knockout promoted the replication of the pseudorabies virus.

[0054] Example 4: PD-L1 gene knockout promotes pseudorabies virus-induced cell apoptosis The WT type and PD-L1 gene knockout BV2 cells cultured for 24 h were taken, and the control group and the virus infection group were set. The maintenance liquid was replaced 2 h after virus infection. After 48 h, the maintenance liquid was removed, each well was washed with 1 mL of pre-cooled PBS once, 0.3 mL of Accutase enzyme was added for digestion, 1 mL of PBS was added for gentle blowing, and the cells were collected into the corresponding flow tube, and centrifuged at 1000 rpm for 5 min. The cells were collected, stained according to the Annexin V-FITC / PI double staining cell apoptosis detection kit instructions, and the apoptosis level was detected by flow cytometry.

[0055] As can be seen from Figure 4 , compared with the WT type cells, the apoptosis rate of the PD-L1 gene knockout BV2 cells was significantly increasedP <0.001), indicating that PD-L1 gene knockout promotes pseudorabies virus-induced apoptosis.

[0056] Example 5: PD-L1 gene knockout enhances host inflammatory response and reduces anti-viral immune response WT and PD-L1 gene knockout BV2 cells adherent cultured for 24 h were taken, and cell control and virus infection groups were set. The virus was replaced with maintenance fluid 2 h after infection. Cells were collected 12 h after culture, total RNA was extracted using TRIzol reagent, and the expression levels of inflammatory and anti-viral factor genes were detected by reverse transcription and RT-qPCR method. Culture supernatant and cells were collected 24 h after culture, and the contents of IL-6 and CXCL10 in the culture supernatant were detected by ELISA kit; the expression levels of anti-viral proteins and cGAS-STING pathway related proteins in cells were detected by Western Blotting method.

[0057] The experimental results are shown in Figure 5 Compared with WT cells, the expression levels of anti-viral factors Irf7 , Ifn-β , Isg15 in PD-L1 gene knockout cells were significantly reduced, Oasl1 the expression levels of STING and ISG15 proteins and the phosphorylation levels of IRF7 and TBK1 in PD-L1 knockout cells were significantly reduced. The above results show that PD-L1 gene knockout enhances host inflammatory response and reduces anti-viral immune response.

[0058] Example 6: Construction of PD-L1 gene overexpression cell line and effect verification The plasmid information and cloning position of the control and PDL1 overexpression Plv4ltr-Puro-CMV are shown in Figure 6 A, and the plasmid was synthesized and sequenced by Genescript Biotech Co., Ltd.

[0059] The control (referred to as Ctrl) and PD-L1 gene overexpression BV2 cell line (referred to as PD-L1 OE) were constructed according to the method of Example 2 (Western Blot verification of overexpression was successful, and the results are shown in Figure 6 .

[0060] Example 7: PD-L1 gene overexpression inhibits pseudorabies virus replication The control and PD-L1 gene overexpression BV2 cells were infected with PRV Bartha K61 strain, and the virus titers of the culture supernatant 48 h after infection and the virus copy number in the mixture of cells and culture supernatant were detected. At the same time, the control and PD-L1 gene overexpression BV2 cells were infected with the pseudorabies virus (PRV-GFP) carrying the green fluorescent protein reporter gene, and the intracellular fluorescence intensity was detected by flow cytometry and observed by fluorescence microscope.

[0061] The results are as follows Figure 7 Compared with the control cells, the PRV copy number, virus titer and intracellular fluorescence intensity of the PD-L1 overexpression cells were significantly reduced, indicating that the PD-L1 gene overexpression inhibited the replication of pseudorabies virus.

[0062] Example 8: PD-L1 gene overexpression inhibits pseudorabies virus-induced cell apoptosis The control and PD-L1 gene overexpression BV2 cells cultured for 24 h were taken, and the control group and virus infection group were set. The maintenance fluid was changed 2 h after virus infection. After 48 h, the maintenance fluid was removed, each well was washed once with 1 mL pre-cooled PBS, 0.3 mL Accutase enzyme was added for digestion, 1 mL PBS was added for gentle blowing, and the cells were collected into the corresponding flow tube and centrifuged at 1000 rpm for 5 min. The cells were collected and stained according to the instructions of Annexin V-FITC / PI double staining cell apoptosis detection kit, and flow cytometry was used for detection.

[0063] From Figure 8 It can be seen that compared with the control group, the apoptosis rate of PD-L1 gene overexpression BV2 cells was significantly reduced (P<0.001), indicating that PD-L1 gene overexpression inhibited pseudorabies virus-induced cell apoptosis. P <0.001), indicating that PD-L1 gene overexpression inhibited pseudorabies virus-induced cell apoptosis.

[0064] Example 9: PD-L1 overexpression inhibits host inflammatory response and enhances anti-viral infection immune response The control and PD-L1 gene overexpression BV2 cells cultured for 24 h were taken, and the control group and virus infection group were set. The maintenance fluid was changed 2 h after virus infection. The cells were collected 12 h after culture, total RNA was extracted using TRIzol reagent, and the expression levels of inflammatory and anti-viral factor genes were detected by RT-qPCR method. The cells were collected 24 h after culture, and the expression levels of anti-viral proteins and cGAS-STING pathway related proteins in the cells were detected by Western Blotting method.

[0065] The experimental results are shown in Figure 9 Compared with the control cell group, PD-L1 overexpression significantly reduced the expression levels of inflammatory factor genes and increased the expression levels of anti-viral factors (P<0.001) at 12 h after infection. Irf7, Ifn-β , Isg15 and Oasl1 ) gene expression levels. At the same time, the expression levels of STING and antiviral protein ISG15 protein and the phosphorylation levels of IRF7 and TBK1 were significantly up-regulated. The above results show that PD-L1 overexpression inhibits the host inflammatory response and enhances the antiviral infection immune response.

[0066] Example 10: Interaction of PD-L1 with PRV gB, gD proteins pCAGGS-gB-Flag, pCAGGS-gD-Flag or control plasmid (i.e. pCAGGS-Flag Ctrl) were co-transfected with pCAGGS-PDL1-HA or pCAGGS-HA Ctrl into 293T cells, and proteins were collected to detect the presence of interaction using co-immunoprecipitation (Co-IP). At the same time, gB-VC155, gD-VC155 were co-transfected with PDL1-VN173 or VN173 into 293T cells, and BiFC experiment was carried out to verify the interaction of PRV gB and PRV gD proteins with PDL1 by confocal microscopy.

[0067] As shown in Figure 10 , both co-immunoprecipitation (Co-IP) and BiFC experiment confirmed that PRV gB and PRV gD proteins interact with PD-L1.

[0068] Example 11: Molecular docking and molecular dynamics simulation of PD-L1 with PRV gB, gD proteins PDL1 and gB proteins were pre-processed using AmberTools22, GAFF force field was added, and RESP charge was calculated using ORCA 5.0.4; the simulation system was constructed in Gromacs 2024.3, Amber99sb-ildn force field was used, Tip3p water model was added, and Na + ions were added to neutralize the charge; energy minimization, NVT and NPT equilibration were performed; 100 ns molecular dynamics simulation was run with a step size of 2 fs; the trajectory was analyzed, RMSD, RMSF, number of hydrogen bonds, SASA, radius of gyration, B factor, free energy landscape and MM / PBSA binding free energy were calculated; through MM / PBSA energy decomposition analysis, the residues with the largest contribution to binding free energy were identified.

[0069] The results are shown in Figure 11As shown, the complex structure of PD-L1 and pseudorabies virus gB is stable, and the ΔG binding free energy is ‒343.93 kcal / mol; the ΔG binding free energy of the complex of PDL1 and pseudorabies virus gD is ‒171.56 kcal / mol, and the structural stability is poor, and the number of hydrogen bonds decreases significantly after 40 ns. The residues that contribute most to the binding free energy of PD-L1 and pseudorabies virus gB, PD-L1 and pseudorabies virus gD were found, including ARG2, LYS30, etc., which can be used as target points for subsequent experimental verification or drug design.

[0070] Example 12: Effect of amino acid mutation on PD-L1 anti-pseudorabies virus infection According to the potential key amino acid sites predicted by the molecular docking method, the predicted amino acids were replaced with alanine using site-directed mutagenesis technology, and five single-point mutant plasmids of PD-L1 (Y56A, E58A, R125A, R265A, K271A) were constructed. The wild type and mutant plasmids of PD-L1 were transfected into mouse microglial BV2 cells, respectively. After 24 hours, PRV Bartha-K61 strain or pseudorabies virus carrying green fluorescent protein reporter gene (PRV-GFP) was used to infect the cells.

[0071] MTT method was used to detect the cell viability after pseudorabies virus infection of BV2 cells, and total DNA was extracted, and RT-qPCR was performed for rabies virus gD gene. The results are shown in Figure 12 A, B show that, compared with the wild type of PD-L1, the mutations of R125A and K271A lead to a significant decrease in the survival rate of BV2 cells infected with pseudorabies virus (P < 0.001). Figure 12 A), the copy number of pseudorabies virus significantly increased (P < 0.001). P < 0.001).

[0072] After 48 hours of infection, Annexin V-FITC / PI apoptosis detection kit was used for staining, and flow cytometry was used for detection. The results are shown in Figure 12 C, D show that, compared with the wild type of PD-L1, the mutations of R125A and K271A lead to a significant increase in the apoptosis rate of BV2 cells infected with pseudorabies virus (P < 0.001). P < 0.001).

[0073] After 48 hours of infection, flow cytometry and fluorescence microscope were used to detect the fluorescence intensity of PRV-GFP infected BV2 cells. The results are shown in Figure 12 E-G show that, compared with the wild type of PD-L1, the mutations of R125A and K271A lead to a significant increase in the fluorescence intensity of PRV-GFP infected BV2 cells (P < 0.001). P < 0.001).

[0074] After 24 hours of infection, the mRNA expression levels of inflammatory factors and anti-viral factors were detected by RT-qPCR. Figure 12 Figure 6 shows that, compared with PD-L1 wild type, mutations of R125A and K271A lead to up-regulation of inflammatory factor gene expression and up-regulation of anti-viral factor gene expression in pseudorabies virus infected BV2 cells.

[0075] The above results show that the two amino acids R125A and K271A play a key role in the effect of PD-L1 on pseudorabies virus infection.

[0076] The present application first found that PD-L1 is a key host restriction factor for pseudorabies virus infection by constructing PD-L1 gene knockout and overexpression cell lines. Knocking out PD-L1 can significantly promote pseudorabies virus replication and its induction of host cell apoptosis and inflammatory response, while overexpression of PD-L1 can effectively inhibit the proliferation of pseudorabies virus and its induction of host cell apoptosis and inflammatory response. Mechanism research results show that PD-L1 can bind to pseudorabies virus envelope proteins gB and gD, and play an anti-pseudorabies virus infection role through the cGAS-STING-IFN pathway. Further research found that the 125th arginine (ARG125) and the 271st lysine (LYS271) of the PD-L1 protein play a key role in the effect of PD-L1 on pseudorabies virus infection. The present application clarifies that PD-L1 can be used as a new target for anti-pseudorabies virus infection therapeutic drugs, and provides a completely new idea for the treatment and / or prevention of pseudorabies virus infection, and provides practical experimental evidence and scientific basis for the clinical treatment of pseudorabies virus infection, and has good application prospect in anti-pseudorabies virus infection.

Claims

1. The use of the PD-L1 gene or PD-L1 protein as a target in the preparation or screening of drugs for the prevention and / or treatment of pseudorabies virus (PRV) infection; wherein the drug is a drug that can enhance PD-L1 activity or promote PD-L1 gene / protein expression.

2. The use of PD-L1 agonists in the preparation of medicaments for the prevention and / or treatment of pseudorabies virus infection, wherein the PD-L1 agonist comprises any one or more of compounds that can enhance PD-L1 activity or promote PD-L1 gene / protein expression, PD-L1 protein, and PD-L1 overexpression vectors.

3. The application as described in claim 2, characterized in that, The PD-L1 protein is encoded by the PD-L1 gene, which includes the PD-L1 gene of pigs (GenBank No. NM_001025221.1), the PD-L1 gene of mice (GenBank No. NM_021893.3), the PD-L1 gene of humans (GenBank No. NM_001267706.2), and the PD-L1 gene of African green monkeys (GenBank No. XM_007969332.3).

4. The application as described in claim 2, characterized in that, The PD-L1 overexpression vector is constructed from porcine PD-L1 gene (GenBank accession number NM_001025221.1), mouse PD-L1 gene (GenBank accession number NM_021893.3), human PD-L1 gene (GenBank accession number NM_001267706.2), or African green monkey PD-L1 gene (GenBank accession number XM_007969332.3).

5. An anti-pseudorabies virus infection drug, comprising a PD-L1 agonist as described in any one of claims 2-4 and pharmaceutically acceptable excipients.

6. A method for screening candidate drugs against pseudorabies virus infection, characterized in that, Includes the following steps: a. Construct a binding system for PD-L1 protein with pseudorabies virus gB and / or gD proteins; b. Add the substance to be screened; c. Detect the effect of the substance on the binding rate of PD-L1 to pseudorabies virus gB and / or gD proteins; d. Select substances with an enhancement rate ≥ 50% as candidate drugs.

7. Application of PD-L1 gene knockout cell lines as production cell lines for porcine pseudorabies virus or vaccines.

8. The application as described in claim 7, characterized in that, The PD-L1 gene knockout cell line was constructed using sgRNA targeting the PD-L1 gene. The sgRNA was sgRNA1, sgRNA2, or sgRNA3. sgRNA1 was a double-stranded fragment formed by annealing sgRNA1-F and sgRNA1-R, and its targeting sequence was ATGGTGGTGCCGACTACAAG. The specific primer sequences are as follows: sgRNA1-F: 5'-caccgATGGTGGTGCCGACTACAAG-3'; sgRNA1-R: 5'-aaacCTTGTAGTCGGCACCACCATC-3'; sgRNA2 is a double-stranded fragment formed by the annealing of sgRNA2-F and sgRNA2-R, and its targeting sequence is: TATTCAATTTGTGAATGGCG; the specific primer sequences are as follows: sgRNA2-F: 5'-caccgTATTCAATTTGTGAATGGCG-3'; sgRNA2-R: 5'-aaacCGCCATTCACAAATTGAATAC-3'; sgRNA3 is a double-stranded fragment formed by the annealing of sgRNA3-F and sgRNA3-R, and its targeting sequence is: GTATGGCAGCAATGTAACAT; the specific primer sequences are as follows. sgRNA3-F: 5'-caccgGTATGGCAGCAATGTAACAT-3'; sgRNA3-R: 5'-aaacATGTTACATTGCTGCCATACC-3'.

9. A PD-L1 mutant, characterized in that, It involves mutating arginine at position 125 (ARG125) and / or lysine at position 271 (LYS271) of the PD-L1 amino acid sequence to other amino acids, including alanine (ALA).

10. The use of the mutant as described in claim 9 in the preparation of pseudorabies virus vaccines or as a tool for studying the interaction mechanism between pseudorabies virus and the host.

Images