Use of gadw mutants in human milk oligosaccharide production

By introducing the GadW E208G mutant into Escherichia coli, the human milk oligosaccharide production pathway was regulated, solving the problem of insufficient human milk oligosaccharide production and significantly increasing the production of 3'-SL, 6'-SL, LNT II, ​​LNnT and LNT.

CN121181671BActive Publication Date: 2026-03-20TIANJIN UNIV OF SCI & TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511757455.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-27
Publication Date
2026-03-20
Estimated Expiration
2045-11-27

AI Technical Summary

Technical Problem

There is still room for improvement in the production yield of human milk oligosaccharides in Escherichia coli using existing technologies, especially in the synthesis of 3'-SL, 6'-SL, LNT II, ​​LNnT and LNT.

Method used

By introducing the GadW mutant, specifically the GadW E208G mutant, into E. coli using gene editing technology, the transcription process in the human milk oligosaccharide production pathway is regulated, thereby increasing the yield of human milk oligosaccharides.

Benefits of technology

The production of 3'-SL, 6'-SL, LNT II, ​​LNnT and LNT was increased by 8.5%, 35.3%, 50% and 42.9%, respectively.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121181671B_ABST
    Figure CN121181671B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to application of a GadW mutant in human milk oligosaccharide production. The amino acid sequence of the GadW mutant is shown as SEQ ID NO. 3. By using a gene editing technology, a genetic engineering chassis strain carrying a GadW mutant coding gene is obtained, and then the above chassis strain is applied in a human milk oligosaccharide such as 3'-SL, 6'-SL, LNT II, LNnT and LNT, etc. production strain construction process, and the yield of human milk oligosaccharide is further improved. Among them, the yield of 3'-SL is increased by 8.5%, the yield of LNT II is increased by 26.7%, the yield of LNnT is increased by 50%, the yield of LNT is increased by 42.9%, and the yield of 6'-SL is increased by 35.3%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of GadW mutants in the production of human milk oligosaccharides. Background Technology

[0002] Human milk oligosaccharides (HMOs) are an important class of bioactive components in breast milk. HMOs have various physiological functions, including establishing a balanced infant gut microbiota, strengthening the gastrointestinal barrier, preventing infection, and providing potential support to the immune system. Based on their structure, they are classified into fucoidylated neutral human milk oligosaccharides, sialylated human milk oligosaccharides, and non-fucosylated neutral human milk oligosaccharides. Currently, more than 200 HMOs have been discovered, including 3'-sialyllactose (3'-SL), 6'-sialyllactose (6'-SL), lactyl- N - Trisaccharide II (lacto- N- triose, LNT II), lactoyl- N -New tetrasaccharide (Lacto- N -neotetraose, LNnT) and lactyl- N -Tetrasaccharide (Lacto- N HMOs are produced through various methods, including chemical synthesis, enzyme catalysis, and microbial fermentation. Among these, microbial fermentation offers advantages such as ease of operation, environmental friendliness, and low cost, making it more suitable for large-scale industrial production.

[0003] In recent years, although the development of HMO microbial cell factory strategies has achieved some success, there is still room for improvement in yield. When *E. coli* synthesizes sialylated human lactose oligosaccharides, the introduction of... N -acetylglucosamine isomerase gene ( neuC) Acetylneuraminic acid synthase gene ( neuB ), CMP-acetylneuraminic acid synthase gene ( neuA ), synthesizing cytidine monophosphate- N - Acetylneuraminic acid (CMP-Neu5Ac). CMP-Neu5Ac binds to lactose under the catalysis of α2,3-sialyltransferase α2,3-SiaT and α2,6-sialyltransferase α2,6-SiaT to synthesize 3'-SL and 6'-SL, respectively. In the synthesis of LNnT, glucose is used as the carbon source, and glucose-6-phosphate (Glc-6-P) is... pgi The encoded glucose-6-phosphate isomerase catalyzes the conversion to fructose-6-phosphate (F6P), and F6P is then sequentially converted to fructose-6-phosphate (F6P).glmS encoded glutamine-fructose-6-phosphate amidotransferase, glmM encoded phosphoglucosamine mutase, glmU encoded N - acetylglucosamine-1-phosphate uridyltransferase / amino-glucose-1-phosphate acetyltransferase to uridine diphosphate under the catalysis of N - acetylglucosamine (UDP-GlcNAc); in the synthesis pathway of another precursor uridine diphosphate-galactose (UDP-Gal), Glc-6-P is converted to UDP-Gal under the catalysis of pgm encoded phosphoglucomutase and galE encoded UDP-glucose-4-isomerase to UDP-Gal, in lgtA encoded β-1,3- N - acetylglucosamine aminotransferase, lactose and UDP-GlcNAc generate intermediate product LNT II. Subsequently, LNT II is combined with UDP-Gal to generate LNnT under the catalysis of lgtB encoded β-1,4-galactosyltransferase to generate LNnT, in wbgO encoded β-1,3-galactosyltransferase to generate LNT.

[0004] GadW is a key AraC family transcriptional dual regulator in E. coli, which mainly regulates glutamate-dependent acid resistance system, controls the transcription of genes involved in acid resistance system, and also activates the transcription of central activators involved in acid reaction. However, there is no related research on the regulation of human milk oligosaccharides in E. coli.

[0005] The present application creatively introduces gadW mutation of the gene in the human milk oligosaccharide production strain, which is expected to further improve the yield of human milk oligosaccharides. SUMMARY

[0006] The present application uses gene editing technology to obtain a genetically engineered chassis strain carrying a GadW mutant encoding gene, and then applies the above chassis strain to the construction process of human milk oligosaccharide production strains such as 3'-SL, 6'-SL, LNT II, LNnT and LNT, further improving the yield of human milk oligosaccharides.

[0007] One of the technical solutions provided by the present application is a mutant of DNA-binding transcriptional dual regulator GadW, wherein the mutant of GadW is obtained by mutating glutamic acid at position 208 to glycine based on wild-type GadW shown in SEQ ID NO. 1.

[0008] Further, the amino acid sequence of the mutant of GadW is shown in SEQ ID NO. 3.

[0009] The present application also provides a coding gene of the mutant of GadW.

[0010] Further, the nucleotide sequence of the coding gene is shown in SEQ ID NO. 4.

[0011] The second technical solution provided by the present application is the application of the mutant of GadW in the first technical solution, in particular, the application in the production of human milk oligosaccharides.

[0012] Further, when the mutant of GadW expressed in the human milk oligosaccharide production strain is the mutant shown in SEQ ID NO. 3, the yield of human milk oligosaccharides can be further improved.

[0013] Further, the human milk oligosaccharides include but are not limited to: lacto-N-triose (LNTII), lacto-N-neotetraose (LNnT), lacto-N-tetraose (LNT), 3'-sialyllactose (3'-SL) and 6'-sialyllactose (6'-SL) and the like. N N N

[0014] The third technical solution provided by the present application is a strain for producing human milk oligosaccharides, wherein the strain is a human milk oligosaccharide production strain, and the amino acid sequence of GadW expressed by the strain is shown in SEQ ID NO. 3.

[0015] Further, the strain uses Escherichia coli K12 MG1655 as a host, and knocks out lacZ in the lactose operon sequence of the host, and overexpresses trc lacY Further, the amino acid sequence of GadW expressed by the strain is shown in SEQ ID NO. 3; and the strain further comprises a human milk oligosaccharide production pathway. ​​​​

[0016] Further, the human milk oligosaccharides include, but are not limited to: lacto- N -N-triose (Lacto-N-Triose, LNT II), lacto- N -N-neotetraose (Lacto-N-Neotetraose, LNnT), lacto- N -N-tetraose (Lacto-N-tetraose, LNT), 3'-sialyllactose (3'-Sialyllactose, 3'-SL) and 6'-sialyllactose (6'-Sialyllactose, 6'-SL);

[0017] Further, the human milk oligosaccharide production pathway is any one of the following plasmids:

[0018] pTrc99a-P trc - lgtA , pTrc99a-P trc - lgtB - lgtA, pTrc99a-P trc - wbgO - lgtA, pTrc99a-P J23119 - neuB-neuC -P trc - neuA-ist and pTrc99a-P J23119 - neuB-neuC -P trc - neuA-ST6 .

[0019] The fourth technical solution of the present application is the application of the strain in the third technical solution in the production of human milk oligosaccharides.

[0020] Further, the human milk oligosaccharides include: LNT II, LNnT, LNT, 3'-SL, 6'-SL.

[0021] Beneficial effects:

[0022] The present application introduces the E208G mutation of GadW into E. coli and applies it in the production of human milk oligosaccharides, and the yields of 3'-SL, 6'-SL, LNT II, LNnT and LNT are all improved to different degrees. Among them, the yield of 3'-SL is increased by 8.5%, the yield of LNT II is increased by 26.7%, the yield of LNnT is increased by 50%, the yield of LNT is increased by 42.9%, and the yield of 6'-SL is increased by 35.3%. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 PCR verification of the first step homologous recombination colony.

[0024] Figure 2 For the second step, the homologous recombination colonies were verified by PCR. DETAILED DESCRIPTION

[0025] The present application is further described in the following specific embodiments. Unless otherwise specified, the technical means, materials and the like involved in the following embodiments can be known to those skilled in the art, and appropriate ones can be selected from the means and materials known to solve the corresponding technical problems. In addition, the embodiments should be understood as illustrative rather than limiting the scope of the present application, and the essence and scope of the present application are only limited by the claims. For those skilled in the art, various changes or modifications to the ingredients and amounts of the materials in these embodiments without departing from the essence and scope of the present application also fall within the protection scope of the present application.

[0026] The following definitions are used in the present application:

[0027] 1. Nomenclature of amino acid and DNA nucleic acid sequences

[0028] The recognized IUPAC nomenclature of amino acid residues is used in the form of single letter or three letter code. The recognized IUPAC nomenclature of DNA nucleic acid sequences is used.

[0029] 2. Identification of GadW mutants

[0030] The amino acid mutated in the GadW mutant is represented by "original amino acid + position + substituted amino acid". For example, E208G represents that the 208th amino acid is replaced from glutamic acid in the wild type to glycine, and the position number corresponds to the amino acid sequence number of wild type GadW in SEQ ID NO. 1.

[0031] In the present application, gadW represents the coding gene of wild type GadW (Gene ID: 948029); gadW E208G represents the coding gene of mutant GadW E208G, and the specific information is shown in the following table.

[0032]

[0033] The transcriptional regulator GadW mutant involved in the present application is the GadW E208G mutant obtained by mutating glutamic acid at position 208 to glycine based on wild type GadW, and the amino acid sequence of the GadW E208G mutant is shown in SEQ ID NO. 3:

[0034] MTHVCSVILIRRSFDIYHEQQKISLHNESILLLEKNLADDFAFCSPDTRRLDIDELTVCHYLQNIRQLPRNLGLHSKDRLLINQSPPMPLVTAIFDSFNESGVNSPILSNMLYLSCLSMFSHKKELIPLLFNSISTVSGKVERLISFDIAKRWYLRDIAERMYTSESLIKKKLQDENTCFSKILLASRMSMARRLLELRQIPLHTIAGKCGYSSTSYFINTFRQYYGVTPHQFAQHSPGTFS*

[0035] The present application relates to gadW The E208G coding gene is obtained by mutating the adenine at position 623 to guanine based on the wild type GadW coding gene shown in Gene ID: 948029, and the wild type GadW coding gene is shown in SEQ ID NO. 1. gadW The nucleotide sequence of the E208G coding gene is shown in SEQ ID NO. 4:

[0036] atgactcatgtctgctcggtgatcctcattcgtcgttcattcgatatttatcatgaacagcaaaaaatatcgctgcataacgagagtattctgctgctggagaaaaatttggcagacgattttgcgttttgttcaccggatacgcgacgactggatatcgatgagctgacagtttgccattacttacaaaatattcgtcagctaccacgcaatttagggttacacagcaaagaccgtttgttaattaaccagtcaccccccatgccgctggtgacggcgatttttgatagcttcaatgaatccggggtaaattcaccgatactgagcaatatgctctacctttcctgtttatcgatgttttctcataagaaagaactgatccccttacttttcaatagcatcagcactgtttcaggaaaagttgaacgccttattagctttgatatcgccaaacgttggtatctgcgcgatatcgcggaaagaatgtataccagcgagagtctaatcaaaaaaaagttgcaggatgaaaatacctgtttcagtaaaatattactcgcctccaggatgtcgatggccagacgattactcgagttacgtcaaattcctctgcatactattgcgggaaaatgtggctatagcagtacatcgtactttataaacacatttcgacaatattatggtgtaacgccacatcagtttgcgcaacattcgccaggtaccttttcctga

[0037] The application will be further explained by the specific embodiments below.

[0038] Example 1 Construction of strain G1

[0039] On the basis of E. coli H0, the transcriptional regulator GadW encoding gene (Gene ID: 948029) on the genome was mutated by CRISPR / Cas9 gene editing technology, the 623th nucleotide adenine was mutated to guanine (A to G), and the corresponding amino acid was the 208th glutamic acid to glycine, to obtain strain G1.

[0040] Among them, Escherichia coli H0 is Escherichia coli K12 MG1655 ( Escherichia coli K12 MG1655 was constructed using the starting strain, and lactose was knocked out of the starting strain. lac P in the manipulator sequence lac Promoter sequences and regulatory genes lacZ , in the original lacZ Following the site with P trc Promoter overexpression lacY For details on the construction process of this strain, please refer to Example 1 of CN119464168A.

[0041] The specific construction method of strain G1 is as follows:

[0042] Based on strain H0, CRISPR / Cas9 technology (Zhao D, et al. CRISPR / Cas9-assisted gRNA-free one-step genome editing with no sequence limitations and improved targeting efficiency. Sci Rep 7,16624) was used to... gadW The adenine nucleotide at position 623 of the gene was mutated to guanine (A mutated to G), resulting in strain G1. The specific construction method of strain G1 is as follows:

[0043] 1. Construction of homologous recombination fragments

[0044] Using the wild-type MG1655 strain preserved in the laboratory as a template, homologous recombination fragments were constructed using the primers in Table 1. gadW -up-f / r and gadW Using -down-f / r primers, PCR amplification yielded the upstream and downstream homologous arms of homologous recombination. This was achieved using artificially synthesized chloramphenicol resistance genes. cat , cat Using the promoter and N20 nucleotide vector as templates, primer pairs were used... gadW PCR amplification was performed using -cat-f / r to obtain samples with... cat- Fragments of the N20 sequence. Upstream and downstream homologous arms, carrying... cat- The N20 sequence fragment (SEQ ID NO.5), these three fragments are used as templates, using primers... gadW -up-f and gadW -down-r performs overlap PCR to obtain homologous recombination fragments, which contain gadW The mutation site of the gene, i.e., the wild type gadW The nucleotide sequence at position 623 is mutated from adenine to guanine.

[0045] 2. First step homologous recombination

[0046] The pCAGO plasmid was transformed into strain H0 by using conventional plasmid transformation method to obtain strain H0 (pCAGO). LB medium containing 1% (m / v) glucose and 0.1 mM IPTG was used to prepare H0 (pCAGO) competent cells, and the homologous recombination fragment obtained in step 1 was introduced by using the electroporation method. The transformed bacterial solution was spread on LB plates containing 100 mg / L ampicillin and 25 mg / L chloramphenicol, and 1% glucose, and cultured at 30°C. The transformants were picked for colony PCR verification (verification primers: gadW -yz-f / r). If the recombination is successful, the band size is about 2685 bp, and the verification result is shown in Figure 1 , the band is correct, i.e. the first homologous recombination is successful, and the correct transformants are picked for the second step homologous recombination.

[0047] 3. Second step homologous recombination

[0048] The strain with successful verification of the first recombination was inoculated into LB test tubes containing 100 μg / mL ampicillin and 0.1 mM IPTG, and cultured on a shaker at 30°C for more than 6 h to induce the expression of CRISPR / Cas9 system and λ-red protein to complete the second recombination. Three zones were separated on LB plates containing ampicillin, and the separated single colonies were picked and spotted on chloramphenicol-resistant LB plates and ampicillin-resistant LB plates, respectively. Single colonies that did not grow on chloramphenicol medium and grew on ampicillin medium were selected, and colony PCR verification was performed (verification primers: gadW -yz-f / r). If the recombination is correct, the band size is about 1750 bp, and the verification result is shown in Figure 2 , the band is correct, and the PCR product of the band was sequenced, and the sequencing result was correct, obtaining the second step homologous recombination strain. The second step homologous recombination strain was further cultured at 37°C to lose the pCAGO plasmid, thereby obtaining a mutant strain with gadW , named G1.

[0049] Table 1 Primers used for constructing gadW gene mutant strains

[0050]

[0051] Example 2 Construction of plasmid pTrc99a-P J23119 - neuB-neuC P trc - neuA-ist

[0052] Plasmid pTrc99a-P was constructed using plasmid pTrc99a as a template J23119 - neuB-neuC -P trc - neuA-ist The specific construction process of the plasmid is referred to in patent CN117736280A Example 2.

[0053] Example 3 Construction of plasmid pTrc99a-P J23119 - neuB-neuC -P trc - neuA-ST6

[0054] Plasmid pTrc99a-P was constructed using plasmid pTrc99a-P J23119 - neuB-neuC -P trc - neuA-ist as a template. J23119 - neuB-neuC -P trc - neuA-ST6 The specific construction process of the plasmid is referred to in patent CN117736280A Example 3.

[0055] Example 4 Construction of plasmid pTrc99a-P trc -lgtA

[0056] lgtA The gene encoding β-1,3-N-acetylglucosamine transferase was used as a template to construct plasmid pTrc99a-P trc -lgtA The specific construction process of the plasmid is referred to in patent CN 119464168A Example 4.

[0057] Example 5 Construction of plasmid pTrc99a-P trc -lgtB-lgtA

[0058] lgtB The gene encoding lipid oligosaccharide biosynthesis protein was used as a template to construct plasmid pTrc99a-P trc - lgtA based on plasmid pTrc99a-P trc - lgtB - lgtA The specific construction process of the plasmid is referred to in patent CN 119464168A Example 5.

[0059] Example 6 Construction of plasmid pTrc99a-P trc - wbgO - lgtA

[0060] wbgO The gene encodes β-1,3-galactosyltransferase, which is expressed in plasmid pTrc99a-P. trc -l gtA Based on this, plasmid pTrc99a-P was constructed. trc -wbgO-lgtA The specific construction process of this plasmid is described in Example 6 of patent CN 119464168A.

[0061] Example 7 Fermentation tests of 3'-SL, 6'-SL, LNT II, ​​LNnT and LNT producing strains

[0062] Using electroconversion, the following plasmid pTrc99a-P J23119 - neuB-neuC -P trc - neuA-ist pTrc99a-P J23119 - neuB-neuC -P trc - neuA-ST6, pTrc99a-P trc - lgtA pTrc99a-P trc - lgtB - lgtA and pTrc99a-P trc - wbgO - lgtA Import them into H0 and G1 respectively, and build them respectively:

[0063] (1) 3'-SL production strain:

[0064] Y1 [H0 (pTrc99a-P J23119 - neuB-neuC -P trc - neuA-ist )];

[0065] Y2 [G1 (pTrc99a-P J23119 - neuB-neuC -P trc - neuA-ist ) ];

[0066] (2) 6'-SL production strain:

[0067] Y3 [H0 (pTrc99a-P J23119 - neuB-neuC -P trc - neuA - ST6 )];

[0068] Y4 [G1 (pTrc99a-P J23119 -neuB-neuC -P trc - neuA - ST6 )];

[0069] (3) LNT II production strain:

[0070] Y5 [H0 (pTrc99a-P trc - lgtA )];

[0071] Y6 [G1 (pTrc99a-P trc - lgtA )];

[0072] (4) LNnT production strain:

[0073] Y7 [H0 (pTrc99a-P trc - lgtB - lgtA )];

[0074] Y8 [G1 (pTrc99a-P trc - lgtB - lgtA )];

[0075] (5) LNT production strain:

[0076] Y9 [H0 (pTrc99a-P trc - wbgO - lgtA )];

[0077] Y10 [G1 (pTrc99a-P trc - wbgO - lgtA )];

[0078] The strains and plasmids used in the present patent are shown in Table 2.

[0079] Table 2 Strains and plasmids used in the present application

[0080]

[0081] The production levels of the above strains were tested by fermentation, respectively. The culture medium used was:

[0082] LB medium (1 L): NaCl 10 g, yeast powder 5 g, peptone 10 g.

[0083] Fermentation medium ingredients: 10 g / L glycerol, 5 g / L lactose, 5 g / L KH2PO4, 2 g / L NH4Cl, 1.7 g / L citric acid, 1.4 g / L MgSO4 7H2O, 4.5 mg / L thiamine, 5 g / L yeast powder, 40 g / L Mops, 1 mL / L trace element stock solution, adjusted to pH 6.8 with ammonia water, sterilized at 121 ℃ for 30 min.

[0084] The trace element stock solution has the following components: 10.0 g / L FeSO4 7H2O, 0.38 g / L MnSO4 H2O, 1.0 g / L CuSO4 5H2O, 2.2 g / L ZnSO4 7H2O, 2.0 g / L CaCl2, 0.1 g / L (NH4)6Mo7O 24 4H2O, 0.1 g / L Na2B4O7 10H2O.

[0085] The fermentation test process is as follows:

[0086] Single colonies of 3'-SL, 6'-SL, LNT II, LNnT and LNT production strains were picked respectively, and cultured in LB liquid medium containing 50 mg / L ampicillin and kanamycin at 37 ℃, 220 rpm / min, overnight. The bacterial liquid of overnight culture was used as seed liquid, and the bacterial liquid was transferred to a 24-well plate containing 2 mL fermentation medium at a inoculation amount of 1%. The fermentation medium contained 50 mg / L ampicillin and kanamycin and 0.1 mmol / L IPTG, and the fermentation was carried out at 37 ℃, 800 rpm / min. Each strain was cultured in parallel for 3 samples. During the fermentation process, the growth (OD 600 ) of the bacterial cells and the contents of 3'-SL, 6'-SL, LNT II, LNnT and LNT were determined, and the concentrations of 3'-SL, 6'-SL, LNT II, LNnT and LNT in the samples were detected by HPLC. The high performance liquid chromatography detection conditions of LNT II, LNnT, LNT, 3'-SL and 6'-SL are referred to in Example 4 of patent CN117736280A. The results are shown in Tables 3 to 7:

[0087] As can be seen from Tables 3 to 7, after the mutants expressing gadW genes respectively, the yields of 3'-SL, 6'-SL, LNT II, LNnT and LNT were all improved to different degrees.

[0088] Table 3 Test results of different strains producing 3'-SL

[0089]

[0090] As can be seen from Table 3, after the amino acid at position 208 of the GadW protein is mutated from glutamic acid to glycine, the strain carrying gadW The 3'-SL yield of the genome-mutated strain Y2 is increased by 8.5% compared to the Y1 strain.

[0091] Table 4. Test results of different strains for producing 6'-SL

[0092]

[0093] As can be seen from Table 4, after the amino acid at position 208 of the GadW protein is mutated from glutamic acid to glycine, the strain carrying gadW The 6'-SL yield of the genome-mutated strain Y4 is increased by 35.3% compared to the Y3 strain.

[0094] Table 5. Test results of different strains for producing LNT II

[0095]

[0096] As can be seen from Table 5, after the amino acid at position 208 of the GadW protein is mutated from glutamic acid to glycine, the strain carrying gadW The LNT II yield of the genome-mutated strain Y6 is increased by 26.7% compared to the Y5 strain.

[0097] Table 6. Test results of different strains for producing LNnT

[0098]

[0099] As can be seen from Table 6, after the amino acid at position 208 of the GadW protein is mutated from glutamic acid to glycine, the strain carrying gadW The LNnT yield of the genome-mutated strain Y8 is increased by 50% compared to the Y7 strain.

[0100] Table 7. Test results of different strains for producing LNT

[0101]

[0102] As can be seen from Table 7, after the amino acid at position 208 of the GadW protein is mutated from glutamic acid to glycine, the strain carrying gadW The LNT yield of the genome-mutated strain Y10 is increased by 42.9% compared to the Y9 strain.

[0103] As can be seen from the results, after the amino acid at position 208 of the GadW protein is mutated from glutamic acid to glycine, the strain carrying the genome mutation exhibits certain advantages in synthesizing human milk oligosaccharides compared to the wild-type strain, and the yields of 3'-SL, 6'-SL, LNT II, LNnT and LNT are all increased to a certain extent.

[0104] While the present application has been disclosed in terms of preferred embodiments thereof, it will be apparent to those skilled in the art that various changes, modifications, substitutions and alterations can be made thereto without departing from the spirit and scope of the application as defined by the appended claims and their equivalents.

Claims

1. A mutant of GadW, a DNA-binding transcription dual regulator, characterized in that, The GadW mutant was obtained by mutating glutamic acid to glycine at position 208 based on the wild-type GadW shown in SEQ ID NO.

1.

2. The encoding gene of the GadW mutant according to claim 1.

3. The application of the GadW mutant according to claim 1, characterized in that, It is used in the production of human milk oligosaccharides.

4. The application as described in claim 3, characterized in that, The human milk oligosaccharide includes: lactoyl- N - Trisaccharide, lactyl- N -New tetrasaccharides, lactose- N -Tetrasaccharide, 3'-sialyl lactose and 6'-sialyl lactose.

5. A bacterial strain that produces human milk oligosaccharides, characterized in that, The strain used *Escherichia coli* K12 MG1655 as a host, and knocked out the lactose operon sequence in the host. lacZ overexpression lacY The amino acid sequence of GadW expressed by the strain is shown in SEQ ID NO.3; in addition, the strain also contains a human milk oligosaccharide production pathway. The human milk oligosaccharide includes: lactoyl- N - Trisaccharide, lactyl- N -New tetrasaccharides, lactose- N -Tetrasaccharide, 3'-sialyl-lactose and 6'-sialyl-lactose; The human milk oligosaccharide production pathway is any one of the following plasmids: pTrc99a-P trc - lgtA 、pTrc99a-P trc - lgtB - lgtA、 pTrc99a-P trc - wbgO - lgtA、 pTrc99a-P J23119 - neuB-neuC -P trc - neuA-ist and pTrc99a-P J23119 - neuB-neuC -P trc - neuA-ST6 .

6. The use of the strain described in claim 5 in the production of human milk oligosaccharides.

Citation Information

Patent Citations

  • Method for producing human milk oligosaccharide

    CN119464168A

  • Application of OpgG and mutant thereof in production of human milk oligosaccharide

    CN120484075A