Aospora cruenta CsCCD4 gene and its role in regulating aroma

By cloning and expressing the CsCCD4 gene of Cymbidium goeringii, constructing a recombinant vector and transforming the plant, the problem of insufficient synthesis of aromatic substances in Cymbidium goeringii was solved, significantly improving the fragrance and ornamental traits of the orchid.

CN121182833BActive Publication Date: 2026-04-10ENVIRONMENTAL HORTICULTURE RES INST OF GUANGDONG ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511579558.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-31
Publication Date
2026-04-10
Estimated Expiration
2045-10-31

AI Technical Summary

Technical Problem

Current technologies lack screening and functional identification of genes related to the synthesis of characteristic aroma substances in Cymbidium goeringii, especially the insufficient research on β-ionone synthesis, which affects the improvement of the orchid's ornamental traits.

Method used

The CsCCD4 gene of Cymbidium sinense was cloned and expressed, and a recombinant expression vector was constructed. Through Agrobacterium tumefaciens transformation of Phalaenopsis petals and Nicotiana macrophylla, the expression of genes related to aroma substance synthesis was enhanced.

Benefits of technology

It significantly increased the content of β-ionone in the petals of Phalaenopsis orchids and large-flowered tobacco, enhanced the fragrance of the orchids, and improved their ornamental value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121182833B_ABST
    Figure CN121182833B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of plant molecular biology technology, and specifically relates to a species of Cymbidium goeringii. CsCCD4 Genes and their role in regulating aroma. This invention provides a method for enhancing the synthesis of aroma compounds in orchids. CsCCD4 The gene, whose nucleotide sequence is shown in SEQ ID NO.1, was cloned to obtain the full-length gene sequence. Based on this, an overexpression vector was constructed and transient transformation of Phalaenopsis orchid petals and stable transformation of Nicotiana benthamiana were performed. The results showed that the content of the aroma compound β-ionone in the transiently transformed Phalaenopsis orchid petals and the stably transformed Nicotiana benthamiana petals was significantly increased compared to the control group (CK), indicating that... CsCCD4 It plays an important role in enhancing the fragrance compounds of orchids. As an important component in the synthesis of fragrance compounds in orchids... CsCCD4 Genes can be used in orchid genetic engineering to improve ornamental traits and create genetic varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology technology, and specifically relates to a species of Cymbidium goeringii. CsCCD4 Genes and their role in regulating aroma. Background Technology

[0002] Chinese orchids are among my country's ten traditional famous flowers, mainly including eight varieties: Cymbidium ensifolium, Cymbidium sinense, Cymbidium goeringii, Cymbidium faberi, Cymbidium faberi, Cymbidium kanran, and Cymbidium faberi. Chinese orchids carry a profound cultural heritage, having been cultivated and passed down for thousands of years, and are deeply loved by people in China and around the world. Their unique fragrance determines the core value of Chinese orchids. Different Chinese orchids possess different characteristic fragrance components; currently, it is necessary to screen and functionally identify genes related to the synthesis of these characteristic fragrance substances to provide genetic resources for further development and utilization.

[0003] Carotenoid cleaving dioxygenases (CCDs) can oxidatively cleave carotenoids at one or both ends of a molecule, generating various apocoside-free carotenoids, which is one of the main pathways for carotenoid degradation in organisms. All CCD family members utilize carotenoids as substrates for oxidative cleavage, but different CCDs exhibit significant differences in substrate specificity and double bond cleavage sites. Among CCD family members, CCD1 and CCD4 are capable of catalyzing the formation of aromatic volatile compounds from carotenoids. Compared to CCD1, CCD4 typically exhibits higher substrate selectivity, specifically cleaving β-carotene at the 9, 10, and 9', 10' double bond sites to generate the aromatic volatile apocoside-free carotenoid β-ionone, a major component of plant floral fragrance. Current reports on characteristic aroma compounds of Cymbidium goeringii suggest that β-ionone plays an important role in the formation of Cymbidium goeringii's fragrance, but research on β-ionone synthesis in Cymbidium goeringii is currently lacking. Therefore, researching and identifying genes in the Cymbidium goeringii genome that regulate the synthesis of floral fragrance substances is of great significance for the later improvement and enhancement of the ornamental traits of orchid plants. Summary of the Invention

[0004] In view of the above-mentioned problems existing in the prior art, the technical problem to be solved by the present invention is: the first technical problem is to provide a method for enhancing the synthesis of orchid fragrance substances. CsCCD4 Genes; the second technical challenge lies in providing information related to the synthesis of substances that enhance the aroma of orchids. CsCCD4 The third technical challenge lies in providing the genes that enhance the synthesis of orchid fragrance compounds. CsCCD4 Specific applications of genes.

[0005] This invention is achieved through the following technical solution:

[0006] A type of Cymbidium CsCCD4 Genes, the ones mentionedCsCCD4 The nucleotide sequence of the gene is shown as SEQ ID NO. 1.

[0007] SEQ ID NO. 1

[0008]

[0009] Further, the expression vector of the gene encoding the protein with the amino acid sequence as shown in SEQ ID NO. 2. CsCCD4

[0010] SEQ ID NO. 2

[0011] MDTLFSTLLKSTSCTSFLPGKSGILISPMKPISPPPAPFISAVETKEKPQRERRTKSDSADNYGNTSSSAGSSSPQQLSQLKPQYQSPRSRYREPSAAAAFCNALDNLINNFIDPPHLRPSFDPRHLLSDNWAPADELPPTACPVIRGVIPTCLRGGAYIRNGPNPQYLPRGTHHLFDGDGMLNALLLPRSGDGTIPATLCSRYVRTYKYLLERDAGGPVLPNVFSGFNGTAGIARGAVAAARILTGQMNPAAGVGLANTSLAFFGDRLYALGESDLPYAVRLSPDDGNITTIGRCDFEGRLSIGMTAHPKKDPATGELFAFRYGPVPPFLTYFRFDAVGNYKTGEDVPIFSLTQPSMVHDFAITERFAIFPDIQIVMKPMDMVAPGRGSPVGPDRGKVPRLGVLPKYARSESGMRWFEVPGFNIMHTLNAWEEEGGDAIILVAPNVLSIEHALERIELVHSSVEMVRIDLQSGAVSRTPLSAENLDFGVIHPNYVGRKNRFAYLGVGNPMPKISGVRKLDFSLCGRGDCVVASRDFGPNCYGGEPFFVPSGKRGEEDDGYVVSYLHDEGIRESKFIVMDARSPQLDVVAEVLLPSRVPYGFHGLFLTQAEIMAQRQD

[0012] A plant of the species Iris japonica containing the above-mentioned gene of Iris japonica CsCCD4 Further, the expression vector of the gene encoding the protein with the amino acid sequence as shown in SEQ ID NO. 2.

[0013] Further, the expression vector of the gene encoding the protein with the amino acid sequence as shown in SEQ ID NO. 2.

[0014] A recombinant Agrobacterium containing the above-mentioned expression vector, wherein the Agrobacterium is GV3101 strain.

[0015] A plant of the species Iris japonica containing the above-mentioned gene of Iris japonica​CsCCD4 The application of genes in enhancing plant aroma synthesis includes the following steps:

[0016] (1) Construct a structure containing the following as shown in SEQ ID NO.1 CsCCD4 Recombinant gene expression vectors;

[0017] (2) Transform the recombinant expression vector obtained in step (1) into Agrobacterium to obtain recombinant Agrobacterium;

[0018] (3) Introduce recombinant Agrobacterium into the target plant via transient or stable transformation methods;

[0019] (4) After the transiently transformed plant has grown normally for 5 days, the petals of the transiently transformed plant were collected for GC-MS determination of aroma substances;

[0020] (5) On the second day after the stable transformed plant has grown normally and flowered, the petals of the stable transformed plant were collected for GC-MS aroma substance determination.

[0021] Furthermore, the starting vector of the expression vector described in step (1) is the pOCA30 plasmid.

[0022] Furthermore, the Agrobacterium mentioned in step (2) is strain GV3101.

[0023] Furthermore, the target plant for the instantaneous transformation is a Phalaenopsis orchid petal;

[0024] The target plant for the stable transformation is Nicotiana macrocarpa.

[0025] The present invention has the following advantages over the prior art:

[0026] This invention provides a method for enhancing the synthesis of orchid fragrance substances. CsCCD4 The gene, whose nucleotide sequence is shown in SEQ ID NO.1, was cloned to obtain the full-length gene sequence. Based on this, an overexpression vector was constructed and transient transformation of Phalaenopsis orchid petals and stable transformation of Nicotiana benthamiana were performed. The results showed that the content of the aroma compound β-ionone in the transiently transformed Phalaenopsis orchid petals and the stably transformed Nicotiana benthamiana petals was significantly increased compared to the control group (CK), indicating that... CsCCD4 It plays an important role in enhancing the fragrance compounds of orchids. As an important component in the synthesis of fragrance compounds in orchids... CsCCD4 Genes can be used in orchid genetic engineering to improve ornamental traits and create genetic varieties. Attached Figure Description

[0027] Figure 1 For target gene CsCCD4 Agarose gel electrophoresis image of the amplification products;

[0028] Figure 2 Phylogenetic tree analysis of six plant CCD proteins;

[0029] Figure 3 For CsCCD4 Expression pattern analysis of the gene in different developmental stages;

[0030] Figure 4 For the target gene CsCCD4 Figure of positive single colony detection after the amplified fragment was connected with PHB vector and transformed;

[0031] Figure 5 Figure of agarose gel electrophoresis of bacteria after Agrobacterium GV1301 transformation;

[0032] Figure 6 Figure of comparison of aroma components of transiently transformed plants with control aroma components;

[0033] Figure 7 Figure of agarose gel electrophoresis identification of tobacco positive plants;

[0034] Figure 8 Figure of comparison of aroma components of stably transformed plants with control aroma components. DETAILED DESCRIPTION

[0035] The present application will be further described below in conjunction with specific examples. In the following examples, the operations not described in detail are all routine biological experimental operations, which can be performed with reference to the Handbook of Molecular Biology Experiments and existing published journal articles, etc., or according to the instructions of the reagent kits and products. The materials, reagents, etc. used in the following examples, if not specifically stated, can be obtained from commercial channels. It should be understood that the examples described in the specification are only for the purpose of explaining the present application, and are not intended to limit the present application, and the parameters, proportions, etc. of the examples can be selected as appropriate without substantially affecting the results.

[0036] The material used in the present application is V3 butterfly orchid in full bloom, and the large-flowered tobacco used is provided by Nanjing Zhongding Biotechnology Co., Ltd.

[0037] Example 1 CsCCD4 Cloning of the gene and sequence analysis

[0038] 1. Extraction of RNA and obtaining of cDNA

[0039] Approximately 2 g of floral organs from the Cymbidium goeringii cultivar 'Yingchunsu' during its peak flowering period (day 2 of flowering) were flash-frozen in liquid nitrogen, ground, and then total RNA was extracted from the floral organs using the Novizan RNA Extraction Kit (Fastpure Universal Plant Total RNA). The extracted total RNA was then stored at -80°C. The extracted floral organ total RNA was used to perform reverse transcription using the HiScript III 1 reverse transcription kit from Novizan Biotechnology Co., Ltd. (Nanjing Novizan Biotechnology Co., Ltd.). st The Strand cDNA Synthesis Kit (+gDNA wiper) is used to reverse transcribe cDNA, which is then stored at -20°C for later use.

[0040] 2. Target gene CsCCD4 Cloning

[0041] Using the cDNA obtained above as a template, PCR primers were used... CsCCD4 -F(GGGCTACTGAGTTTGCTTGT) and CsCCD4 -R (ATCTTGTCGTTGCGCCAT) was amplified by PCR using Novizan's high-fidelity enzyme (2×Phanta Flash MasterMix (Dye Plus)). The PCR reaction mixture was as follows: cDNA 2 uL, high-fidelity enzyme 25 uL. CsCCD4 -F primer 2 μL, CsCCD4 -R primer 2 uL, add ddH2O to 50 uL. PCR reaction program is as follows: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 56℃ annealing for 5 s, 72℃ extension for 5 s, 35 cycles; final extension at 72℃ for 1 min. The obtained PCR amplification products are subjected to 1% agarose gel electrophoresis (…). Figure 1 The DNA was extracted from the gel using the Novizan FastPure Gel DNA Extraction Mini Kit. The extracted product was ligated into a cloning vector (Novozymes 5 min TA / Blunt-Zero Cloning Kit) and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Sequencing results revealed that the amplified fragment contained the complete CDS sequence of the target gene, consisting of 1857 bases, with the nucleotide sequence shown in SEQ ID NO.1. This gene was named the *Cymbidium goeringii* aroma regulatory gene. CsCCD4 Using SnapGene software to CsCCD4 The nucleotide sequence was translated into a protein sequence (as shown in SEQ ID NO.2), which encodes a protein amino acid sequence consisting of 618 amino acid residues, named the orchid aroma regulating protein CsCCD4. The obtained protein contains... CsCCD4E. coli was preserved in Guangdong Academy of Agricultural Sciences Institute of Environmental Horticulture.

[0042] 3. CsCCD4 Gene sequence analysis

[0043] The conserved domain of CsCCD4 protein was analyzed by Conserve Domain Search function of NCBI database, and it was found that CsCCD4 has A conserved NCED conserved domain (belongs to RPE65 superfamily) is one of the main characteristics of oxidative cleavage enzymes involved in the biosynthesis of apo-carotenoids.

[0044] All genes containing PF03055 domain in Arabidopsis, rice and four orchid species (Shenzhen Pseudodendrium, Dendrobium officinale, Cymbidium goeringii and Phalaenopsis amabila) were identified at the whole genome level, and a phylogenetic tree was constructed based on these genes (Fig. 1 Figure 2 ), and finally the candidate gene Mol015121 was determined as CsCCD4 .

[0045] Example 2 CsCCD4 Expression pattern of the gene in the bud development process of C. goeringii

[0046] 1. Extraction of RNA and acquisition of cDNA

[0047] About 2 g of flower organs of C. goeringii variety 'Yingchun' from 5 representative flower development stages (flower bud stage (S1), early opening stage (S2), half opening stage (S3), full opening stage (S4) and wilting stage (S5)) were quickly frozen in liquid nitrogen and ground, then total RNA of the flower organs was extracted using the RNA extraction kit (Fastpure Universal Plant Total RNA) of Novagen Company, and stored in a-80℃ refrigerator. The total RNA of the flower organs extracted above was reverse transcribed to generate cDNA using the reverse transcription kit (HiScript III 1 st Strand cDNA Synthesis Kit (+gDNA wiper) of Nanjing Novagen Biotechnology Co., Ltd. (hereinafter referred to as Novagen Company), and stored at-20℃.

[0048] 2. qRT-PCR detection

[0049] The forward primer qRT-CsCCD4-F (TCAACCTTGCTGAAGTCCAC) and the reverse primer qRT-CsCCD4-R (CGGGCTTTGATATTGAGGCT) were used to detect the expression of the gene in the flower organs of C. goeringii from 5 representative flower development stages (flower bud stage (S1), early opening stage (S2), half opening stage (S3), full opening stage (S4) and wilting stage (S5)). CsCCD4Gene expression levels were analyzed by qRT-PCR. Actin was amplified using qRT-CsActin-F (GGTGATGTGCTGGATCCTTT) and qRT-CsActin-R (TACTGGATTGGTTGGGCTTG) primers as an internal control. The qRT-PCR reaction program was: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 5 s, 60℃ annealing for 30 s, for 40 cycles. Real-time quantitative PCR was performed using a qTOWER 2.2 PCR instrument from Jena, Germany, following the instructions for the Taq Pro Universal SYBR qPCR Master Mix kit.

[0050] 3. Expression Analysis

[0051] Analysis of the qRT-PCR results revealed that... CsCCD4 Gene expression analysis showed that, along with the flower bud opening process, CsCCD4 Gene expression levels peaked at time S3 and then declined. Figure 3 ).

[0052] Example 3 CsCCD4 Construction of gene overexpression vectors

[0053] 1. Obtain the target gene fragment

[0054] The amplification in Example 1 CCD4 Using a full-length TA vector as a template, the target gene fragment was amplified using the following primers.

[0055] F:ccagtctctctctcaagcttATGGATACTTTGTTCTCAACCTTGC

[0056] R:ggatcaattcgagctcTCACAATGAATTTGGACTCTCTAAT

[0057] 2. PCR amplification

[0058] PCR amplification was performed using Q5® high-fidelity DNA polymerase.

[0059] Table 1 PCR reaction system

[0060] ;

[0061] Table 2 Amplification Procedure

[0062] ;

[0063] The PCR products at the end of the reaction were detected by gel electrophoresis using 1.0% low-melting-point agarose gel and observed by ultraviolet gel imaging device, and the correct band was cut and recovered.

[0064] 3. Plasmid double enzyme digestion and product purification

[0065] Table 3 Enzyme digestion system

[0066] ;

[0067] Reaction conditions: 37°C, overnight. The enzyme digestion products were recovered by product purification.

[0068] Recombinant ligation

[0069] Table 4 Recombinant ligation system

[0070] ;

[0071] Use a pipette to gently pipette and mix briefly (do not shake and mix), and centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0072] Single fragment recombinant reaction, 37°C, 30 min; reduce to 4°C or immediately cool on ice.

[0073] 5. Recombinant plasmid transformation

[0074] Take the 1.5 mL centrifuge tube containing E. coli transformation competent from the -80°C refrigerator and insert it into ice for 2 min, aspirate the ligation product into E. coli transformation competent and mix well, insert the well-mixed E. coli into ice for 30 min, then insert it into a 42°C metal bath for heat shock for 1 min, immediately remove it and place it in ice for 5 min, then add 800 μL of sterile LB liquid medium to the centrifuge tube, and place it in a 37°C constant temperature incubator for recovery culture for 30 min. After centrifugation of the recovered E. coli culture, discard the supernatant in a clean bench, add the mixture to LB solid plate medium containing 50 mg / L Kan and spread evenly, and incubate at 37°C for 14-18 h, pick 5 single colonies into centrifuge tubes containing 500 μL of LB liquid medium containing 50 mg / L Kan, and incubate at 37°C in a constant temperature incubator for 3 h. Then perform bacterial liquid PCR verification (PCR primers are shown in Table 6) Figure 4 ).

[0075] 6. Detection of positive clones

[0076] Table 5 PCR reaction system

[0077] ;

[0078] Table 6 PCR reaction conditions

[0079] ;

[0080] The PCR products were detected by gel electrophoresis (Vex WIX-EP300) with 1% low-melting agarose and observed by an imaging system (Shanghai Kinxiang ChemiScope 6100) to determine whether there were target bands.

[0081] The bacterial liquid with target bands was sequenced.

[0082] 7. Plasmid extraction

[0083] The bacterial liquid with correct bands was used to extract plasmid DNA according to the instructions of the plasmid extraction kit (Meiji Biological P1001-02), and was directly used for Agrobacterium transformation or stored at -20°C.

[0084] 8. Agrobacterium transformation

[0085] The recombinant plasmid was transformed into Agrobacterium GV3101 by freeze-thaw method, and after overnight culture, single colonies on the plate were picked and subjected to colony PCR identification (PCR primers are shown in Table 7), and positive clones were added with 500 uL LB containing 50 mg / L kan and 50 mg / L rif for overnight culture, and 1:1 with glycerol for preservation, which was used for subsequent experiments. Figure 5

[0086] Example 4: Transient transformation of Phalaenopsis petals

[0087] (1) Shake the bacteria: The bacterial liquid of PHB empty vector and PHB-CCD4 target gene fusion expression vector transferred into GV3101 Agrobacterium was taken out from -80°C, thawed to ice water mixed state, and then inserted into ice for thawing. 300 uL of bacterial liquid was added into 30 mL of LB liquid medium (containing Kana 50 ug / mL -1 , Rif 25 ug / mL -1 ) and cultured at 28°C, 200 rpm, in the dark, until the bacterial liquid OD 600 = 0.6~0.8.

[0088] ​(2) Preparation of mixed bacterial suspension: Weigh 0.196 g of acetylsuccinone (As) powder and dissolve and mix it in 10 mL of dimethyl sulfoxide (operation in a fume hood) to obtain a 100 mM As solution. Weigh 0.195 g of 2-morpholinoethanesulfonic acid (MES) and 0.095 g of magnesium chloride (MgCl2) powder and dissolve them in 1 mL of water to obtain 1 M MES solution and MgCl2 solution. Filter the above solutions through a 0.22 μm filter membrane, and add 100 μL of each solution to an Erlenmeyer flask. Make up to 100 mL with sterile water to obtain a suspension. Centrifuge the bacterial suspension (4℃, 5000 rpm, 10 min), discard the supernatant, collect the bacterial cells, and resuspend them using the suspension prepared on the same day until the resuspended solution has an OD of 0. 600 = Between 0.8 and 1.0. Place in the dark for 2 hours.

[0089] (3) Infection: Use a 1 mL disposable syringe to inject the mixed bacterial solution into the back of the petals of a healthy white Phalaenopsis orchid.

[0090] (4) Culture: Place the transiently transformed plants injected with the target gene mixed bacterial solution and the transiently transformed plants injected with the empty vector bacterial solution in the dark overnight, and take them out in the sunlight the next day for 3 days.

[0091] (5) Determination of β-ionone content in transiently transformed plants

[0092] Table 7 Instruments

[0093] ;

[0094] (1.1) Standards and reagents

[0095] Standard: β-ionone (source leaf, CAS: 14901-07-6)

[0096] Reagent: Methanol (chromatographic grade, Shanghai Xingke).

[0097] (1.2) Draw the standard curve

[0098] Accurately weigh an appropriate amount of the standard sample and prepare a standard stock solution with a concentration of 100 μg / mL using methanol. Then dilute the stock solution with methanol to a series of standard solutions with concentrations of 0.1, 0.20, 0.5, 1, 2, and 5 μg / mL.

[0099] (1.3) Sample extraction

[0100] About 0.1 g sample (0.1 g of PHB empty vector transformed Cymbidium petals, three biological replicates; 0.1 g of PHB-CCD4 vector transformed Cymbidium petals, three biological replicates) was precisely weighed in a centrifuge tube, 1 mL of methanol was added, and the sample was ultrasonicated in an ice bath for 30 min. Then, the sample was centrifuged at 12,000 rpm at 4°C for 10 min, and the supernatant was filtered and then determined by HPLC.

[0101] (1.4) Chromatographic conditions

[0102] Inlet temperature: 250°C;

[0103] Carrier gas: helium, flow rate: 1.2 mL / min;

[0104] Injection volume: 1 μL;

[0105] Purge flow: 5 mL / min;

[0106] Table 8 Temperature programming

[0107] ;

[0108] (1.5) Mass spectrometry parameters

[0109] Mass spectrometry conditions:

[0110] The ionization mode was electron impact ion source: EI source;

[0111] Transfer line temperature 250°C;

[0112] Ion source temperature 250°C;

[0113] Table 9 Ion parameters for qualitative and quantitative determination of ionone

[0114] ;

[0115] (1.6) Data analysis

[0116] The results show that the transient expression of PHB-CCD4 in Cymbidium petals CsCCD4 Compared with the control containing only empty vector, the accumulation of (E)-β-ionone increased by 1.44 ± 0.03 times (n = 3; P < 0.001), and the peak value reached 30.69 μg·g -1 ·DW( Figure 6 ).

[0117] Example 5 Stable transformation of Nicotiana plumbaginifolia

[0118] 1. Tobacco aseptic seedling culture

[0119] Tobacco seeds were placed in 1.5 mL centrifuge tubes, 50% 84 disinfectant solution was added to the centrifuge tubes, the seeds were fully contacted with the disinfectant solution by turning up and down, and sterilization treatment was performed for 10 min, then in the clean bench, the sterile tobacco seeds were sowed on the MS solid medium in bottles, one tobacco seed was sowed in each bottle, and the sowed culture bottles were placed in a light incubator with a temperature of 25°C and a light cycle of 16 h / 8 h (light / dark) for culture.

[0120] 2. Preparation and pre-culture of explants

[0121] Healthy tobacco aseptic seedlings grown for 60-70 days were prepared, and a green leaf close to the top of the plant, fully unfolded, large and thick in texture was selected, the leaf was laid flat on sterile filter paper, the leaf was fixed with a forceps, the edges and veins of the leaf were cut off with a blade, and then the leaf was cut into a square of 5 mm × 5 mm and placed on the pre-culture medium for pre-culture for 3-4 days under light / dark 16 / 8 h.

[0122] 3. Preparation of Agrobacterium

[0123] Agrobacterium containing the expression vector of the target gene was inoculated into the corresponding resistant solid medium, and inverted culture was performed in a 28°C incubator for 3 days, then single colonies were picked into 1 mL of resistant liquid LB medium, and culture was performed in a 28°C constant temperature shaker at a speed of 200 rpm for 24-48 h, when the bacterial solution was well shaken, the small shaken bacterial solution was added to 50 mL of resistant liquid LB medium at a ratio of 1:100, and culture was performed in a 28°C constant temperature shaker at a speed of 200 rpm, and the OD value of the bacterial solution was about 0.6 after culture, and the bacterial solution was ready for use. 600

[0124] 4. Preparation of infection solution

[0125] The Agrobacterium bacterial solution with an OD value was centrifuged at 5000 rpm for 5 min, the supernatant was discarded in the clean bench, and tobacco infection solution was added to resuspend the bacterial cells, then the bacterial cells were centrifuged at 5000 rpm for 10 min, and the bacterial cells were suspended in the infection solution, and the OD value of the bacterial solution was between 0.4 and 0.6, ready for use. 600

[0126] 5. Infection and co-culture

[0127] ​​Take 50 mL of prepared infectious bacteria solution in a flask, put the cut tobacco leaves into it, shake to make the bacteria solution and the leaves fully contact, infect for 8-10 min, shake the flask several times during the period, then use tweezers to take out the leaves and place them on sterile filter paper, absorb the bacteria solution on the surface of the leaves, inoculate on the co-culture medium, and cultivate at 25°C in a light / dark 16 / 8 h culture room for 2-3 days.

[0128] 6. Screening culture

[0129] (1) Take the leaves from the co-culture medium, wash them three times in sterile water, then soak them in 200 mg / L Timetin water for 2 min, if the washing liquid is turbid, repeat the step 2-3 times until the liquid is clear, then absorb the water on the surface of the leaves with sterile filter paper, inoculate on the primary screening medium for 1-2 weeks, 10-14 pieces per dish;

[0130] (2) After primary screening, change to secondary screening medium, 4-5 explants per dish, cultivate at 25°C, subculture every 2 weeks during the period until buds are regenerated;

[0131] (3) At this time, cut the regenerated buds and place them on seedling screening medium for about a week.

[0132] 7. Rooting culture

[0133] When the small buds grow to more than 1 cm, cut off the callus at the base of the bud and transfer it to the rooting medium containing antibiotics for culture.

[0134] 8. Extraction of transgenic seedling genomic DNA

[0135] Refer to the extraction of DNA in Magen RaPure Plant DNA Mini Kit instruction manual:

[0136] (1) Grind the plant sample into powder with liquid nitrogen, transfer 50-150 mg of fresh / frozen sample or 15-40 mg of dry sample to a 2 mL centrifuge tube.

[0137] (2) Immediately add 700 μL of preheated Buffer PAL to the sample, vortex the sample vigorously to disperse it thoroughly, incubate at 65°C for 20 min, mix 2-3 times during the period.

[0138] (3) Add 700 μL of Buffer BDP to the sample, vortex for 15 s.

[0139] (4) At room temperature, centrifuge at 12,000 x g for 5 min, carefully transfer the supernatant to a new centrifuge tube.

[0140] (5) Add 700 μL Buffer GWP to the supernatant, invert to mix 10-15 times.

[0141] (6) Place the DNA column in a collection tube, transfer half the volume of the mixture to the column. Centrifuge at 12,000 x g for 60 s.

[0142] (7) Discard the flow-through, place the column in a collection tube, transfer the remaining mixture to the column. Centrifuge at 12,000 x g for 60 s.

[0143] (8) Discard the flow-through, place the column in a collection tube, add 500 μL Buffer PW1 to the column. Centrifuge at 12,000 x g for 60 s.

[0144] (9) Discard the flow-through, place the column in a collection tube, add 500 μL Buffer PW2 to the column. Centrifuge at 12,000 x g for 60 s.

[0145] (10) (Optional) Discard the flow-through, place the column in a collection tube, add 500 μL Buffer PW2 to the column. Centrifuge at 12,000 x g for 60 s.

[0146] (11) Discard the flow-through, place the column in a collection tube. Centrifuge at 12,000 x g for 2 min to remove residual ethanol from the column.

[0147] (12) Transfer the column to a new 1.5 mL microcentrifuge tube, add 40-75 μL of preheated to 65ºC Buffer AE to the center of the membrane. Let stand at room temperature for 2 min, centrifuge at 12,000 x g for 1 min.

[0148] (13) (Optional) Add an additional 40-75 μL of preheated to 65ºC Buffer AE to the center of the membrane. Let stand for 2 min. Centrifuge at 12,000 x g for 1 min.

[0149] (14) Discard the DNA binding column, store the DNA at -20ºC.

[0150] 9. PCR identification

[0151] PCR identification was performed on the transgenic seedlings obtained according to the following PCR amplification system, and the results showed that the 9 transgenic tobacco plants tested were all positive (Table 4). Figure 7 ).

[0152] Table 10 PCR system and amplification system

[0153] ;

[0154] Table 11 Reaction procedure

[0155] ;

[0156] 10. Determination of β-ionone content in stably transformed N. plumbaginifolia

[0157] (1) Instruments

[0158] Electronic balance (mL-204, METTLER-TOLEDO, USA)

[0159] Gas chromatograph-mass spectrometer (Thermo Trace 1300 / ISQ7000, ThermoFisher, USA)

[0160] Rotary mixer (VORTEX-5, Kylin-Bell, China)

[0161] Sample processing

[0162] Weigh 5 g of sample (5 g of whole flowers of N. plumbaginifolia transformed with PHB empty vector, three biological replicates; 5 g of whole flowers of N. plumbaginifolia transformed with PHB-CCD4 vector, three biological replicates), add 2 g of sodium chloride, add 10 mL of pure water into a headspace bottle, equilibrate in a water bath at 60°C for 60 min in an electric thermostatic stirrer, and finally insert the extraction head into the GC-MS injector for desorption.

[0163] GC-MS operation

[0164] After the sample extraction is completed, quickly insert the extraction head into the gas chromatograph-mass spectrometer (GC-MS) inlet.

[0165] GC conditions:

[0166] Chromatographic column: TG-5MS (30 m x 0.25 mm x 0.25 um);

[0167] Temperature program: initial temperature 60°C, hold for 1 min, increase to 160°C at a rate of 3°C / min, and then increase to 230°C at a rate of 20°C / min.

[0168] Inlet temperature: 250°C;

[0169] Carrier gas: high-purity helium, purity 99.99%;

[0170] Flow rate: 1.0 mL / min, no split in injection.

[0171] MS conditions:

[0172] Ionization mode EI, mass detector in 70 v electron collision mode, ion source temperature is 230 ℃.

[0173] Data analysis

[0174] The content of (E)-β-ionone in transgenic tobacco flowers was significantly increased by 5.81 ± 0.29 folds (P < 0.01; n = 3) compared with the control containing empty vector only, and the highest content reached 2.69 μg·g -1 · DW ( Figure 8 ).

[0175] The above specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the present application. It should be understood that the above description is only a specific embodiment of the present application and is not intended to limit the protection scope of the present application. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A plant of the species Iris domestica CsCCD4 gene, characterized in that, The CsCCD4 The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. An ink lake according to claim 1 CsCCD4 gene, characterized in that, The CsCCD4 The amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO.

2.

3. An ink comprising the melanin of claim 1 CsCCD4 An expression vector containing the gene of claim 1, characterized in that, The starting vector of the expression vector is a binary vector that can be used for Agrobacterium transformation of plants or a vector that can be used for plant microprojectile bombardment.

4. The expression vector of claim 3, wherein, The starting vector is a pOCA30 vector or a PHB vector.

5. A recombinant Agrobacterium containing the expression vector of claim 3, wherein, The Agrobacterium is a GV3101 strain.

6. An ink lake as claimed in claim 1 CsCCD4 application of the gene in enhancing aroma synthesis in plants, characterized in that, The plant is selected from Phalaenopsis or Nicotiana plumbaginifolia, and the application comprises the following steps: (1) constructing a recombinant expression vector containing a gene as shown in SEQ ID NO. 1 CsCCD4 gene; (2) transforming the recombinant expression vector obtained in step (1) into Agrobacterium to obtain recombinant Agrobacterium; (3) transiently transforming the recombinant Agrobacterium into Phalaenopsis petals or stably transforming the recombinant Agrobacterium into Nicotiana plumbaginifolia; (4) collecting the petals of the transiently transformed Phalaenopsis for GC-MS aroma substance determination after the transiently transformed plant grows normally for 5 days; or collecting the petals of the stably transformed Nicotiana plumbaginifolia for GC-MS aroma substance determination after the stably transformed plant grows normally and flowers for 2 days.

7. Use according to claim 6, characterized in that, The starting vector of the recombinant expression vector in step (1) is a pOCA30 plasmid.

8. Use according to claim 6, characterized in that, The Agrobacterium in step (2) is a GV3101 strain.