Use of glyma.06g319700 gene in modulating soybean cyst nematode resistance

By mining and utilizing the Glyma.06G319700 gene, the problem of loss of resistance to soybean cyst nematode was solved by regulating soybean resistance through overexpression or silencing, thus achieving high resistance improvement in soybean varieties.

CN121182879BActive Publication Date: 2026-04-28INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511591092.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-03
Publication Date
2026-04-28
Estimated Expiration
2045-11-03

AI Technical Summary

Technical Problem

In existing technologies, soybean cyst nematode disease causes severe yield losses, and continuous planting of a single resistant variety leads to the gradual loss of resistance. There is a lack of effective genetic resources and molecular mechanism research.

Method used

The Glyma.06G319700 gene was discovered and utilized. By overexpressing or silencing this gene, the resistance of soybean to cyst nematodes was increased or decreased. Genetic transformation was carried out using Agrobacterium rhizogenes-mediated hairy root transformation technology.

Benefits of technology

Significantly reducing or increasing soybean resistance to cyst nematodes provides new genetic resources and technical support, offering theoretical support for soybean variety improvement and high-resistance breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121182879B_ABST
    Figure CN121182879B_ABST
Patent Text Reader

Abstract

The application discloses application of a Glyma.06G319700 gene in regulation of soybean cyst nematode resistance and belongs to the technical field of genetic engineering. The CDS sequence of the Glyma.06G319700 gene is shown as SEQ ID NO. 3. The application mines the gene Glyma.06G319700 related to soybean cyst nematode 3 physiological race resistance. It is confirmed that overexpression of the gene can significantly reduce the cyst number on soybean hairy roots and improve the soybean cyst nematode resistance, thereby providing theoretical support for soybean disease resistance mechanism research and providing new gene resources and technical support for soybean trait improvement and high-resistance soybean breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of the Glyma.06G319700 gene in regulating soybean cyst nematode resistance. Background Technology

[0002] Soybean cyst nematode disease, caused by the soybean cyst nematode (SCN), is a devastating disease that severely impacts soybean yields in soybean-producing regions worldwide. This pathogen is characterized by its wide distribution, diverse transmission routes, and numerous host species. Once the disease occurs, it often results in significant yield and economic losses. Practical experience shows that the most economical, safe, and effective method currently remains planting soybean varieties resistant to cyst nematodes.

[0003] However, soybean cyst nematodes exist in multiple physiological race populations in the field. Continuous planting of a single type of resistant variety may lead to a shift in the toxicity of the dominant soybean cyst nematode population, resulting in the gradual loss of resistance in existing resistant varieties. Therefore, discovering new cyst nematode-resistant genes and using genetic engineering techniques to create high-quality new soybean cyst nematode-resistant varieties has become an important research direction for the integrated management of soybean cyst nematode diseases.

[0004] Although several soybean nematode resistance genes have been identified, research on the molecular mechanisms of soybean resistance to SCN is still relatively scarce. In particular, the functions and applications of many genes associated with soybean cyst nematode resistance are not yet fully understood, and many genes with potential applications remain to be discovered and developed. Therefore, further research and application of genes regulating soybean cyst nematode resistance are of significant theoretical and practical value for breeding new soybean varieties with durable resistance, ensuring soybean yield and quality, and promoting the sustainable development of the soybean industry. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the Glyma.06G319700 gene in regulating soybean cyst nematode resistance, thereby addressing the problems existing in the prior art. This invention identifies the gene Glyma.06G319700, which is associated with resistance to soybean cyst nematode race 3. It has been confirmed that overexpression of this gene can significantly reduce the number of cysts on soybean hairy roots and improve soybean cyst nematode resistance, providing theoretical support for research on soybean insect resistance mechanisms and offering new gene resources and technical support for soybean trait improvement and breeding of highly resistant soybean varieties.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides the application of the Glyma.06G319700 gene in regulating soybean cyst nematode resistance, and the CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3;

[0008] The regulation of soybean cyst nematode resistance refers to increasing soybean cyst nematode resistance by overexpressing the Glyma.06G319700 gene; or decreasing soybean cyst nematode resistance by silencing the Glyma.06G319700 gene.

[0009] The present invention also provides an application of a recombinant vector in regulating soybean cyst nematode resistance, wherein the recombinant vector includes a recombinant vector overexpressing the Glyma.06G319700 gene and a recombinant vector silencing the Glyma.06G319700 gene;

[0010] The CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3;

[0011] The regulation of soybean cyst nematode resistance refers to increasing soybean cyst nematode resistance by overexpressing the Glyma.06G319700 gene; or decreasing soybean cyst nematode resistance by silencing the Glyma.06G319700 gene.

[0012] The initial vector for the recombinant vector is either the pSM101-3HA vector or the pG2RNAi1 vector.

[0013] This invention also provides the application of recombinant microorganisms in regulating soybean cyst nematode resistance, wherein the recombinant microorganisms include recombinant microorganisms that overexpress the Glyma.06G319700 gene and recombinant microorganisms that silence the Glyma.06G319700 gene;

[0014] The CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3;

[0015] The regulation of soybean cyst nematode resistance refers to increasing soybean cyst nematode resistance by overexpressing the Glyma.06G319700 gene; or decreasing soybean cyst nematode resistance by silencing the Glyma.06G319700 gene.

[0016] The present invention also provides the application of overexpression of the Glyma.06G319700 gene in the breeding of soybean varieties with high resistance to cyst nematodes, wherein the CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3.

[0017] The present invention also provides the application of a recombinant vector containing the Glyma.06G319700 gene in the breeding of soybean varieties with high resistance to cyst nematodes, wherein the CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3.

[0018] The initial vector for the recombinant vector is either the pSM101-3HA vector or the pG2RNAi1 vector.

[0019] The present invention also provides the application of recombinant microorganisms containing the Glyma.06G319700 gene in the breeding of soybean varieties with high resistance to cyst nematodes, wherein the CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3.

[0020] Optionally, the cyst nematode includes soybean cyst nematode race 3.

[0021] The present invention also provides a method for improving soybean cyst nematode resistance, comprising the step of using genetic transformation technology to transfer the Glyma.06G319700 gene into soybean and stably overexpress it, thereby improving soybean cyst nematode resistance;

[0022] The CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3.

[0023] The present invention also provides a method for breeding soybean varieties with high resistance to cyst nematodes, comprising the steps of using genetic transformation technology to transfer the Glyma.06G319700 gene into soybeans and stably overexpressing it to obtain the soybean variety with high resistance to cyst nematodes;

[0024] The CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3.

[0025] Optionally, the cyst nematode includes soybean cyst nematode race 3.

[0026] The present invention discloses the following technical effects:

[0027] This invention utilizes Agrobacterium rhizogenes-mediated hairy root transformation technology to overexpress and silencing the soybean Glyma.06G319700 gene. Results showed that the number of sporangia formed by positive hairy roots overexpressing Glyma.06G319700 was significantly reduced, while the number of sporangia formed by positive hairy roots with the gene silenced was significantly increased, confirming that Glyma.06G319700 plays an important role in soybean cyst nematode infection. This invention also developed the Glyma.06G319700 resistance gene for soybean cyst nematode race 3, providing theoretical support for research on soybean insect resistance mechanisms and offering new gene resources and technical support for soybean trait improvement and breeding of highly resistant soybean varieties. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0029] Figure 1 The diagram shows the construction process of the soybean hairy root transformation system; where a is seed disinfection, b is explant removal, c is Agrobacterium inoculation and co-culture, d is callus production, e is root formation, f is nematode inoculation, g is GFP fluorescence detection results (scale bar is 2 mm), and h is sporangium morphology on hairy roots.

[0030] Figure 2 The statistical results of the number of SCN sporangia in hairy roots overexpressing Glyma.06G319700 (a) and gene expression (b).

[0031] Figure 3 The statistical results of the number of SCN sporangia in the hairy roots of silenced Glyma.06G319700 (a) and gene expression (b). Detailed Implementation

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0034] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0035] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0036] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0037] The primer sequences used in the following examples are as follows:

[0038] Glyma.06G319700 gene F: ATGAATCTGTACCACTCCTCCACCA (SEQ ID NO.1);

[0039] Glyma.06G319700 gene R: TTATGCTTTGTTGCAGGGTGG (SEQ ID NO.2);

[0040] Glyma.06G319700 gene CDS sequence:

[0041]

[0042] G6JF: attgttgactcgacagtcgacATGAATCTGTACCACTCCTCCAC (SEQ ID NO.4);

[0043] G6JR: cggggaaattcgagcggatccTTATGCTTTGTTGCAGGGTGG (SEQ ID NO.5);

[0044] q61F: GCACCCGGGTCCAAAGATTA (SEQ ID NO.6);

[0045] q61R:TCGGGTAAGGTTACCGATGT (SEQ ID NO.7);

[0046] 6i1JR: gagagtgagattaccatttaaatGCACCCGGGTCCAAAGATTA (SEQ ID NO. 8);

[0047] 6i1JF: gacagcggccgcaccggcgcgccTCGGGTAAGGTTACCGATGT (SEQ ID NO.9);

[0048] 6r1JR: gccataatactcgaacctaggTCGGGTAAGGTTACCGATGT (SEQ ID NO. 10);

[0049] 6r1JF: tgaacatgtgtagatggatccGCACCCGGGTCCAAAGATTA (SEQ ID NO. 11).

[0050] The silencing vector pG2RNAi1 and the overexpression vector pSM101-3HA of the present invention are both disclosed in the literature "[1] Zhu Qun, Guo Xiaoli, Zhang Lei. GmMYB15 positively regulates the resistance of soybean to soybean cyst nematode [J]. Plant Protection, 2024, 50(06):42-50. DOI:10.16688 / j.zwbh.2024186."

[0051] Example 1

[0052] 1. Acquisition of cDNA from TZX1011 soybean

[0053] (1) Sample processing: Take 50-100 mg of soybean tissue and put it into a 1.5 ml centrifuge tube. Add 1 mg of Trizol and homogenize thoroughly. Let stand at room temperature for 5 min.

[0054] (2) Add 0.2 ml of chloroform, shake for 15 s, and let stand for 2 min;

[0055] (3) Centrifuge at 4℃, 12000×g, for 15 min, and collect the supernatant;

[0056] (4) Add 0.5 mL of isopropanol to the tube, mix by inverting the tube, and let stand at room temperature for 10 min.

[0057] (5) Centrifuge at 4℃, 12000×g, for 10 min, and discard the supernatant;

[0058] (6) Add 1 mL of 75% ethanol, gently wash the precipitate, 4℃, 7500 × g, 5 min, and discard the supernatant;

[0059] (7) Dry it and add an appropriate amount of DEPC H2O to dissolve it (promote dissolution at 65℃ for 10-15 min).

[0060] cDNA was obtained by reverse transcription using the Novizan HiScript IV All-in-One Ultra RT SuperMix for qPCR (R433-01).

[0061] 2. Glyma.06G319700 gene amplification

[0062] Primers were designed using Snapgene, and the CDS sequence of the Glyma.06G319700 gene was amplified using the cDNA of TZX1011 as a template, following the reaction system shown in Table 1 and the reaction procedure described below. The forward and reverse primer sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively. After verification by agarose gel electrophoresis, the amplified products were sent to the company for sequencing, and the sequencing results are shown in SEQ ID NO. 3.

[0063] Table 1 PCR reaction system

[0064]

[0065] The reaction program was as follows: 98℃ for 5 min; 98℃ for 10 s, 55℃ for 5 s, 72℃ for 10 s, 35 cycles; 72℃ for 7 min.

[0066] 3. Construction of Glyma.06G319700 gene overexpression vector and RNAi vector

[0067] 3.1 Construction of overexpression vectors

[0068] When constructing the vector using the In-Fusion seamless cloning method, a homologous arm of 15-20 bp, identical to that of the linearized vector, needs to be added to the primers. The CDS sequence amplified in step 2 was PCR amplified using primers shown in SEQ ID NO.4 and SEQ ID NO.5 to obtain the target fragment. The vector was linearized using a double enzyme digestion method (BamHI and SalI), the digestion system is shown in Table 2, and the digestion reaction program was: 37℃ water bath for 3 h. After gel recovery, the linearized vector was used for seamless cloning. The recombinant vector was constructed using the CloneExpress® II One Step Cloning Kit from Nanjing Novizan Biotechnology Co., Ltd. The recombinant vector construction system is shown in Table 3, and the vector was incubated at 37℃ for 30 min, followed immediately by cooling to 4℃.

[0069] Table 2 Enzyme digestion system

[0070]

[0071] Table 3 Recombinant Vector Construction System

[0072]

[0073] 3.2 Construction of RNAi vectors

[0074] When constructing RNAi vectors using the In-Fusion seamless cloning method, the CDS sequence amplified in step 2 was used as a template to design specific primers to amplify the sense and antisense fragments. Homologous arms containing the vector's restriction enzyme sites were added to both ends of the fragments. The primer sequences are shown in SEQ ID NO. 8-11. The pG2RNAi1 vector was subjected to two double digestions, and then the target fragments were ligated forward and reverse into the linearized vector. The specific digestion systems are shown in Tables 4 and 5.

[0075] Table 4 First Enzyme Digestion System

[0076]

[0077] The target positive fragment (obtained from SEQ ID NO. 8-9 amplification) was ligated in the forward direction into the linearized vector after the first enzyme digestion, and sequenced for verification. After successful verification, proceed to the next step according to Table 5.

[0078] Table 5 Second Enzyme Digestion System

[0079]

[0080] The target antisense fragment (obtained by amplification of SEQ ID NO.10-11) was ligated in the forward direction into the linearized vector after the second enzyme digestion, and then sequenced for verification.

[0081] 4. Genetic transformation of Agrobacterium rhizogenes

[0082] (1) Add 0.01-1 µg of recombinant vector or blank vector to every 100 µL of competent Agrobacterium rhizogenes K599 bacterial culture (it is recommended to conduct a preliminary experiment for the first experiment to determine the optimal amount of plasmid). When adding, gently invert and mix or repeatedly pipette the mixture to ensure that the DNA is in full contact with the bacterial cells;

[0083] (2) Place the mixture on ice immediately and let it stand for 5 minutes to allow the DNA to come into full contact with the bacterial membrane, thus preparing for subsequent transformation;

[0084] (3) Then briefly transfer the sample into liquid nitrogen and let it stand for 5 minutes, and then quickly transfer the sample to a 37°C water bath for heat shock for 5 minutes.

[0085] (4) Add 700µL of antibiotic-free LB culture medium to the treated bacterial culture, and then incubate at 28℃ on a shaker for 2 hours. During this period, set the rotation speed to 4000rpm and gently shake once every 1 minute to keep the bacterial culture uniform. After the culture is completed, take 100µL of the recovery medium for plate culture.

[0086] (5) Place the plate samples on a suitable culture medium and incubate for 2 to 3 days to observe the formation of positive clones. Then, perform PCR detection on the selected colonies to confirm whether the plasmid transformation was successful, and then freeze the correct strains with glycerol.

[0087] 5. Transformation of soybean hairy roots and RT-PCR

[0088] (1) Seed disinfection Figure 1 a):

[0089] 1) Spread the seeds in a single layer in a petri dish, and place the petri dish filled with soybean seeds in the desiccator inside a fume hood;

[0090] 2) Place a 250 mL beaker inside the desiccator and pour 200 mL of sodium hypochlorite into the beaker;

[0091] 3) Add 3-4 mL of concentrated HCl to the beaker, quickly turn off the desiccator, and let it stand for 18-20 hours;

[0092] 4) Open the desiccator lid, cover the petri dish, place the petri dish on the sterile operating table, open the lid and blow air for 15 minutes to remove chlorine. After completely removing the chlorine in the fume hood, pour out the waste liquid.

[0093] (2) Seed germination:

[0094] 1) Prepare 1 / 4 Gamborh's W / O Sugar Solid medium for seed germination (using a 100×20mm petri dish);

[0095] 2) Using sterile tweezers, transfer the seeds to the culture medium, 8-9 seeds per petri dish, and gently press them into the culture medium to prevent them from rolling around.

[0096] 3) Cover the petri dish with sealing film and place it in an incubator at 25-26℃ with 16 hours of light and 8 hours of darkness;

[0097] 4) Seeds germinate in 7-9 days.

[0098] (3) Activation of Agrobacterium rhizogenes:

[0099] 1) Four days before explant removal, activate the transformed Agrobacterium rhizogenes K599 on LB medium with appropriate antibiotics and incubate at 28°C for 2 days;

[0100] 2) After 2 days, select 3-5 clones and put them into 1 mL of LB liquid medium with the corresponding antibiotic. Incubate overnight at 28°C with shaking. Then, take 300 µL to 50 mL and add it into LB liquid medium with the corresponding antibiotic. Incubate overnight at 28°C.

[0101] 3) During transformation, strains that tested correctly by PCR were preserved in glycerol. The culture medium was transferred to a sterile 50 mL centrifuge tube and centrifuged at 4,000 rpm for 10 min to precipitate the bacterial cells; the precipitate was pale pink.

[0102] 4) Resuspend the precipitate in 50 mL of 1 / 4 Gamborg's W / O Sugar liquid medium;

[0103] 5) Take 1.5-2 mL of the suspension and measure the OD. 600 The OD value should be 0.2-0.3.

[0104] (4) Explant excision, inoculation, and co-culture ( Figure 1 (bc)

[0105] 1) 7-9 days after soybean seeds germinate, cut off the cotyledon portion close to the stem in a clean bench and place it in a covered petri dish. If necessary, remove the seed coat.

[0106] 2) Place the cut cotyledons in an Agrobacterium solution with the OD value adjusted, and soak for 2 hours, shaking occasionally during the process;

[0107] 3) Using sterile forceps, transfer the cotyledons into 1-2 sterile, pre-moistened 3 mm Whatman Chromatography Paper culture dishes, with a maximum of 36 cotyledons per dish. The Whatman Paper should be pre-moistened with 1 / 4 Gamborg's W / O Sucrose Liquid Media to prevent drying. If the paper is too wet or liquid accumulates after tilting the culture dish, use a sterile pipette tip to aspirate the excess liquid.

[0108] 4) Seal the petri dish with two layers of sealing film to prevent it from drying out, and place the petri dish in a light incubator (16 h light, 8 h darkness, 26℃) for a total of 3 days.

[0109] (5) Callus formation ( Figure 1 d):

[0110] 1) After 3 days, aseptically transfer the cotyledons from the filter paper to a deep petri dish. Add 100 mL of 1 / 4 Gamborg's W / O Sugar containing Timentin (238 µg / mL), soak in the dish for 1 h, and repeat 3 times.

[0111] 2) Use sterile forceps to transfer the cotyledons from the liquid to MXB medium containing Timentin. Do not place the cut side towards the medium or in close contact with the petri dish lid.

[0112] 3) Seal the petri dish with sealing film and incubate it in the growth incubator (16 h light, 8 h dark, 25-26℃).

[0113] 4) Callus formation should be observed after 5 days, and obvious callus should be visible 7-14 days after inoculation;

[0114] 5) Numerous hair-like roots will appear on the callus tissue 14-21 days after inoculation.

[0115] (6) The formation of hair roots ( Figure 1 e):

[0116] 1) After 14-21 days, separate and transfer the hair roots, which are at least 1 cm long, from the cotyledons.

[0117] 2) Transfer the detached roots to MXB medium (gently press the root tips to the surface of the medium), arrange the roots in 2 rows with 12-18 roots in each row, seal with sealing film and incubate in the dark at 26°C;

[0118] 3) After cutting the roots off the cotyledons, remove excess roots (some dried or not intended for propagation) from the callus surface and return the petri dish to the incubator. Removing these roots will induce more root growth; this can be done multiple times.

[0119] 4) After 3 days, the roots produced from the root tips were transferred to new MXB medium and arranged in two rows with 12-18 roots in each row.

[0120] 5) Repeat step 4 twice;

[0121] 6) Growth in the same culture medium is not conducive to the propagation of root tips, so the roots need to be transferred to a new MXB medium every 2-3 weeks;

[0122] 7) By observing the expression of the reporter gene (GFP gene) on the vector in hairy roots, it was determined whether the recombinant vector was expressed in hairy roots. The GFP fluorescence observation results in the soybean hairy root Glyma.06G319700 overexpression system are shown in [reference needed]. Figure 1 The expression of the Glyma.06G319700 gene successfully expressed by the recombinant vector in hair roots was detected using qRT-PCR. Primer sequences are shown in SEQ ID NO.6 and SEQ ID NO.7. The reaction system is shown in Table 6, and the reaction procedure is shown in Table 7. Results are shown below. Figure 2 b and Figure 3 In step b, after transformation with the overexpression vector, the expression level of Glyma.06G319700 in positive hairy roots was significantly increased compared to the control group transfected with the blank vector; after transformation with the RNAi vector, the expression level of Glyma.06G319700 in positive hairy roots decreased by 60% compared to the control group. This indicates that the Glyma.06G319700 overexpression system and the Glyma.06G319700 silencing system in soybean hairy roots were successfully constructed.

[0123] Table 6 Reaction System

[0124]

[0125] Table 7 Reaction Procedure

[0126]

[0127] (7) Nematode hatching:

[0128] Place the collected clean sporangia in a glass petri dish, add an appropriate amount of 3 mM ZnCl2 solution to submerge the sporangia, and incubate in a 28℃ constant temperature incubator under dark conditions. Filter and collect the hatched J2s suspension daily, rinsing several times with water to ensure the collection of as many J2s as possible. Store in a 4℃ refrigerator. Add an appropriate amount of ZnCl2 solution to the petri dish and continue incubation until enough J2s have been collected, then stop incubation.

[0129] (8) Surface disinfection of nematodes:

[0130] 1) Collect a sufficient number of J2s;

[0131] 2) Divide a sheet of kitchen paper into two, take one, fold it, cut off the excess, and put it into the funnel. Attach a plastic tube about 20 cm long to the bottom of the funnel and clamp it with a clip.

[0132] 3) Pour the nematode suspension into a funnel, let it stand for 48 hours in a relatively clean, dark environment, and then collect the filtrate.

[0133] 4) After centrifuging the collected nematode suspension at 4,000 rpm for 2 min, remove as much water as possible;

[0134] 5) Operate in a clean bench, wash the nematodes with ddH2O 2-3 times, and then dry them as much as possible;

[0135] 6) Add 3 mL of 0.1% Ampicillin and 0.5% Streptomycin respectively, mix thoroughly and sterilize for 20 min;

[0136] 7) After rinsing three times with ddH2O, blot dry as much water as possible, add 5mL of 0.5% Chlorhexidine and continue to mix and sterilize for 3 minutes;

[0137] 8) After washing three times with ddH2O, count the samples and adjust the concentration to 400-500 J2s per 20 μL.

[0138] (9) Inoculation with nematodes ( Figure 1 f):

[0139] 1) After three propagations at the root tip, it can be used for nematode infection;

[0140] 2) Transfer the roots propagated from root tips to new MXB culture dishes, with 2 roots in each dish, and let them grow for 1-2 days (root length 3-4cm). At the same time, prepare to hatch nematodes.

[0141] 3) Mark the infection area 1 cm away from the root tip on the back of the petri dish;

[0142] 4) Inoculate 20 μL of nematode suspension into the area about 1 cm above the root tip of each root. Be sure to mix the nematode suspension well and change the nozzle frequently.

[0143] 5) Seal the petri dish with sealing film and mark the inoculation time. Place the petri dish horizontally in a 26℃ incubator for dark incubation. Count the number of SCN sporangia on each hairy root 30 days after inoculation. The morphology of sporangia on the hairy roots is as follows: Figure 1 As shown in h, the statistical results of the number of sporangia are shown in [the table]. Figure 2 a and Figure 3 a.

[0144] The results showed that the average number of sporangia formed by transgenic positive hairy roots overexpressing Glyma.06G319700 after inoculation with nematodes was 4, significantly lower than the average of 12.4 sporangia formed by positive hairy roots transformed with blank vector. After silencing Glyma.06G319700, the number of sporangia formed by positive hairy roots was 14.9, significantly higher than the average of 6.6 sporangia formed by the control group. These results indicate that overexpression of Glyma.06G319700 enhances soybean resistance to SCN 3, while silencing this gene reduces soybean resistance to SCN 3. This reveals that Glyma.06G319700 plays an important role in the infection of soybean by SCN 3. Targeting the Glyma.06G319700 gene can improve soybean resistance and facilitate the development of new soybean varieties resistant to SCN 3.

[0145] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of the Glyma.06G319700 gene in regulating soybean resistance to cyst nematodes, characterized in that, The CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3; The regulation of soybean resistance to cyst nematodes refers to increasing soybean resistance to cyst nematodes by overexpressing the Glyma.06G319700 gene in soybean; or decreasing soybean resistance to cyst nematodes by silencing the Glyma.06G319700 gene in soybean. The cyst nematode is the third physiological race of soybean cyst nematode.

2. The application of a recombinant vector in regulating soybean resistance to cyst nematodes, characterized in that, The recombinant vector is a recombinant vector that overexpresses the Glyma.06G319700 gene or a recombinant vector that silences the Glyma.06G319700 gene. The CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3; The regulation of soybean resistance to cyst nematodes refers to increasing soybean resistance to cyst nematodes by overexpressing the Glyma.06G319700 gene in soybean; or decreasing soybean resistance to cyst nematodes by silencing the Glyma.06G319700 gene in soybean. The cyst nematode is the third physiological race of soybean cyst nematode.

3. The application of a recombinant microorganism in regulating soybean resistance to cyst nematodes, characterized in that, The recombinant microorganism is either a recombinant microorganism overexpressing the Glyma.06G319700 gene or a recombinant microorganism silencing the Glyma.06G319700 gene; The CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3; The regulation of soybean resistance to cyst nematodes refers to increasing soybean resistance to cyst nematodes by overexpressing the Glyma.06G319700 gene in soybean; or decreasing soybean resistance to cyst nematodes by silencing the Glyma.06G319700 gene in soybean. The cyst nematode is the third physiological race of soybean cyst nematode.

4. The application of overexpression of the Glyma.06G319700 gene in breeding soybean varieties highly resistant to cyst nematodes, characterized in that, The CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3; The cyst nematode is the third physiological race of soybean cyst nematode.

5. The application of a recombinant vector containing the Glyma.06G319700 gene in the breeding of soybean varieties highly resistant to cyst nematodes, characterized in that, The CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3; The cyst nematode is the third physiological race of soybean cyst nematode.

6. The application of a recombinant microorganism containing the Glyma.06G319700 gene in the breeding of soybean varieties highly resistant to cyst nematodes, characterized in that, The CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3; The cyst nematode is the third physiological race of soybean cyst nematode.

7. A method for improving soybean resistance to cyst nematodes, characterized in that, This includes the steps of using genetic transformation technology to transfer the Glyma.06G319700 gene into soybeans and stably overexpress it, thereby improving the soybeans' resistance to cyst nematodes; The CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3; The cyst nematode is the third physiological race of soybean cyst nematode.

8. A method for breeding soybean varieties highly resistant to cyst nematodes, characterized in that, The process includes the steps of using genetic transformation technology to transfer the Glyma.06G319700 gene into soybean and stably overexpress it to obtain the soybean variety with high resistance to cyst nematodes. The CDS sequence of the Glyma.06G319700 gene is shown in SEQ ID NO.3; The cyst nematode is the third physiological race of soybean cyst nematode.

Citation Information

Patent Citations

  • Application of Glyma. 19G262700 protein in cultivation of soybean cyst nematode resistant plant

    CN116178515A

  • Streptomyces endophyte compositions and methods for improved agronomic traits in plants

    US20190059390A1