Triblock single-stranded nucleic acid, spherical nucleic acid probe, preparation and application thereof, and virus detection test strip

Abstract

The invention discloses a triblock single-stranded nucleic acid, a spherical nucleic acid probe, preparation and application thereof and a virus detection test strip. The three-block single-stranded nucleic acid sequentially comprises an assembly structural domain, a hybridization structural domain and a report structural domain of which the tail end is coupled with biotin, and the single-stranded nucleic acid is adsorbed on the surface of the nano particle and forms a complementary double-stranded structure with the hybridization DNA to obtain the spherical nucleic acid probe. The method for detecting the virus by using the spherical nucleic acid probe comprises the following steps: designing and synthesizing crRNA by using a target sequence; carrying out incubation on the crRNA and CRISPR nuclease to construct a binary complex; mixing to-be-detected target nucleic acid or an isothermal amplification product thereof, the spherical nucleic acid probe and the binary complex for reaction to obtain to-be-detected liquid; a to-be-detected solution is dropwise added to the test strip, and interpretation is performed according to the color development conditions of the test line and the quality control line. The CRISPR gene editing technology is combined to realize rapid test paper mode detection of nucleic acid, and a simple, convenient, rapid and effective detection method is provided for disease prevention and control.

Description

TECHNICAL FIELD

[0001] The present application relates to a probe and method for detecting viral target nucleic acid sequences based on single-stranded nucleic acid, in particular to a tri-block single-stranded nucleic acid, a spherical nucleic acid probe, preparation and application thereof, and a viral detection test strip. BACKGROUND

[0002] Rapid detection of biomarkers plays a vital role in the prevention, prognosis, and monitoring of diseases. Although significant progress has been made in laboratory-based standard methods (such as enzyme-linked immunosorbent assay, polymerase chain reaction), these methods often require a large amount of manpower and material resources, and need to go through multiple steps, which have the problems of long time-consuming and high cost. Therefore, there is an increasing demand for platforms that can sensitively, specifically, rapidly, and easily measure diagnostic biomarkers in natural environments. Lateral flow assays (LFAs) provide a rapid, low-cost, user-friendly method, and lateral flow-based test strips have been widely used in the fields of diagnosis, environmental and food safety, etc.

[0003] Currently, commercial test strips are mainly based on immune reactions, which utilize the specific binding of antibodies and antigens to form an antigen-antibody-colored particle complex, thereby observing the presence or absence of target proteins through the generation of color bands. However, biomarker protein-based detection still has the problem of low sensitivity. Nucleic acid detection for disease markers is more sensitive than protein detection, but current nucleic acid detection methods are mainly based on polymerase chain reaction (PCR) and rely on professional equipment and technical personnel, which limits the application of nucleic acid detection. Currently developed nucleic acid detection test strips still rely on nucleic acid amplification technology, and the detection time is relatively long. Therefore, there is an urgent need to develop test strip devices that can rapidly analyze nucleic acids.

[0004] The substrate cleavage reaction of CRISPR nuclease is mostly based on the free diffusion and collision of components in solution, and the cleavage kinetics is limited by the free diffusion and molecular collision speed of the Cas12a / crRNA / dsDNA ternary complex and the reporter probe, resulting in limited cleavage efficiency, cleavage rate and sensitivity. Gold nanoparticles have good fluorescence quenching effect, and the spherical nucleic acid (SNA) probe based on DNA-gold nanoparticle self-assembly has good biocompatibility. By modifying the cleavage substrate on the surface of gold nanoparticles, the enrichment of CRISPR cleavage substrate can be realized, and the reaction efficiency can be improved. However, the assembly process based on thiol-modified nucleic acid is complex, and it is difficult to control the assembly density of surface modification and the DNA reaction performance; the SNA probe based on double-block DNA self-assembly has poor stability and cannot withstand the high salt environment under the CRISPR cleavage condition. The existing test strip based on CRISPR gene editing still has the problem of long detection time, how to improve the efficiency of CRISPR gene editing and develop a new type of nano probe suitable for CRISPR gene editing system of test strip is crucial in the construction of nucleic acid rapid analysis test strip.

[0005] Chinese patent CN115896261A discloses a spherical nucleic acid based on double-block DNA probe and its preparation method and application. The spherical nucleic acid takes gold nanoparticles as a carrier, and double-block DNA probes are modified on the surface of the gold nanoparticles. This method does not rely on the participation of enzymes and releases reporter molecules in a fuel chain replacement mode, but the double-block DNA probe cannot adapt to the release of reporter molecules by nuclease cleavage. The main reason is that although the double-block DNA probe on the surface of the gold nanoparticles can hybridize with other short DNA chains, its configuration is not stretched enough, resulting in low cleavage efficiency of the double-block DNA probe by the nuclease, which cannot quickly cleave and release the reporter molecules on the DNA probe, and therefore cannot meet the demand of rapid detection. SUMMARY

[0006] The purpose of the present application is to provide a triple-block single-stranded nucleic acid to solve the problems of low cleavage efficiency of existing double-block nucleic acid by nuclease and poor stability of double-block nucleic acid. The second purpose of the present application is to provide a spherical nucleic acid probe containing a triple-block single-stranded nucleic acid to solve the problem that the existing spherical nucleic acid probe cannot adapt to the nuclease. The third purpose of the present application is to provide a preparation method of a spherical nucleic acid probe containing a triple-block single-stranded nucleic acid to solve the problem of how to prepare a spherical nucleic acid probe based on a triple-block single-stranded nucleic acid. The fourth purpose of the present application is to apply the spherical nucleic acid probe containing a triple-block single-stranded nucleic acid in virus detection to solve the problem of low cleavage efficiency, cleavage rate and sensitivity of the existing CRISPR nuclease cleavage detection method. The fifth purpose of the present application is to provide a virus detection test strip to solve the problem of visual detection of nucleic acid samples by the naked eye.

[0007] Technical solution: The trimeric single-stranded nucleic acid comprises, in sequence, an assembly domain for adsorbing on the surface of a carrier, a hybridization domain for forming a double-stranded structure, and a report domain, wherein the nucleic acid sequence of the report domain is cleaved to generate free biotin.

[0008] Preferably, the assembly domain is a PolyA sequence containing 5-100 adenines, the hybridization domain is a random sequence of 5-100 bases, and the report domain comprises a DNA sequence that can be cleaved by a nuclease, and the end of the DNA sequence is connected with biotin.

[0009] The lateral spacing of the report domain on the trimeric single-stranded nucleic acid can be adjusted by the length of the polyA, thereby enhancing the contact of the nuclease Cas12a with the report domain and adjusting the transcleavage activity. The end of the report domain is coupled with biotin as a reporter molecule, so that the trimeric single-stranded nucleic acid can be coupled with a test paper containing streptavidin for detection.

[0010] Preferably, the DNA sequence of the hybridization domain is shown in SEQ ID NO. 16, i.e. TGGTTGATTGTG; the DNA sequence of the report domain is shown in SEQ ID NO. 17, i.e. CCGATATCATATGTC; and the assembly domain is a PolyA sequence containing 20-40 adenines.

[0011] Preferably, the trimeric single-stranded nucleic acid comprises a DNA sequence shown in SEQ ID NO. 1, and the 3' end of the DNA sequence is connected with biotin.

[0012] The application further discloses a spherical nucleic acid probe comprising the above-mentioned trimeric single-stranded nucleic acid, and gold nanoparticles, wherein the trimeric single-stranded nucleic acid is adsorbed on the surface of the gold nanoparticles through the assembly domain, and the trimeric single-stranded nucleic acid forms a complementary double-stranded structure with hybridization DNA on the hybridization domain thereof.

[0013] Based on the double-stranded rigid scaffold formed by the hybridization domain and the hybridization DNA, the trimeric single-stranded nucleic acid on the surface of the gold nanoparticles has a more stretched configuration, so that the nuclease is more easily contacted with the report domain, the efficiency of cleaving the report domain is improved, the biotin is quickly released, and the detection result can be quickly and easily read by combining with streptavidin in the detection line of the test paper to produce a visualized strip change phenomenon. In addition, the trimeric single-stranded nucleic acid is more resistant to degradation and interference in actual complex samples, and is suitable for detection in complex environments and high salt concentrations.

[0014] In order to obtain the above-mentioned spherical nucleic acid probe comprising the trimeric single-stranded nucleic acid, the application provides a preparation method of the spherical nucleic acid probe, comprising the following steps:

[0015] (1) mixing the triblock single-stranded nucleic acid with gold nanoparticles, and incubating to obtain gold nanoparticles loaded with the triblock single-stranded nucleic acid by using a salt-aging method or a rapid assembly method;

[0016] (2) mixing the gold nanoparticles loaded with the triblock single-stranded nucleic acid with hybridization DNA, and performing a hybridization reaction to obtain a spherical nucleic acid probe.

[0017] The triblock single-stranded nucleic acid can be assembled on the surface of gold nanoparticles by various assembly methods, and the salt-aging method or the rapid assembly method is preferably used as the assembly method. In the salt-aging method, the triblock single-stranded nucleic acid is mixed with gold nanoparticles at a certain ratio, and is gently shaken at room temperature overnight. A 1M PBS (100mM PB, 1M NaCl, pH 7.4) solution is added in batches for multiple times, and the mixture is gently shaken at room temperature overnight. The excess triblock single-stranded nucleic acid is removed by centrifugation, and the obtained basic gold nanoparticle probe is stored in a 0.1M PBS solution. In the rapid assembly method, the triblock single-stranded nucleic acid is mixed with gold nanoparticles at a certain ratio, and is incubated at room temperature. Then, a trisodium citrate solution (pH 3) is added to the solution, and the mixture is left to stand at room temperature. After the addition of a PB solution, the excess triblock single-stranded nucleic acid is removed by centrifugation, and the obtained basic gold nanoparticle probe is stored in a 0.1M PBS solution.

[0018] Preferably, the molar ratio of the triblock single-stranded nucleic acid to gold nanoparticles is 100-300:1. The method of the hybridization reaction is as follows: the gold nanoparticles loaded with the triblock single-stranded nucleic acid are mixed with hybridization DNA in a buffer at a molar ratio of 1:5-100, and are hybridized at 36-38℃ for 10-90min. The unbound hybridization DNA is washed away to obtain the spherical nucleic acid probe. The buffer in the preparation method can be a phosphate buffer. The particle size of the gold nanoparticles is 5-200nm, and the sequence of the hybridization DNA is complementary to the hybridization domain.

[0019] In some embodiments, the sequence of the hybridization DNA is shown in SEQ ID NO. 2.

[0020] Compared with the freely diffusing probe, the spherical nucleic acid probe has multiple triblock single-stranded nucleic acids assembled on the gold nanoparticles, which can increase the local density of the reporter domain, thereby enhancing the trans-cleavage activity of the CRISPR nucleic acid enzyme Cas12a, and improving the speed and efficiency of nucleic acid sample detection.

[0021] The spherical nucleic acid probe containing the triblock single-stranded nucleic acid is further applied to virus detection.

[0022] Further, the specific method for detecting viruses by using the spherical nucleic acid probe includes the following steps:

[0023] (1) Design and synthesize crRNA with a characteristic nucleic acid sequence of the target virus as the target sequence;

[0024] (2) Incubate the crRNA with the CRISPR nuclease to construct a binary complex;

[0025] (3) Mix the target nucleic acid to be tested or its isothermal amplification product, the spherical nucleic acid probe and the binary complex in a buffer to obtain a test solution;

[0026] (4) Drop the test solution on the sample pad of the test strip, and interpret according to the color development of the streptavidin-containing detection line and the quality control line.

[0027] The principle of the detection method is as follows: the binary complex does not have the activity of cutting the reporter domain. If the target sequence is contained in the virus nucleic acid to be tested, the target sequence and the binary complex first assemble into a Cas-crRNA-Target ternary complex, the ternary complex has the cutting activity of the reporter domain, starts to cut the reporter domain rapidly, and makes the biotin free in the test solution. When the test solution passes through the detection line, the free biotin binds to the streptavidin in the detection line, so that the detection line does not develop color. If the target nucleic acid sequence is not contained in the virus nucleic acid to be tested, the binary complex cannot form a ternary complex, cannot cut the reporter domain, and then free biotin cannot be formed in the test solution. When the test solution passes through the detection line, there is no free biotin to bind to the streptavidin in the detection line, so the detection line develops color. Whether the virus nucleic acid to be tested is the target virus can be determined by observing whether the detection line develops color. According to this principle, the specific method for judging according to the color development is as follows:

[0028] If the detection line and the quality control line show red color at the same time, the result is negative;

[0029] If the detection line does not develop color and the quality control line shows red color, the result is positive;

[0030] If the quality control line does not develop color, the detection is invalid.

[0031] In some embodiments, the buffer in step (3) is a 1%-20% BSA solution, preferably a 10% BSA solution. The isothermal amplification product of the target nucleic acid to be tested refers to the product after nucleic acid amplification of the target nucleic acid to be tested by conventional isothermal amplification means such as RAA, RPA or LAMP.

[0032] Preferably, in step (1), the target sequence is shown as SEQ ID NO. 3 or SEQ ID NO. 4, and the sequence of the crRNA is shown as SEQ ID NO. 5. The virus in the present application can be African swine fever virus, or porcine circovirus type 2, porcine pseudorabies virus and other viruses.

[0033] In some embodiments, the CRISPR nuclease in step (2) is Cas12a, and the method for constructing the binary complex is: adding Cas12a and crRNA in a molar ratio of 1:1-10 into DEPC water containing NEBuffer 2.1, and incubating at room temperature to form the binary complex.

[0034] In some embodiments, the molar ratio of the spherical nucleic acid probe (calculated by gold nanoparticles) to the binary complex (calculated by nucleases) in step (3) is 1:0.1-10, and the incubation condition is 25-43 DEG C for 3-30 min.

[0035] The application also provides a virus detection test strip, comprising the spherical nucleic acid probe comprising the tri-block single-stranded nucleic acid, the CRISPR nuclease binary complex capable of specifically binding to the viral target sequence, and a test strip, wherein the CRISPR nuclease binary complex is used to cut the reporter domain in the tri-block single-stranded nucleic acid, and the test strip is provided with a detection line containing streptavidin.

[0036] In some embodiments, the preparation method of the test strip is: drawing streptavidin on the nitrocellulose membrane as a detection line, and drawing glycerol on the other end as a quality control line, and the interval between the detection line and the quality control line is 5.0-6.0 mm; drying in a 37 DEG C oven for 60 min; according to the structure of the test strip, the sample pad, the nitrocellulose membrane and the water absorption pad are pasted, and after assembly, the weight is compacted at room temperature, and the test strip for rapid nucleic acid analysis is obtained after cutting, sealing and drying. Figure 1

[0037] Advantages: Compared with the prior art, the application has the following obvious advantages:

[0038] (1) The tri-block single-stranded nucleic acid in the application has an extended configuration and good salt resistance, is suitable for detection in complex environments and high salt concentrations, and can realize controllable spatial confinement on the nanometer interface through self-assembly.

[0039] (2) The spherical nucleic acid probe in the application can effectively improve the cutting rate and cutting efficiency of the nuclease ternary complex, and further improve the virus nucleic acid detection efficiency.

[0040] (3) The application combines the CRISPR gene editing technology to realize the rapid test paper detection of nucleic acid, which can complete the rapid detection of nucleic acid in 3 minutes; combined with the isothermal amplification technology of nucleic acid, the sensitivity of 0.1 copy / μL of target nucleic acid can be reached in 25 minutes, which improves the detection performance of the nucleic acid test strip, and provides a simple, rapid and effective detection method for disease prevention and control.

[0041] ​(4) The preparation process of this invention is simple, the production cost is low, the reaction results are accurate, fast and sensitive, no special equipment is needed, and it can be judged directly by the naked eye, which can meet the needs of on-site real-time diagnosis and is easy to promote and apply on a large scale. Attached Figure Description

[0042] Figure 1 This is a schematic diagram of the test strip structure of the present invention;

[0043] Figure 2 The UV-Vis spectra of the A30-P1-B assembly of this invention before and after assembly.

[0044] Figure 3 The results show the test time of the test strip of this invention for nucleic acid detection.

[0045] Figure 4 The results of the test strip of this invention for detecting nucleic acids of different concentrations are shown.

[0046] Figure 5 This is a diagram showing the experimental results of the specificity of the test strip of this invention for nucleic acid detection. Detailed Implementation

[0047] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0048] Unless otherwise specified, all raw materials and reagents used in the following examples are commercially available.

[0049] Example 1: A triblock single-stranded nucleic acid, the nucleic acid sequence of which is shown in SEQ ID NO.1: 5'-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA TGGTTGATTGTGCCGATATCATA TGTC-Biotin- 3';

[0050] like Figure 1 As shown, the single-underlined portion of the sequence represents the hybridization domain, the double-underlined portion represents the reporter domain, and "Biotin" stands for biotin. The 5' end contains a PolyA sequence consisting of 30 adenine molecules, which is the assembly domain. This triblock single-stranded nucleic acid is referred to as A30-P1-B.

[0051] Example 2: A spherical nucleic acid probe containing the triblock single-stranded nucleic acid from Example 1, such as... Figure 1 As shown, it contains gold nanoparticles, and the A30-P1-B is adsorbed on the surface of the nanoparticles through the assembly domain. The A30-P1-B forms a complementary double-stranded structure with the hybrid DNA on its hybridization domain.

[0052] Spherical nucleic acid probes were prepared using a salt aging method, and the specific steps are as follows:

[0053] (1) A30-P1-B was mixed with gold nanoparticles with a particle size of 10 nm at a molar ratio of 200:1 at room temperature for overnight with light shaking; in this example, the final concentration of A30-P1-B was 800 nM, and the final concentration of gold nanoparticles was 4 nM;

[0054] (2) 1M PBS (100 mM PB, 1M NaCl, pH 7.4) was added to the solution of step (1) in 5 portions, with an interval of 20 min, to make the final concentration of 0.1M PBS (10 mM PB, 100 mM NaCl, pH 7.4) in the mixed solution, and the solution was continuously shaken at room temperature for overnight.

[0055] (3) The solution of step (2) was centrifuged to remove the unlinked A30-P1-B according to the parameters (15000 rpm, 20 min, 15°C), and the A30-P1-B was repeatedly washed three times with 0.1M PBS solution to obtain gold nanoparticles loaded with multiple A30-P1-B on the surface, which was referred to as SNA-2, and the SNA-2 was dispersed in 0.1M PBS (10 mM PB, 100 mM NaCl, pH 7.4).

[0056] (4) 80 μL of the SNA-2 solution prepared in step (3) was taken, and hybridization DNA was added to make the final concentration of SNA-2 10 nM and the final concentration of hybridization DNA 200 nM. After hybridization at 37°C for 10 min, the unhybridized hybridization DNA was removed by centrifugation at 15000 rpm for 20 min at 15°C, and the hybridization DNA was repeatedly washed three times with 0.1M PBS solution to obtain a spherical nucleic acid probe, which was dispersed in 0.1M PBS (10 mM PB, 100 mM NaCl, pH 7.4). In this example, the sequence of the hybridization DNA is shown in SEQ ID NO. 2:

[0057] 5'-CACAATCAACCA-3'

[0058] The ultraviolet-visible spectra before and after assembly are shown in Figure 2 . The ultraviolet characteristic peak (525 nm) of the spherical nucleic acid probe appears red shift relative to the ultraviolet characteristic peak (520 nm) of the AuNP, which proves the successful assembly of the spherical nucleic acid probe.

[0059] Example 3: In this example, the spherical nucleic acid probe prepared in Example 2 was used for virus nucleic acid detection with African swine fever virus nucleic acid as the target, and the specific steps were as follows:

[0060] (1) Design a crRNA targeting the characteristic nucleic acid sequence of African swine fever virus (ASFV). The crRNA can be incubated with the nuclease Cas12a at room temperature to form a Cas12a-crRNA binary complex.

[0061] The characteristic nucleic acid sequence, i.e. the target nucleic acid, has the following sequence:

[0062] The sequence of the sense strand (TS) is shown in SEQ ID NO. 3:

[0063] 5'-TTCATGATTTGCACAAGCCGCACCAAAGCAA-3'

[0064] The sequence of the antisense strand (NTS) is shown in SEQ ID NO. 4:

[0065] 5'-TTGCTTTGGTGCGGCTTGTGCAAATCATGAA-3'

[0066] The crRNA has the sequence shown in SEQ ID NO. 5, specifically:

[0067] 5'-UAAUUUCUACUAAGUGUAGAUGUGCGGCUUGUGCAAAUCAUGAA-3'

[0068] (2) Add 1 μL of 1 μM Cas12a, 1 μL of 1 μM crRNA, and 2 μL of 10×NEBuffer 2.1 to 5 μL of DEPC water to construct a Cas12a-crRNA binary complex to recognize the ASFV target.

[0069] The 10×NEBuffer 2.1 is composed of 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL Recombinant Albumin.

[0070] (3) Draw streptavidin on the nitrocellulose membrane as the test line, and draw glycerol on the other end as the quality control line. The interval between the test line and the quality control line is 5.0-6.0 mm. Dry in a 37℃ oven for 60 min. According to the structure of the test strip, paste the sample pad, nitrocellulose membrane, and water absorption pad. After assembly, press with a weight at room temperature, cut, seal, and dry to store, obtaining the nucleic acid rapid analysis test strip. Figure 1

[0071] ​(4) 10 μL of the spherical nucleic acid probe prepared in Example 2 with a final concentration of 10 nM was added to the Cas12a-crRNA binary complex solution, and 100 nM of the ASFV viral nucleic acid target was added. The reaction was carried out at 37°C for 0 min, 1 min, 2 min, 3 min, and 4 min, respectively, and the reaction was added to the sample pad of the nucleic acid rapid analysis test strip for detection. As shown in FIG. 6, the detection line intensity gradually decreased over time within 0-4 min; when the nuclease cleavage time reached 4 min, the Cas12a cleavage reaction of the reporter substrate on the spherical nucleic acid probe reached an equilibrium state. Therefore, the nucleic acid rapid analysis test strip proposed in the present application has the ability to rapidly detect viral nucleic acids. Figure 3

[0072] Example 4: In this embodiment, the detection method of Example 3 is combined with isothermal amplification reaction to expand the detection range, and the specific steps are as follows:

[0073] (1) The forward and reverse primers for RAA isothermal amplification are designed for the characteristic nucleic acid sequence of African swine fever virus ASFV, and the primers have the preferred sequences shown in SEQ ID NO. 6 and SEQ ID NO. 7, specifically:

[0074] SEQ ID NO. 6:

[0075] 5'-GAAATTAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATGTGCGGCTTGTGCAAATCATGAA-3'

[0076] SEQ ID NO. 7:

[0077] 5'-TTCATGATTTGCACAAGCCGCACATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC-3'

[0078] (2) 0, 0.1, 1, 10, and 100 copies / μL of the viral sample to be tested, 10 μM of the forward and reverse primers, 2 μL each, 25 μL of buffer V, and RAA recombinant enzyme freeze-dried powder, 2.5 μL of magnesium acetate, and 15.5 μL of nuclease-free water were added to the isothermal amplification reaction system, mixed well, and the reaction system was placed at 37°C for 40 min.

[0079] ​(3) The isothermal amplification reaction product prepared in step (2) is added to the Cas12a-crRNA binary complex solution prepared in Example 3 and mixed with the spherical nucleic acid probe prepared in Example 2 (final concentration 10 nm), and the cleavage reaction is carried out at 37°C for 5 min, and after the reaction is completed, the test is detected by using the nucleic acid rapid analysis test strip.

[0080] The test results are shown in Figure 4 , wherein T represents the test line, and C represents the quality control line. As the concentration of the sample to be tested increases, the intensity of the test line of the test strip gradually decreases, indicating that the present application can realize the detection of different concentrations of the sample to be tested.

[0081] Example 5: This example investigates the specificity of the virus detection method:

[0082] Using the same method as in Example 3, 100 nM of target nucleic acid, mismatch sequence Mis-1 and Mis-2, and viral nucleic acid of the same type as the target nucleic acid: porcine circovirus type 2 (PCV2) nucleic acid target and porcine pseudorabies virus (PRV) nucleic acid target are added to the Cas12a-crRNA binary complex solution, and mixed with the spherical nucleic acid probe prepared in Example 2, and the reaction is carried out at 37°C for 5 min, and after the reaction is completed, the test is detected by using the nucleic acid rapid analysis test strip. The mismatch and viral nucleic acid sequence of the same type as the target nucleic acid are as follows:

[0083] Mis-1:

[0084] TS 5'-TTCATGATTTGCACAAGCCGCACCATAGCAA-3'

[0085] NTS 5'-TTGCTATGGTGCGGCTTGTGCAAATCATGAA-3'

[0086] Mis-2:

[0087] TS 5'-TTCATGATTTGCACATGCCGCACCATAGCAA-3'

[0088] NTS 5'-TTGCTATGGTGCGGCATGTGCAAATCATGAA-3'

[0089] PCV2:

[0090] TS 5'-TCTCGATGTGGCAGCGGGCACCCAAATACCA-3'

[0091] NTS 5'-TGGTATTTGGGTGCCCGCTGCCACATCGAGA-3'

[0092] PRV:

[0093] TS 5'-TGTACTTTATCGAGTACGCCGACTGCGACCC-3'

[0094] NTS 5'-GGGTCGCAGTCGGCGTACTCGATAAAGTACA-3'

[0095] Test results are as follows Figure 5 As shown, T represents the test line and C represents the control line. A positive result will only appear when the African swine fever virus target is added, that is, the test line will not be displayed, while the control line will be colored, which proves that the detection probe has high specificity for African swine fever virus.

[0096] Example 6: Everything else is the same as in Example 2, except that:

[0097] Spherical nucleic acid probes were prepared using a rapid assembly method, the specific method being as follows:

[0098] An-P1-B was mixed with gold nanoparticles at a molar ratio of 200:1 and incubated for 10 minutes at 25°C and 300 rpm. Then, 500 mM trisodium citrate solution (pH = 3) was added to bring the final concentration of trisodium citrate in the mixture to 10 mM. After standing for another 10 minutes, 0.2 M PB buffer was added to bring the final concentration of PB to 10 mM. The mixture was centrifuged at 12000 rpm for 20 minutes at 15°C, and the supernatant was removed. The sample was washed with 0.01 M PBS solution (10 mM PB, 0.1 M NaCl, pH 7.4), and this centrifugation and washing step was repeated three times to ensure the removal of excess nucleic acid sequences. The resulting DNA-AuNPs spherical nucleic acid probes were dispersed in 0.01 M PBS solution (10 mM PB, 0.1 M NaCl, pH 7.4) and stored.

[0099] Testing showed that the spherical nucleic acid probe prepared in this embodiment had a similar detection effect on the African swine fever virus target as the spherical nucleic acid probe prepared in Example 2.

[0100] Example 7: Everything else is the same as in Example 2, except that:

[0101] The molar ratio of triblock single-stranded nucleic acid to gold nanoparticles is 100:1; the particle size of the gold nanoparticles is 5 nm.

[0102] Take 80 μL of the SNA-2 solution prepared in step (3), add hybridization DNA to it to ensure that the final concentration of SNA-2 is 20 nM and the final concentration of hybridization DNA is 400 nM, and after hybridization at 36°C for 90 min, centrifugal removal of unhybridized hybridization DNA, and repeated washing three times with 0.1 M PBS solution, spherical nucleic acid probes are obtained, and the spherical nucleic acid probes are dispersed in 0.1 M PBS (10 mM PB, 100 mM NaCl, pH 7.4).

[0103] It is detected that the detection effect of the spherical nucleic acid probe prepared in this embodiment on the African swine fever virus target is equivalent to that of the spherical nucleic acid probe prepared in Example 2.

[0104] Example 8: The rest are the same as Example 2, except that:

[0105] The molar ratio of the triblock single-stranded nucleic acid to the gold nanoparticles is 300:1, and the particle size of the gold nanoparticles is 20 nm.

[0106] Take 80 μL of the SNA-2 solution prepared in step (3), add hybridization DNA to it to ensure that the final concentration of SNA-2 is 20 nM and the final concentration of hybridization DNA is 400 nM, and after hybridization at 36°C for 90 min, centrifugal removal of unhybridized hybridization DNA, and repeated washing three times with 0.1 M PBS solution, spherical nucleic acid probes are obtained, and the spherical nucleic acid probes are dispersed in 0.1 M PBS (10 mM PB, 100 mM NaCl, pH 7.4).

[0107] It is detected that the detection effect of the spherical nucleic acid probe prepared in this embodiment on the African swine fever virus target is equivalent to that of the spherical nucleic acid probe prepared in Example 2.

[0108] Example 9: The rest are the same as Example 3, except that:

[0109] Step (2) adds 1 μL of 1 μM Cas12a, 1 μL of 10 μM crRNA, and 2 μL of 10×NEBuffer 2.1 to 11 μL of DEPC water to construct a Cas12a-crRNA binary complex. That is, the molar ratio of Cas12a to crRNA is 1:10. The assembly effect of the binary complex is equivalent to that of Example 3.

[0110] Example 10: The rest are the same as Example 3, except that:

[0111] Add 4 μL of the spherical nucleic acid probe prepared in Example 2 with a final concentration of 10 nM to the Cas12a-crRNA binary complex solution with a final concentration of 1 μM, and add the ASF virus nucleic acid target with a final concentration of 100 nM. React at 25°C for 30 min. The detection result is equivalent toFigure 2 Approximately.

[0112] Example 11: The same as example 3, except that:

[0113] 4 μL of the spherical nucleic acid probe prepared in example 2 with a final concentration of 10 nM was added to the Cas12a-crRNA binary complex solution with a final concentration of 50 nM, and the ASF virus nucleic acid target with a final concentration of 100 nM. The reaction was carried out at 43°C for 5 min. The detection result is similar to Figure 2 Approximately.

[0114] Example 12: A viral detection test strip, comprising the spherical nucleic acid probe comprising a triblock single-stranded nucleic acid prepared in example 2 and the CRISPR nuclease binary complex prepared in example 3 and the test strip, during detection, according to the method of example 3, the spherical nucleic acid probe, the CRISPR nuclease binary complex and the nucleic acid sample to be detected are mixed and incubated, then the incubated sample to be detected is dropped on the paper strip, and the color development of the test line and the control line is observed to complete the detection.

Claims

1. A triblock single-stranded nucleic acid, characterized in that, It sequentially includes an assembly domain for adsorption onto the surface of a carrier, a hybridization domain for forming a double-stranded structure, and a reporter domain, wherein the nucleic acid sequence of the reporter domain is cleaved to produce free biotin.

2. The triblock single-stranded nucleic acid according to claim 1, characterized in that, The assembly domain is a PolyA sequence containing 5-100 adenines, the hybridization domain is a random sequence of 5-100 bases, and the reporter domain contains a DNA sequence that can be cleaved by nucleases, with biotin attached to the end of the DNA sequence.

3. The triblock single-stranded nucleic acid according to claim 1, characterized in that, The DNA sequence of the hybridization domain is shown in SEQ ID NO.16; the DNA sequence of the reporter domain is shown in SEQ ID NO.17; the assembled structure is a PolyA sequence containing 5-100 adenines.

4. The triblock single-stranded nucleic acid according to claim 1, characterized in that, It contains a DNA sequence as shown in SEQ ID NO.1, with biotin attached to the 3' end of the DNA sequence.

5. A spherical nucleic acid probe comprising the triblock single-stranded nucleic acid according to any one of claims 1-4, characterized in that, The compound contains gold nanoparticles, and the triblock single-stranded nucleic acid is adsorbed onto the surface of the gold nanoparticles through an assembly domain. The triblock single-stranded nucleic acid forms a complementary double-stranded structure with the hybrid DNA on its hybridization domain.

6. The method for preparing a spherical nucleic acid probe comprising a triblock single-stranded nucleic acid according to claim 5, characterized in that, Includes the following steps: (1) Mix triblock single-stranded nucleic acid with gold nanoparticles and incubate them using a salt aging method or a rapid assembly method to obtain gold nanoparticles loaded with triblock single-stranded nucleic acid. (2) A spherical nucleic acid probe was obtained by mixing gold nanoparticles loaded with triblock single-stranded nucleic acid with hybrid DNA and then performing a hybridization reaction.

7. The method for preparing a spherical nucleic acid probe comprising a triblock single-stranded nucleic acid according to claim 6, characterized in that, The molar ratio of the triblock single-stranded nucleic acid to the gold nanoparticles is 100-300:1; the hybridization reaction method is as follows: the gold nanoparticles loaded with the triblock single-stranded nucleic acid are mixed with the hybridization DNA in a buffer solution at a molar ratio of 1:5-100, and the mixture is hybridized at 36-38℃ for 10-90 min. After that, the unbound hybridization DNA is washed away to obtain a spherical nucleic acid probe.

8. The application of the spherical nucleic acid probe containing a triblock single-stranded nucleic acid as described in claim 5 in virus detection.

9. The application according to claim 8, characterized in that, Includes the following steps: (1) Design and synthesize crRNA using the characteristic nucleic acid sequence of the target virus as the target sequence; (2) Construct a binary complex by incubating crRNA with CRISPR nuclease; (3) In a buffer solution, the target nucleic acid or its isothermal amplification product, the spherical nucleic acid probe and the binary complex are mixed and reacted to obtain the test solution; (4) Add the test liquid droplet to the sample pad of the test strip and interpret the results based on the color development of the detection line and control line containing streptavidin.

10. The application according to claim 9, characterized in that, In step (1), the target sequence is as shown in SEQ ID NO.3 or SEQ ID NO.4, and the crRNA sequence is as shown in SEQ ID NO.

5.

11. A virus detection test strip, characterized in that, The invention includes the spherical nucleic acid probe containing a triblock single-stranded nucleic acid as described in claim 5, a CRISPR nuclease binary complex that can specifically bind to a viral target sequence, and a test strip, wherein the CRISPR nuclease binary complex is used to cleave the reporter domain in the triblock single-stranded nucleic acid, and the test strip is provided with a detection line containing streptavidin.

Images