Aptamer colorimetric sensor constructed by amorphous cobalt-based nano enzyme as well as preparation method and application of aptamer colorimetric sensor

Abstract

The invention belongs to the technical field of food safety detection, and discloses a preparation method of an aptamer colorimetric sensor constructed by amorphous cobalt-based nano-enzyme and detection application of the aptamer colorimetric sensor to zearalenone (ZEN) in food, and the preparation method comprises the following steps: constructing amorphous Co3O4 (at) CN / SiO2 nano-enzyme; and constructing an aptamer (Apt) colorimetric sensor to detect the ZEN. The amorphous Co-based nano material is simple in preparation process, high in catalase-like activity, easy to modify by biological materials and low in cost. The colorimetric sensor for detection is based on Co3O4 (at) CN / SiO2 nano-enzyme adsorption aptamers, the construction process is simple, the used aptamers are TCATCTATGGTACATACTATCTGTAATGTGATATG and are marked as ZEN-Apt, a detection system of the colorimetric sensor is characterized in that Co3O4 (at) CN / SiO2, ZEN-Apt and ZEN with different concentrations are incubated at a proper temperature to form a competitive reaction, and ZEN-Apt and ZEN are preferentially combined, so that the aptamers on the nano-enzyme are reduced. When the sensor constructed by the invention is used for detecting and analyzing unknown ZEN in an actual sample, the operation is convenient, the specificity is good, the sensitivity is high, the speed is high, and the repeatability and the reproducibility are good.

Description

Technical Field

[0001] This invention relates to the field of food safety testing technology, specifically to an aptamer colorimetric sensor constructed from an amorphous cobalt-based nanozyme, its preparation method, and its application. Background Technology

[0002] Zearalenone (ZEN) is a non-steroidal estrogenic fungal toxin secreted by Fusarium graminearum and other Fusarium fungi, also known as F-2 toxin. It is mainly produced through moldy grains or feed. When humans and animals ingest ZEN-contaminated grains, it can cause serious damage to their bodies and lead to various diseases. Therefore, it is necessary to employ highly sensitive and selective methods to determine the ZEN content in food.

[0003] Currently, many advanced analytical techniques have been widely applied to the detection of ZEN in various matrices. Among them, traditional instrumental analytical methods, such as high-performance liquid chromatography (HPLC), mass spectrometry (MS), and Raman spectroscopy, play a crucial role in ZEN detection due to their excellent precision, high sensitivity, and reliable accuracy. However, they also suffer from drawbacks such as complex sample pretreatment, long measurement times, complicated operating procedures, and unsuitability for on-site detection, making it difficult to rapidly monitor mold content in practical applications. In recent years, colorimetric methods have attracted considerable attention from researchers due to their advantages of simplicity, speed, low cost, and intuitive visualization. This method enables rapid on-site detection, solving the problems associated with traditional instruments. The emergence of nanozymes has provided an effective approach for the application of colorimetric methods in mycotoxin detection. Furthermore, nanozymes possess characteristics such as simple preparation, high catalytic activity, stability, and controllability, gradually becoming ideal materials for enhancing colorimetric signals. However, nanozyme colorimetric sensors exhibit low target selectivity due to the lack of specific recognition elements.

[0004] Currently, aptamers can recognize a variety of targets through specific binding sites and have advantages such as simple preparation processes, ease of chemical modification, and low cost, thus being regarded as an ideal alternative to natural antibodies. Studies have shown that modifying nanozymes with aptamers not only provides the recognition element with specific binding to the target, but also effectively modulates the nanozyme's own catalytic activity, ultimately achieving highly sensitive and selective detection of the target by enhancing or inhibiting the colorimetric signal. Because the aptamer's phosphate backbone dissociates, resulting in a negatively charged surface, it can adsorb onto the positively charged nanozyme through electrostatic and π-π stacking interactions.

[0005] Polydopamine-encapsulated SiO2 (PDA@SiO2) was prepared by sol-gel method. After calcination and carbonization, a carbon-nitrogen layer (CN / SiO2) was formed on the SiO2 surface, which can adsorb aptamers through π-π stacking. Then, Co3O4 was loaded on CN / SiO2. Due to the large specific surface area of ​​the carbon-nitrogen layer, Co3O4 was highly dispersed on the CN / SiO2 surface. The synergistic effect of CN / SiO2 and Co3O4 gave the Co3O4@CN / SiO2 nanozyme excellent peroxidase-like activity. It can effectively adsorb aptamers to achieve specific detection of zearalenone content, and can also effectively catalyze H2O2 to oxidize colorless TMB to blue oxTMB. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the aforementioned background technology and provide an aptamer colorimetric sensor constructed from an amorphous cobalt-based nanozyme, its preparation method, and its application. The nanomaterial used in the sensor of this invention is an amorphous Co-based nanozyme Co3O4@CN / SiO2, which is simple to prepare. The aptamer used is TCATCTATCTATGGTACATTACTATCTGTAATGTGATATG, denoted as ZEN-Apt. The detection method involves incubating Co3O4@CN / SiO2 with ZEN-Apt and different concentrations of ZEN at a suitable temperature to form a competitive reaction. ZEN-Apt and ZEN preferentially bind, resulting in a reduction of the aptamer on the nanozyme. Then, buffer solution, H2O2, and TMB are added, and the reaction is carried out at a suitable temperature. The absorbance is measured using a UV spectrophotometer. Different curves will be obtained depending on the solutions added, providing more accurate detection results for the trace analysis of zearalenone.

[0007] To achieve the objectives of this invention, the method for preparing the aptamer colorimetric sensor constructed from amorphous cobalt-based nanozymes includes the following steps:

[0008] S1.1 Preparation of precursor PDA@SiO2:

[0009] The PDA@SiO2 was synthesized by the sol-gel method. A certain amount of ethanol, water and ammonia were added to a beaker and stirred vigorously for 10 min. Then, tetraethyl silicate was added dropwise and stirred vigorously for 10 min. A certain amount of dopamine hydrochloride was added and stirred at room temperature for 24 h. The solution quickly changed from transparent to brownish-gray. After stirring, the solution was centrifuged and the black precipitate was collected. The precipitate was washed three times with deionized water and dried in an oven at 60 °C.

[0010] S1.2 Preparation of amorphous Co3O4@CN / SiO2:

[0011] Co3O4@CN / SiO2 nanozymes were synthesized via a hydrothermal method. A certain amount of the precursor prepared from S1.1 was weighed, and urea and cobalt acetate tetrahydrate were dissolved in ethylene glycol. The mixture was sonicated for 30 min and stirred for 2 h. The solution was then transferred to an autoclave and reacted at 160 ℃ for 24 h. After cooling to room temperature, the precipitate was collected by centrifugation and washed several times with anhydrous ethanol. The precipitate was then freeze-dried at -65 ℃ for 12 h to obtain the precursor Co3O4@PDA-N / SiO2. The precursor was then calcined in air at a heating rate of 2 ℃ / min to 350 ℃ for 2 h. After cooling, the final product Co3O4@CN / SiO2 was obtained.

[0012] Furthermore, in some embodiments of the present invention, the mass ratio of cobalt acetate tetrahydrate, PDA@SiO2 and urea is 1:8:400.

[0013] This invention provides a method for preparing amorphous cobalt-based nanomaterials. The CN layer covering the SiO2 surface effectively prevents Co3O4 from agglomerating into a crystalline structure. Compared with Co3O4 crystals, the amorphous structure effectively increases the number of active sites. Based on this nanozyme Co3O4@CN / SiO2, an aptamer colorimetric sensor for detecting ZEN was constructed. The sensor construction scheme includes the following steps:

[0014] S2.1, Aptamer Treatment

[0015] S2.11 Preparation of aptamer solution: First, purchase centrifuge tubes containing aptamer powder. Before opening the cap, centrifuge at 4000 rpm for 30-60 seconds. Centrifugation can prevent the DNA powder from being lost. Then, slowly open the cap, add an appropriate amount of buffer solution, cover and shake thoroughly to mix. This will prepare an aptamer solution of a certain concentration. If not used temporarily or stored for a long time, it should be refrigerated at -20℃.

[0016] S2.12 Determining the effectiveness of the aptamer: Incubate the aptamer solution prepared in S2.11 with the Co3O4@CN / SiO2 nanozyme prepared in S1. After adding ABS, add the chromogenic substrate TMB and H2O2 to react. After transferring the solution to a cuvette, scan it within a certain wavelength range using a UV-Vis spectrophotometer and compare the absorbance difference between the two peaks with that of the Co3O4@CN / SiO2 nanozyme prepared in S1. If the difference is large, the aptamer is effective.

[0017] S2.2 Preparation of Co3O4@CN / SiO2 nanozyme adsorbent aptamers

[0018] The prepared Co3O4@CN / SiO2 nanozyme was dissolved in a solvent, and a small amount was added to a 1.5 mL centrifuge tube. Then, the aptamer solution prepared with S2.11 was added to the centrifuge tube. After incubation for 20 min, Co3O4@CN / SiO2-Apt was prepared. ABS buffer was added, followed by the chromogenic substrate TMB and H2O2. The reaction was carried out at a suitable temperature, and the absorbance was measured at 652 nm using a UV-Vis spectrophotometer. By adding the target analyte in the presence of Co3O4@CN / SiO2-Apt and following the same conditions, the target analyte can be detected.

[0019] Furthermore, in some embodiments of the present invention, the solvent is DMF, water, or ethanol.

[0020] Furthermore, in some embodiments of the present invention, the ZEN aptor is TCATCTATCTATGGTACATTACTATCTGTAATGTGATATG.

[0021] Furthermore, in some embodiments of the present invention, in S2.11, the buffer solution is TE buffer, 1X, low EDTA, pH 8.0.

[0022] Furthermore, in some embodiments of the present invention, the cuvette in S2.12 is either a quartz cuvette or a glass cuvette.

[0023] Furthermore, in some embodiments of the present invention, the chromogenic substrate in S2.12 is any one of 3,3',5,5'-tetramethylbenzidine, 2,2-azido-bis(3-ethyl-benzothiazoline-6-sulfonic acid) diammonium salt, and o-phenylenediamine.

[0024] Furthermore, in some embodiments of the present invention, the ABS buffer solution in S2.12 is a C2H3O2Na solution containing 0.2 mol / L and a CH3COOH solution containing 0.2 mol / L.

[0025] Preferably, in some embodiments of the present invention, the wavelength range in S2.12 refers to a wavelength of 652 nm.

[0026] Furthermore, in some embodiments of the present invention, the incubation conditions in S2.12 are 37°C for 20 minutes.

[0027] Furthermore, in some embodiments of the present invention, the reaction conditions in S2.12 are 37°C for 10 min.

[0028] On the other hand, the present invention also provides a method for preparing an aptamer colorimetric sensor constructed from amorphous cobalt-based nanozymes. The application of this aptamer colorimetric sensor for detecting zearalenone includes the following steps:

[0029] S3.1 Establish a standard working curve for the detection of zearalenone in zearalenone:

[0030] S3.11. Prepare an acetate buffer solution that does not participate in the chemical reaction as a base solution in a centrifuge tube; prepare a certain concentration of 3,3',5,5'-tetramethylbenzidine (TMB) as a colorimetric reagent; prepare a certain concentration of H2O2 as a substrate to activate the nanozyme to catalyze the oxidation and color development of TMB;

[0031] S3.12 Dissolve zearalenone in a solvent that can dissolve it and does not react with zearalenone to prepare a zearalenone standard stock solution, and then prepare a series of zearalenone standard solutions of different concentrations.

[0032] S3.13. Add Co3O4@CN / SiO2 and Apt to a centrifuge tube, add the same volume of zearalenone standard solution prepared in S3.12 but with different concentrations, incubate at 37℃ for 20 min, then place in the solution prepared in S2.11, and add TMB and H2O2 with a certain concentration as described in S3.11. React at 37℃ for 10 min, then transfer the solution to a quartz cuvette. Analyze the solution using a UV-Vis spectrophotometer at a wavelength of 652 nm. Record the absorbance of Co3O4@CN / SiO2 + Apt + ZEN as A, and the absorbance of Co3O4@CN / SiO2 + Apt as A0. Establish a standard working curve for zearalenone detection with ∆A as the ordinate (∆A = A - A0) and zearalenone concentration as the abscissa.

[0033] S3.2 Rapid quantitative analysis of zearalenone in actual samples:

[0034] The Co3O4@CN / SiO2 and Apt mentioned above in this invention are added to a centrifuge tube, along with a certain volume of the test solution containing an unknown concentration of zearalenone. After incubation, the buffer solution prepared in S3.11 is added, along with TMB and H2O2 of a certain concentration as described in S2.11. After reacting at 37°C for 10 min, the solution is transferred to a quartz cuvette. The absorbance of the solution is detected at a wavelength of 652 nm using a UV-Vis spectrophotometer. Finally, based on the zearalenone detection standard working curve established in S3.1, the measured absorbance value is substituted into the standard working curve to obtain the concentration of the unknown zearalenone in the actual sample.

[0035] Furthermore, in some embodiments of the present invention, the matrix solution is an acetate buffer solution; preferably, in some embodiments of the present invention, the acetate buffer solution is a 0.2 mol / L mixed solution of acetic acid and sodium acetate.

[0036] Furthermore, in some embodiments of the present invention, the method for preparing the zearalenone standard mother liquor is as follows: zearalenone is dissolved in ethanol to prepare a zearalenone standard mother liquor with a concentration of 0.001 mol / L.

[0037] Compared with the prior art, the advantages of the present invention are as follows:

[0038] (1) This study synthesized amorphous Co-based nanozymes using a simple method. Due to the lack of long-range order in the amorphous structure and the presence of numerous defects on the surface, more active sites (Co) were exposed. 2+ / Co 3+ Compared to Co3O4 crystals, amorphous Co-based materials significantly enhance the catalytic efficiency for substrates. The electron migration pathways in amorphous Co-based materials are more flexible, which is conducive to accelerating electron transfer, promoting the decomposition of H2O2 into free radicals, and increasing the redox reaction rate. At the same time, amorphous Co-based materials have a larger specific surface area and abundant mesoporous structure, which is beneficial to the diffusion and contact of substrate molecules.

[0039] (2) In this invention, the absorbance generated by the detection of Co3O4@CN / SiO2+ Apt + ZEN is denoted as A, and the absorbance generated by the detection of Co3O4@CN / SiO2+ Apt is denoted as A0. The difference between them is ∆A=A-A0. With ∆A as the vertical axis and the zearalenone concentration as the horizontal axis, a standard working curve for the detection of zearalenone is established. The unknown concentration of zearalenone is measured by the standard working curve for the detection of zearalenone. The method is simple, convenient to operate, fast, selective, and has strong anti-interference ability. It can be used for rapid quantitative detection of zearalenone in actual samples such as corn, wheat, and soybeans. Attached Figure Description

[0040] Figure 1 A schematic diagram illustrating the feasibility analysis of detecting ZEN using a Co3O4@CN / SiO2 aptamer sensor in an embodiment of the present invention.

[0041] Figure 2 The maximum absorption wavelength of TMB in buffer solutions of Co3O4@CN / SiO2 with different concentrations of aptamers in the embodiments of the present invention.

[0042] Figure 3 In this embodiment of the invention, the Co3O4@CN / SiO2 nanozyme colorimetric detection of ZEN showed good linear calibration curves in the range of 0.7-130 nM.

[0043] Figure 4 In this embodiment of the invention, the RGB values ​​of solutions with different concentrations of ZEN were measured using the Color picker mobile app, and the linear calibration curve with G / B representing the ordinate was plotted.

[0044] Figure 5 This is a selectivity diagram of the Co3O4@CN / SiO2 aptamer sensor in an embodiment of the present invention.

[0045] Figure 6 This is a diagram illustrating the anti-interference capability of the Co3O4@CN / SiO2 aptamer sensor in an embodiment of the present invention. Detailed Implementation

[0046] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. Additional aspects and advantages of this invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. It should be understood that the following description is merely illustrative and not intended to limit the invention.

[0047] The terms “comprising,” “including,” “having,” “containing,” or any other variations thereof, as used herein, are intended to cover a non-exclusive inclusion. For example, a composition, step, method, article, or apparatus that includes the listed elements is not necessarily limited to those elements, but may include other elements not expressly listed or elements inherent to such composition, step, method, article, or apparatus.

[0048] When a quantity, concentration, or other value or parameter is expressed as a range, a preferred range, or a range defined by a series of upper and lower preferred values, this should be understood as specifically disclosing all ranges formed by any pair of any upper or preferred value with any lower or preferred value, regardless of whether the range is disclosed individually. For example, when the range “1 to 5” is disclosed, the described range should be interpreted as including the ranges “1 to 4”, “1 to 3”, “1 to 2”, “1 to 2 and 4 to 5”, “1 to 3 and 5”, etc. When numerical ranges are described herein, unless otherwise stated, the range is intended to include its endpoints and all integers and fractions within that range.

[0049] The singular form includes the plural objects of discussion unless the context clearly indicates otherwise. "Optional" or "any one" means that the matter or event described thereafter may or may not occur, and the description includes both the possibility that the event occurs and the possibility that the event does not occur.

[0050] The indefinite articles “a” and “an” preceding an element or component of this invention do not impose any limitation on the quantity (i.e., number of times) of the element or component. Therefore, “an” or “a” should be interpreted as including one or at least one, and the singular form of an element or component also includes the plural form, unless the quantity clearly refers only to the singular form.

[0051] Furthermore, the terms "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., described below refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms are not necessarily directed at the same embodiment or example. Moreover, the technical features involved in the various embodiments of the present invention can be combined with each other as long as they do not conflict with each other.

[0052] The abbreviations involved in the embodiments of this invention include:

[0053] 1. Zearalenone (ZEN)

[0054] 2,3,3',5,5'-Tetramethylbenzidine (TMB)

[0055] 3. 2,2-Aza-bis(3-ethyl-benzothiazoline-6-sulfonic acid) diammonium salt (ABTS)

[0056] 4. o-Phenylenediamine (OPD)

[0057] 5. Acetic acid buffer solution

[0058] Example 1

[0059] An aptamer colorimetric sensor based on amorphous cobalt-based nanozymes is prepared by the following steps:

[0060] (1) Preparation of amorphous cobalt-based nanozymes Co3O4@CN / SiO2:

[0061] ① The precursor PDA@SiO2 was synthesized by the sol-gel method. The specific process was as follows: 24 mL of ethanol, 80 mL of water and 1 mL of 25% ammonia water were added to a beaker and stirred vigorously for 10 min. Then, 1 mL of tetraethyl silicate was added dropwise and stirred vigorously for 10 min. Then, 8 mL of dopamine hydrochloride (50 mg / mL) was added and stirred at room temperature for 24 h. The solution changed from transparent to brownish-gray rapidly. After stirring, the solution was centrifuged and the black precipitate was collected. The precipitate was washed three times with deionized water and dried in an oven at 60 °C to obtain the PDA@SiO2 precursor.

[0062] ②Co3O4@CN / SiO2 nanozyme was synthesized via a hydrothermal method. 40 mg of PDA@SiO2 precursor, 800 mg of urea, and 5 mg of cobalt acetate were weighed and dissolved in 40 mL of ethylene glycol. After superheating for 30 min and stirring for 2 h, the solution was transferred to an autoclave and reacted at 160 °C for 24 h. After cooling to room temperature, the solution was collected by centrifugation and washed several times with anhydrous ethanol to obtain a precipitate. The precipitate was placed in a freeze dryer and frozen at -65 °C for 12 h, then dried for 24 h to obtain the precursor. The precursor was then placed in a tube furnace and calcined at 350 °C at a heating rate of 2 °C / min in air for 2 h. After cooling, the final product Co3O4@CN / SiO2 was obtained.

[0063] (2) Adsorption of aptamers on the surface of Co3O4@CN / SiO2

[0064] The effect of aptamers on catalase activity of Co3O4@CN / SiO2 was investigated by adding 10 μL of 1.5 mg / mL Co3O4@CN / SiO2, along with 10 μL of ZEN-Apt and ZEN at different concentrations. The mixture was incubated at 37 °C for 20 min. Then, 300 μL of Abs (0.2 M, pH 4.0), 10 μL of H2O2 (40 mM), and 10 μL of TMB (4 mM) were added. After reacting for another 10 min, the absorbance was measured at 652 nm using UV-Vis. Figure 1 The absorbance decreased after incubating the material with ZEN-Apt, but increased upon re-addition of ZEN, demonstrating the feasibility of using the sensor to detect ZEN. The study investigated the regulatory effect of different concentrations of ZEN-Apt on the activity of catalase in Co3O4@CN / SiO2, such as... Figure 2 .

[0065] Example 2

[0066] The Co3O4@CN / SiO2 nanozyme aptamer colorimetric sensor prepared in Example 1 was used to detect and study zearalenone in zearalenone. The specific steps of the analytical method are as follows:

[0067] (1) Construction of standard curve for colorimetric detection of ZEN by Co3O4@CN / SiO2 nanozyme

[0068] Because Co3O4@CN / SiO2 exhibits good peroxidase-like activity, its enzyme activity was inhibited by ZEN-Apt. Adding different concentrations of ZEN deepened the solution color, thus achieving the detection purpose. The experimental conditions of Co3O4@CN / SiO2 concentration, ZEN-Apt concentration, pH, ZEN-Apt incubation time, TMB concentration, H2O2 concentration, reaction time, and reaction temperature were optimized. The optimal detection conditions were found to be 1.5 mg / mL Co3O4@CN / SiO2, 0.5 μM ZEN-Apt, pH 4.0, incubation time 20 min, 4 mM TMB, 40 mM H2O2, reaction temperature 37 ℃, and reaction time 10 min, which provided the highest sensitivity for ZEN detection. Figure 3 As shown, the system exhibits good linear calibration curves in the range of 0.7–130 nM, with the corresponding linear regression equation being ΔA = 0.0264 + 0.0049 c(R). 2 =0.9917), and the detection limit (LOD=3Sd / k) was calculated to be 0.91nM, which has a lower detection limit and a wider linear range compared with other methods.

[0069] (2) Colorimetric sensing combined with smartphone detection ZEN

[0070] ① Add 10 μL of 1.5 mg / mL Co3O4@CN / SiO2, along with 10 μL of 0.5 μM ZEN-Apt and 10 μL of ZEN at different concentrations, and incubate at 37 ℃ for 20 min.

[0071] ② Add 300 μL Abs (0.2 M, pH 4.0), 10 μL H2O2 (40 mM), and 10 μL TMB (4 mM). After reacting for 10 min, measure the absorbance at 652 nm using UV-vis. The difference ΔA = A - A0 (A is the absorbance without ZEN, and A0 is the absorbance with ZEN) forms a linear relationship with the ZEN concentration. When a linear relationship is formed, the color development degree of oxTMB is different, and the RGB values ​​are also different. The RGB values ​​of the solution are measured using the Color picker mobile app, and a linear relationship is also formed with the ZEN concentration, which can be used for on-site detection.

[0072] Constructing a visual standard curve:

[0073] To enable rapid, convenient, and real-time detection of ZEN, this paper, based on a colorimetric aptamer sensor, utilizes a smartphone to measure the RGB values ​​of solutions containing different concentrations of ZEN using the Color Picker mobile app. The values ​​are expressed on the ordinate as G / B. Figure 4 As shown, it exhibits a good linear relationship in the range of 1 - 100 nM, and its corresponding linear equation is y = 1.1342 - 0.0017x(R). 2 =0.9907), and the lowest detection limit (LOD=3SD / K) was 8.823 nM. In summary, this indicates that the colorimetric sensor of the joint smartphone has good detection performance.

[0074] Selection and interference immunity evaluation of colorimetric aptamer sensors:

[0075] The Co3O4@CN / SiO2 nanozyme-based aptamer colorimetric sensor prepared in this invention exhibits strong selectivity and anti-interference capabilities. Anti-interference tests were conducted on the detection system using AFB1, CIT, NaCl, KNO3, Vitamin C, glucose, and phenylalanine, respectively. Figure 5 As shown, in the detection system, the selectivity of the sensor for zearalenone, and Figure 6 All the anti-interference substances shown did not cause significant interference to the experimental system and were within a controllable range.

[0076] Spike recovery of actual samples

[0077] To verify the practical application value of the developed sensor, the prepared Co3O4@CN / SiO2-Apt colorimetric sensor was used for the standard addition method detection of ZEN in grains. To verify the accuracy of the colorimetric sensor, spiked recovery experiments were conducted on corn, wheat, and soybeans in food. The actual sample processing followed the method described in Chapter 2.3 of this paper. The three actual samples were prepared into ZEN solutions with concentrations of 5, 50, and 100 nM, respectively. The data processing is shown in the table below. The recovery rate ranged from 89.63% to 106.0%, and the relative standard deviation (RSD) ranged from 0.2% to 4.6%, indicating that the sensor has good accuracy.

[0078] Table 1. Detection of ZEN in actual samples

[0079]

[0080] As shown in Table 1, after multiple repeated experiments, the recoveries of this method for corn, wheat, and soybean ranged from 89.63% to 106.0%, with RSDs ranging from 0.2% to 4.6%. The results demonstrate that the amorphous cobalt-based nanozyme Co3O4@CN / SiO2 prepared in this invention possesses high catalase-like activity. The aptamer colorimetric sensor constructed based on this nanozyme is simple to prepare, convenient to operate, rapid in detection, exhibits good repeatability and reproducibility, and high sensitivity, making it suitable for the rapid quantitative detection of zearalenone in actual grain samples.

[0081] Those skilled in the art will readily understand that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. An amorphous cobalt-based nanozyme Co3O4@CN / SiO2, characterized in that: It is an amorphous cobalt-based nanomaterial with SiO2 encapsulated with dopamine hydrochloride as the core, cobalt acetate tetrahydrate and urea as raw materials to synthesize precursors, and obtained by sol-gel method and hydrothermal method.

2. The amorphous cobalt-based nanozyme Co3O4@CN / SiO2 according to claim 1, characterized in that... It is produced by the following method: S1.1 Preparation of precursor PDA@SiO2: By using the sol-gel method, a certain amount of ethanol, water, and ammonia were added to a beaker and stirred vigorously for 10 min. Then, tetraethyl silicate was added dropwise and stirred vigorously for 10 min. Next, a certain amount of dopamine hydrochloride was added and stirred at room temperature for 24 h. The solution quickly changed from transparent to brownish-gray. After stirring, the solution was centrifuged and a black precipitate was collected. The precipitate was washed three times with deionized water and dried in an oven at 60 °C to obtain PDA@SiO2. S1.2 Preparation of amorphous Co3O4@CN / SiO2: Co3O4@CN / SiO2 nanozymes were synthesized via a hydrothermal method. A certain amount of the precursor prepared in S1.1, urea, and cobalt acetate tetrahydrate were dissolved in ethylene glycol. The mixture was sonicated for 30 min, stirred for 2 h, and then transferred to an autoclave at 160 ℃ for 24 h. After cooling to room temperature, the precipitate was collected by centrifugation and washed several times with anhydrous ethanol. The precipitate was then freeze-dried at -65 ℃ for 12 h to obtain the precursor Co3O4@PDA-N / SiO2. The precursor was then calcined in air at 350 ℃ with a heating rate of 2 ℃ / min for 2 h. After cooling, the final product Co3O4@CN / SiO2 was obtained. The mass ratio of cobalt acetate tetrahydrate, PDA@SiO2, and urea was 1:8:

400.

3. A method for preparing an aptamer colorimetric sensor constructed from an amorphous cobalt-based nanozyme, characterized in that, Includes the following steps: S2.1, Aptamer treatment: S2.11 Preparation of aptamer solution: First, purchase centrifuge tubes containing aptamer powder. Before opening the cap, centrifuge for 30-60 seconds. Centrifugation can prevent the DNA powder from being lost. Then, slowly open the cap, add an appropriate amount of buffer solution, cover and shake thoroughly to mix. This will prepare an aptamer solution of a certain concentration. S2.12 Determining the effectiveness of the aptamer: Incubate the aptamer solution prepared in S2.11 with the Co3O4@CN / SiO2 nanozyme prepared in S1. After adding ABS, add the chromogenic substrate TMB and H2O2 to react. After transferring the solution to a cuvette, scan it within a certain wavelength range using a UV-Vis spectrophotometer and compare the absorbance difference between the two peaks with that of the Co3O4@CN / SiO2 nanozyme prepared in S1. If the difference is large, the aptamer is effective. S2.2 Preparation of amorphous Co3O4@CN / SiO2 nanozyme adsorbent aptamers: The Co3O4@CN / SiO2 nanozyme prepared in S1 was dissolved in a solvent, and a small amount was added to a 1.5 mL centrifuge tube. Then, the aptamer solution prepared in S2.11 was added to the centrifuge tube. After incubation for 20 min, Co3O4@CN / SiO2-Apt was prepared. After adding ABS, the chromogenic substrate TMB and H2O2 were added and reacted at 37℃. The absorbance was measured at a wavelength of 652 nm using a UV-Vis spectrophotometer. The target analyte was added in the presence of Co3O4@CN / SiO2-Apt, and the target analyte was detected under the same conditions as above.

4. The method for preparing an aptamer colorimetric sensor constructed from an amorphous cobalt-based nanozyme according to claim 3, characterized in that, The solvent is DMSO, water, or ethanol; the aptamer is TCATCTATCTATGGTACATTACTATCTGTAATGTGATATG; in S2.11, the buffer solution is TE buffer, 1X, low EDTA, pH 8.

0.

5. The method for preparing an aptamer colorimetric sensor constructed from an amorphous cobalt-based nanozyme according to claim 3, characterized in that, The cuvette in S2.12 is either a quartz cuvette or a glass cuvette.

6. The method for preparing an aptamer colorimetric sensor constructed from an amorphous cobalt-based nanozyme according to claim 3, characterized in that, The chromogenic substrate in S2.12 is any one of 3,3',5,5'-tetramethylbenzidine (TMB), 2,2-azido-bis(3-ethyl-benzothiazoline-6-sulfonic acid) diammonium salt, and o-phenylenediamine; the chromogenic substrate in S2.12 is 3,3',5,5'-tetramethylbenzidine (TMB).

7. The aptamer colorimetric sensor constructed from amorphous cobalt-based nanozymes according to claim 3, characterized in that, The ABS buffer solution in S2.12 consists of a C2H3O2Na solution containing 0.2 mol / L and a CH3COOH solution containing 0.2 mol / L; the wavelength range in S2.12 refers to a wavelength of 652 nm; the incubation conditions in S2.12 are incubation at 37°C for 20 min; and the reaction conditions in S2.12 are reaction at 37°C for 10 min.

8. An application of an amorphous cobalt-based nanozyme-based aptamer colorimetric sensor, prepared using the method described in any one of claims 3-7, for the detection of zearalenone, characterized in that... The application includes the following steps: S3.1 Establish a standard working curve for the detection of zearalenone in zearalenone: S3.

11. Prepare an acetate buffer solution that does not participate in the chemical reaction as a base solution in a centrifuge tube; prepare a certain concentration of 3,3',5,5'-tetramethylbenzidine (TMB) as a colorimetric reagent; prepare a certain concentration of H2O2 as a substrate to activate the nanozyme to catalyze the oxidation and color development of TMB; S3.12 Dissolve zearalenone in a solvent that can dissolve it and does not react with zearalenone to prepare a zearalenone standard stock solution, and then prepare a series of zearalenone standard solutions of different concentrations. S3.

13. Add Co3O4@CN / SiO2 and Apt to a centrifuge tube, add the same volume of zearalenone standard solution prepared in S3.12 but with different concentrations, incubate at 37℃ for 20 min, then place in the solution prepared in S3.11, and add TMB and H2O2 with a certain concentration as described in S3.

11. React at 37℃ for 10 min, then transfer the solution to a quartz cuvette. Analyze the solution using a UV-Vis spectrophotometer at a wavelength of 652 nm. Record the absorbance of Co3O4@CN / SiO2 + Apt + ZEN as A, and the absorbance of Co3O4@CN / SiO2 + Apt as A0. Establish a standard working curve for zearalenone detection with ∆A as the ordinate (∆A = A - A0) and zearalenone concentration as the abscissa. S3.2 Rapid quantitative analysis of zearalenone in actual samples: Co3O4@CN / SiO2 and Apt were added to a centrifuge tube, along with a certain volume of the test solution containing an unknown concentration of zearalenone. After incubation, the acetate buffer solution prepared in S3.11 was added, along with TMB and H2O2 of a certain concentration as described in S3.

11. The mixture was reacted at 37°C for 10 min, and then the solution was transferred to a quartz cuvette. The absorbance of the solution was measured at a wavelength of 652 nm using a UV-Vis spectrophotometer. Finally, based on the zearalenone detection standard working curve established in S3.1, the measured absorbance value was substituted into the standard working curve to obtain the concentration of the unknown zearalenone in the actual sample.

9. The detection application according to claim 8, characterized in that, The matrix solution is an acetate buffer solution; the acetate buffer solution is a 0.2 mol / L mixed solution of acetic acid and sodium acetate.

10. The detection application according to claim 8, characterized in that, The method for preparing the zearalenone standard stock solution is as follows: zearalenone is dissolved in ethanol to prepare a zearalenone standard stock solution with a concentration of 0.001 mol / L.

Images