Application of combination of pectin methylesterase and pectin lyase in degradation of tobacco leaf pectin

Abstract

The invention discloses application of combination of pectin methylesterase and pectin lyase in degradation of tobacco leaf pectin, and is characterized in that the application comprises the following steps: weighing recombinant pectin methylesterase according to a proportion of 0.01-0.05% of the mass of tobacco leaves, weighing recombinant pectin lyase according to a proportion of 0.01-0.05% of the mass of the tobacco leaves, respectively diluting with deionized water, and mixing to obtain an enzyme mixed solution; uniformly spraying the enzyme mixed solution on the surfaces of the tobacco leaves; the sprayed tobacco leaves are subjected to fermentation treatment; after fermentation treatment is completed, heating the tobacco leaves to inactivate enzyme; wherein the nucleotide sequence of the recombinant pectin methylesterase is as shown in SEQ ID NO.3; and the nucleotide sequence of the recombinant pectin lyase is as shown in SEQ ID NO.6. The high-purity active enzyme is obtained through pichia pastoris heterologous expression, and the method is suitable for large-scale production; through the synergistic effect of the two enzymes, the pectin degradation rate of the tobacco leaves reaches 35.2%, the total sensory quality is improved by 2.68, and the degradation rate is higher than that of a single enzyme; the application amounts of the two enzymes are 0.03% respectively, namely the optimal effect is achieved, and the cost is controlled.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and enzyme engineering, and in particular to the application of pectin methyl esterase combined with pectin lyase in the degradation of tobacco pectin. Background Technology

[0002] Pectin is an important component of tobacco leaf cell walls, and excessive pectin content directly affects the sensory quality and safety of cigarettes. On the one hand, pectin easily decomposes during combustion to produce irritating substances such as methanol and formaldehyde, increasing the unpleasantness and irritation of the smoke and affecting the sensory experience of cigarettes. On the other hand, pectin can also cause tobacco leaves to stick together during processing and re-drying, reducing processing efficiency; it also increases the risk of incomplete combustion, further affecting cigarette quality. Therefore, the efficient degradation of tobacco leaf pectin has become an important issue for the tobacco industry.

[0003] Traditional chemical methods (such as acid and alkali treatment) can degrade pectin, but they alter the cell structure of tobacco leaves, leading to the loss of aroma substances and potentially leaving chemical residues that threaten product safety. In contrast, enzymatic hydrolysis has become a research focus due to its high efficiency and gentleness; however, the application of single enzyme preparations has not yielded ideal results.

[0004] When pectin methylesterase is used alone, it can only hydrolyze the methyl ester groups in pectin molecules to generate polygalacturonic acid, but it cannot break glycosidic bonds. Therefore, the molecular weight of pectin decreases only to a limited extent, making it difficult to thoroughly improve the combustion performance of tobacco leaves. When pectin lyase is used alone, due to the high degree of methyl esterification of natural pectin and the limited number of enzyme action sites, the catalytic efficiency is low. A large amount of enzyme preparation or a long reaction time is required to achieve a certain degradation effect, which not only increases the cost, but may also affect other quality indicators of tobacco leaves due to the excessively long reaction time.

[0005] Furthermore, natural enzyme sources generally suffer from low yield, insufficient purity, and poor stability, while conventional engineered bacterial recombinant expression technologies also suffer from low recombinant enzyme expression efficiency and insufficient activity due to issues such as vector selection and signal peptide efficiency, further limiting the large-scale application of enzymatic hydrolysis in the tobacco industry. Therefore, developing efficient compound enzyme preparations and combining them with genetic engineering technology to achieve heterologous and efficient expression of highly active recombinant enzymes has become a core direction for solving the problem of tobacco pectin degradation and promoting the upgrading of tobacco processing technology. Summary of the Invention

[0006] The technical problem to be solved by this invention is to provide the application of pectin methyl esterase combined with pectin lyase in the degradation of tobacco pectin. By constructing engineered bacteria that heterologously express pectin methyl esterase to achieve efficient and large-scale production of the enzyme, and by combining it with pectin lyase, the defects of traditional chemical methods for degrading tobacco pectin and the problems of low degradation efficiency and difficulty in taking into account the sensory quality and safety of tobacco leaves are overcome. Thus, the invention efficiently degrades pectin in tobacco leaves and improves the sensory quality and safety of cigarettes.

[0007] The technical problem to be solved by the present invention is achieved through the following technical solution:

[0008] The combined application of pectin methylesterase and pectin lyase in the degradation of tobacco pectin, the application comprising the following steps:

[0009] (1) Enzyme solution preparation: Weigh recombinant pectin methyl esterase at a ratio of 0.01-0.05% of the tobacco leaf weight, and weigh recombinant pectin lyase at a ratio of 0.01-0.05% of the tobacco leaf weight. Dilute them separately with deionized water and mix them to obtain an enzyme mixture.

[0010] (2) Spraying treatment: Spray the enzyme mixture evenly onto the surface of the tobacco leaves to ensure that the surface of each tobacco leaf is evenly covered by the enzyme solution.

[0011] (3) Fermentation treatment: Place the sprayed tobacco leaves in an environment of 20-45℃ and 45-70% relative humidity for 12-48 hours for fermentation treatment;

[0012] (4) Inactivation treatment: After the fermentation treatment is completed, the tobacco leaves are heated at 80-120℃ for 2-5 minutes to inactivate the enzymes;

[0013] The nucleotide sequence of the recombinant pectin methyl esterase is shown in SEQ ID NO.3, and the amino acid sequence of its encoded protein is shown in SEQ ID NO.2; the nucleotide sequence of the recombinant pectin lyase is shown in SEQ ID NO.6, and the amino acid sequence of its encoded protein is shown in SEQ ID NO.5; both the pectin methyl esterase and pectin lyase genes are derived from Aspergillus niger (strain ATCC MYA-4892) and obtained through heterologous expression in Pichia pastoris X-33.

[0014] Preferably, in the above technical solution, in step (1), the mass ratio of recombinant pectin methyl esterase to recombinant pectin lyase is 1:1.

[0015] Preferably, in the above technical solution, in step (1), the amount of recombinant pectin methyl esterase and recombinant pectin lyase added is 0.03% of the tobacco leaf mass.

[0016] Preferably, in the above technical solution, the tobacco leaf treatment conditions in step (3) are: temperature 30℃, relative humidity 55%, and static fermentation treatment for 30h.

[0017] Preferably, in the above technical solution, in step (4), the heating treatment conditions are 100°C for 3 to 4 minutes.

[0018] Preferably, in the above technical solution, the preparation method of the recombinant pectin methyl esterase includes the following steps:

[0019] (1) Construction of engineered bacteria: an engineered bacteria containing a recombinant expression vector was constructed. The recombinant expression vector was based on the Pichia pastoris expression vector pPICZαA and contained, in sequence, an AOX1 promoter, a yeast α-factor signal peptide coding sequence, the pectin methyl esterase coding gene shown in SEQ ID NO.1, a 6His purification tag coding sequence, and an AOX1 terminator.

[0020] (2) Seed culture: The engineered bacteria were inoculated into BMGY medium and cultured at 30℃ with shaking at 200r / min for 16-24 hours until the bacterial culture reached OD. 600 =2-6, to obtain seed liquid;

[0021] (3) Fermentation culture: Inoculate the seed liquid into BMMY fermentation medium at an inoculation rate of 10%, and ferment for 3-4 days at 30℃, pH 5.0-6.0, dissolved oxygen >20%, stirring speed 500-1500rpm, and aeration rate 0.1-1.0vvm.

[0022] (4) Separation and purification: After fermentation, the supernatant was collected by centrifugation; the pectin methyl esterase in the supernatant was purified by gel filtration chromatography and affinity chromatography to obtain high-purity pectin methyl esterase.

[0023] Preferably, in the above technical solution, the preparation method of the recombinant pectin lyase includes the following steps:

[0024] (1) Construction of engineered bacteria: an engineered bacteria containing a recombinant expression vector was constructed. The recombinant expression vector was based on the Pichia pastoris expression vector pPICZαA and contained, in sequence, an AOX1 promoter, a yeast α-factor signal peptide coding sequence, the pectin lyase coding gene shown in SEQ ID NO.4, a 6His purification tag coding sequence, and an AOX1 terminator.

[0025] (2) Seed culture: The engineered bacteria were inoculated into BMGY medium and cultured at 30℃ with shaking at 200r / min for 16-24 hours until the bacterial culture reached OD. 600 =2-6, to obtain seed liquid;

[0026] (3) Fermentation culture: Inoculate the seed liquid into BMMY fermentation medium at an inoculation rate of 10%, and ferment for 3-4 days at 30℃, pH 5.0-6.0, dissolved oxygen >20%, stirring speed 500-1500rpm, and aeration rate 0.1-1.0vvm.

[0027] (4) Separation and purification: After fermentation, the supernatant was collected by centrifugation; the pectin lyase in the supernatant was purified by gel filtration chromatography and affinity chromatography to obtain high-purity pectin lyase.

[0028] The above-described technical solution of the present invention has the following beneficial effects:

[0029] (1) Breaking through the limitations of traditional technology, the two enzymes work together to achieve efficient degradation of pectin. When used together, the degradation rate reaches up to 35.02%, which is far greater than that of single enzyme preparations, thus solving the problem of pectin's difficulty in degradation.

[0030] (2) Optimize enzyme production process and obtain high-purity, high-activity enzymes through technologies such as heterologous expression of Pichia pastoris to meet the needs of large-scale production;

[0031] (3) Improve the quality and safety of cigarettes, reduce the irritating substances in cigarettes, increase the total sensory score by up to 2.68 points, reduce tobacco leaf sticking, and improve processing efficiency;

[0032] (4) Controlling application costs: adding 0.03% of each of the two enzymes is sufficient to achieve optimal effect, avoiding excessive cost increase and making it economically valuable. Detailed Implementation

[0033] Various exemplary embodiments of the present invention will now be described in detail. It should be noted that, unless otherwise specifically stated, the relative arrangement, numerical expressions, and values ​​of the components and steps set forth in these embodiments do not limit the scope of the invention.

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials and reagents used are commercially available. Unless otherwise specified, the equipment used in the experiments is well known to those skilled in the art.

[0035] Example 1: Construction and expression verification of engineered strains of pectin methyl esterase

[0036] (1) Synthesis of pectin methyl esterase gene: Based on the optimized amino acid sequence of the pectin methyl esterase protein (pmeAn-pep2), as shown in SEQ ID NO.2, the corresponding nucleotide sequence (pmeAn-gene), as shown in SEQ ID NO.3, was derived using a codon optimization strategy. Subsequently, the pectin methyl esterase gene fragment was obtained using whole-genome synthesis technology to ensure the accuracy and stability of the gene sequence, laying the foundation for subsequent efficient expression.

[0037] (2) Construction of recombinant expression vector: The synthesized pectin methyl esterase gene fragment was ligated with the Pichia pastoris expression vector pPICZaA, which had been digested with a specific restriction endonuclease (selected based on the multiple cloning site and construction strategy of the Pichia pastoris expression vector pPICZaA). The ligation reaction was incubated overnight at 16°C under the catalysis of T4 DNA ligase to ensure the accuracy and efficiency of the ligation, thereby constructing the recombinant expression vector.

[0038] (3) Construction of engineered bacteria: The recombinant plasmid pPICZaA-pmeA was linearized by digesting it with SacI. Subsequently, the linearized recombinant plasmid was transformed into Pichia pastoris X-33 competent cells via electroporation or chemical transformation (following the standard procedure for the preparation and transformation of Pichia pastoris X-33 competent cells). The transformed cells were plated on YPD-resistant culture dishes supplemented with 100 μg / mL bleomycin (zeocin) and cultured under suitable conditions. Single colonies were picked from the culture dishes and identified by colony PCR and subsequent gene sequencing (to ensure the correctness and integrity of the inserted gene). Positive clones were screened, thus successfully constructing an engineered bacterium heterologously expressing pectin methyl esterase.

[0039] (4) Colony PCR identification: 15 single clones were randomly selected from each culture dish and resuspended in 10 μL of sterile ddH2O. 0.5 μL of the resuspended solution was used as a template and added to the following PCR reaction mixture: 5 μL of 2×dNTP mix, 0.2 μL of upstream primer 5'AOX (5'ctgctgatagcctaacgttc 3'), 0.2 μL of downstream primer 3'AOX (5'gctgatcaggagcaagctcg 3'), 0.5 μL of template, and sterile ddH2O to a total volume of 10 μL. The amplification reaction was performed according to the standard PCR amplification procedure. After the reaction, the PCR products were detected by agarose gel electrophoresis to identify positive clones.

[0040] (5) Expression and Identification (3mL System): Select positive clones with good colony PCR identification results, and transfer a small amount to each of the 24-well culture plates containing 2mL of BMGY medium. Incubate overnight at 30℃ and 200r / min in a constant temperature shaking incubator. The next day, remove the culture plate and let it stand at room temperature for 30min to allow the cells to settle naturally. Then carefully aspirate the supernatant, add 3mL of BMGY medium to the cell pellet, and add methanol at 1 / 100 of the medium volume to induce pectin methyl esterase expression. Place the culture plate back in a constant temperature shaking incubator at 30℃ and 200r / min for further incubation, adding an equal amount of methanol every 24h for a total of 72h of induction. After the induction is complete, collect the bacterial culture into a 1.5mL centrifuge tube, centrifuge at 10,000g for 1min to separate the medium from the cell pellet. Take 100 μL of supernatant and label it "Medium"; add 1 mL of 1×PBS buffer to the bacterial pellet, sonicate to disrupt the bacterial cells (sonication conditions should be set according to the standard operating procedure of the sonicator to ensure complete disruption of the cells and no impact on enzyme activity), centrifuge at 10,000 g for 1 min, and take 100 μL of supernatant and label it "NPE"; discard the excess supernatant, add 100 μL of 1×PBS (containing 8M urea) to the bacterial pellet, resuspend and mix well, and label it "DPE". Add 25 μL of 5× reducing loading buffer to each of the above samples, boil for 10 min, and perform SDS-PAGE detection. Based on the detection results, select positive strains with high protein expression levels as production engineering strains for subsequent large-scale fermentation production of pectin methyl esterase.

[0041] Example 2: Production of pectin methyl esterase by engineered bacteria

[0042] (1) Seed culture

[0043] The seed culture medium was prepared as follows: First, purchase the basal medium PM4020 (g / L): YNB (13.4), biotin 0.0004, yeast extract 10, peptone 20; then, prepare the seed culture medium (BMGY): Take one 0.5L packet of basal medium PM4020 (approximately 21.7g), dissolve it in deionized water, add 5mL of glycerol, and bring the volume to 450mL. Sterilize at 121℃ for 20 minutes. Simultaneously, prepare and sterilize 1M potassium phosphate buffer (or use ready-to-use product PML4280). After cooling, aseptically add 50mL of potassium phosphate buffer to the medium to prepare the seed culture medium (BMGY).

[0044] The engineered bacteria were inoculated into the seed culture medium and cultured at 30℃ and 200 rpm for 16-24 hours until the OD value was reached. 600 Reaching levels 2-6 yields seed liquid.

[0045] (2) Fermentation culture

[0046] Fermentation medium preparation

[0047] Take one 0.5L packet of basal culture medium PM4020 (approximately 21.7g), dissolve it in deionized water, and bring the volume to 447.5mL. Sterilize at 121℃ for 20 minutes, while simultaneously treating with 1M potassium phosphate buffer (or PML4280). After cooling, aseptically add 50mL of potassium phosphate buffer and 2.5mL of methanol to prepare fermentation medium (BMMY).

[0048] Prepare the fermentation base salt solution (1L): 26.7 mL of 85% phosphate, 0.93 g of calcium sulfate, 18.2 g of potassium sulfate, 14.9 g of magnesium sulfate heptahydrate, 4.13 g of potassium hydroxide, and 40.0 g of glycerol. Add water to 1 L, mix, filter, and sterilize.

[0049] Prepare a 1L PTM trace element solution: 6.0g copper sulfate pentahydrate, 0.08g sodium iodide, 3.0g manganese sulfate monohydrate, 0.2g sodium molybdate dihydrate, 0.02g boric acid, 0.5g cobalt chloride, 20.0g zinc chloride, 65.0g ferrous sulfate heptahydrate, 0.2g biotin, and 5.0ml sulfuric acid. Add water to a final volume of 1L. If a precipitate forms, filter the solution and store at room temperature for later use.

[0050] Fermentation process operation:

[0051] Inoculate the seed culture at a rate of 10% into the fermentation medium and ferment for 3-4 days at 30℃, pH 5.0-6.0, dissolved oxygen >20%, stirring speed 500-1500 rpm, and aeration rate of 0.1-1.0 vvm.

[0052] Glycerol batch culture stage: After sterilizing and cooling the fermenter with a basal salt medium containing 4% glycerol, adjust the temperature, stirring, aeration, and pH. Aseptically add PTM microsalt and culture until glycerol is depleted (DO reaches 100%). During this period, maintain DO > 20% and take samples regularly. Cell yield at this stage is 90-150 g / L wet cells, without recombinant protein.

[0053] Feed-on-batch culture phase with glycerol: At the start of glycerol depletion, feed 50% w / v glycerol containing 12 ml PTM trace salt / L at an initial fermentation volume rate of 18.15 ml / hr / L. Feed for approximately 4 hours or longer. At the end of the fermentation, cell yield should be 180-220 g / L wet cells with no significant recombinant protein. Feeding length can be optimized; a cell mass of 50-300 g / L wet cells is recommended, with a maximum glycerol content of 4% during the batch phase. Stop feeding when dissolved oxygen is low, and adjust aeration parameters after the DO peak.

[0054] In the fed-batch methanol culture stage: after stopping glycerol feeding, feed 100% methanol containing 12 ml / L of PTM trace salt at an initial fermentation volume rate of 3.6 ml / hr / L. The dissolved oxygen (DO) concentration (DO) in methanol is unstable for the first 2-3 hours, then stabilizes. If DO cannot be maintained above 20%, stop feeding methanol. After the DO peak, continue feeding, using methods such as increased stirring to maintain DO. After acclimatization to methanol (2-4 hours), maintain a low feed rate for 1 hour, then double it to 7.3 ml / hr / L. After 2 hours, increase it again to 10.9 ml / hr / L until fermentation ends, a total of approximately 70 hours. The initial methanol volume is approximately 740 ml / L, and the cell density can reach 350-450 g / L wet cells.

[0055] (3) Isolation and purification of enzymes

[0056] After fermentation is complete, the supernatant is collected by centrifugation.

[0057] Pectin methyl esterase in the fermentation broth was separated and purified by methods such as gel filtration and affinity chromatography to obtain high-purity pectin methyl esterase.

[0058] Example 3: Construction and Expression Validation of Pectin Lyase Engineered Strains

[0059] (1) Synthesis of pectin lyase gene: Based on the optimized amino acid sequence of the pectin lyase protein (pelA-pep2), as shown in SEQ ID NO.5, the corresponding nucleotide sequence (pelA-gene), as shown in SEQ ID NO.6, was derived using a codon optimization strategy. Subsequently, the pectin lyase gene fragment was obtained using whole-genome synthesis technology to ensure the accuracy and stability of the gene sequence, laying the foundation for subsequent efficient expression.

[0060] (2) Construction of recombinant expression vector: The synthesized pectin lyase gene fragment was ligated with the Pichia pastoris expression vector pPICZaA, which had been digested with a specific restriction endonuclease (selected based on the multiple cloning site and construction strategy of the Pichia pastoris expression vector pPICZaA). The ligation reaction was incubated overnight at 16°C under the catalysis of T4 DNA ligase to ensure the accuracy and efficiency of the ligation, thereby constructing the recombinant expression vector.

[0061] (3) Construction of engineered bacteria: The recombinant plasmid pPICZaA-pelA was linearized by digesting it with SacI. Subsequently, the linearized recombinant plasmid was transformed into Pichia pastoris X-33 competent cells via electroporation or chemical transformation (following the standard procedure for the preparation and transformation of Pichia pastoris X-33 competent cells). The transformed cells were plated on YPD-resistant culture dishes supplemented with 100 μg / mL bleomycin (zeocin) and cultured under suitable conditions. Single colonies were picked from the culture dishes and identified by colony PCR and subsequent gene sequencing (to ensure the correctness and integrity of the inserted gene). Positive clones were screened, thus successfully constructing the engineered bacteria heterologously expressing pectin lyase.

[0062] (4) Colony PCR identification: 15 single clones were randomly selected from each culture dish and resuspended in 10 μL of sterile ddH2O. 0.5 μL of the resuspended solution was used as a template and added to the following PCR reaction mixture: 5 μL of 2×dNTP mix, 0.2 μL of upstream primer 5'AOX (5'ctgctgatagcctaacgttc 3'), 0.2 μL of downstream primer 3'AOX (5'gctgatcaggagcaagctcg 3'), 0.5 μL of template, and sterile ddH2O to a total volume of 10 μL. The amplification reaction was performed according to the standard PCR amplification procedure. After the reaction, the PCR products were detected by agarose gel electrophoresis to identify positive clones.

[0063] (5) Expression and Identification (3mL System): Select positive clones with good colony PCR identification results, and transfer a small amount to each of the 24-well culture plates containing 2mL of BMGY medium. Incubate overnight at 30℃ and 200r / min in a constant temperature shaking incubator. The next day, remove the culture plates and let them stand at room temperature for 30min to allow the cells to settle naturally. Then carefully aspirate the supernatant, add 3mL of BMGY medium to the cell pellet, and add methanol at 1 / 100 of the medium volume to induce the expression of pectin lyase. Place the culture plates back in a constant temperature shaking incubator at 30℃ and 200r / min for further incubation, adding an equal amount of methanol every 24h, for a total induction of expression for 72h. After the induction of expression, collect the bacterial culture into a 1.5mL centrifuge tube, centrifuge at 10,000g for 1min to separate the medium from the cell pellet. Take 100 μL of supernatant and label it "Medium"; add 1 mL of 1×PBS buffer to the bacterial pellet, sonicate to disrupt the bacterial cells (sonication conditions should be set according to the standard operating procedure of the sonicator to ensure that the cells are fully disrupted and the enzyme activity is not affected), centrifuge at 10,000g for 1 min, and take 100 μL of supernatant and label it "NPE"; discard the excess supernatant, add 100 μL of 1×PBS (containing 8M urea) to the bacterial pellet, resuspend and mix well, and label it "DPE". Add 25 μL of 5× reducing loading buffer to each of the above samples, boil for 10 min, and perform SDS-PAGE detection. Based on the detection results, select positive strains with high protein expression levels as production engineering strains for subsequent large-scale fermentation production of pectin lyase.

[0064] Example 4: Production of pectin lyase by engineered bacteria through fermentation

[0065] (1) Seed culture

[0066] The seed culture medium was prepared as follows: First, purchase the basal medium PM4020 (g / L): YNB (13.4), biotin 0.0004, yeast extract 10, peptone 20; then, prepare the seed culture medium (BMGY): Take one 0.5L packet of basal medium PM4020 (approximately 21.7g), dissolve it in deionized water, add 5mL of glycerol, and bring the volume to 450mL. Sterilize at 121℃ for 20 minutes. Simultaneously, prepare and sterilize 1M potassium phosphate buffer (or use ready-to-use product PML4280). After cooling, aseptically add 50mL of potassium phosphate buffer to the medium to prepare the seed culture medium (BMGY).

[0067] The engineered bacteria were inoculated into the seed culture medium and cultured at 30℃ and 200 rpm for 16-24 hours until the OD value was reached. 600 Reaching levels 2-6 yields seed liquid.

[0068] (2) Fermentation culture

[0069] Fermentation medium preparation:

[0070] Take one 0.5L packet of basal culture medium PM4020 (approximately 21.7g), dissolve it in deionized water, and bring the volume to 447.5mL. Sterilize at 121℃ for 20 minutes, while simultaneously treating with 1M potassium phosphate buffer (or PML4280). After cooling, aseptically add 50mL of potassium phosphate buffer and 2.5mL of methanol to prepare fermentation medium (BMMY).

[0071] Prepare the fermentation base salt solution (1L): 26.7 mL of 85% phosphate, 0.93 g of calcium sulfate, 18.2 g of potassium sulfate, 14.9 g of magnesium sulfate heptahydrate, 4.13 g of potassium hydroxide, and 40.0 g of glycerol. Add water to 1 L, mix, filter, and sterilize.

[0072] Prepare a 1L PTM trace element solution: 6.0g copper sulfate pentahydrate, 0.08g sodium iodide, 3.0g manganese sulfate monohydrate, 0.2g sodium molybdate dihydrate, 0.02g boric acid, 0.5g cobalt chloride, 20.0g zinc chloride, 65.0g ferrous sulfate heptahydrate, 0.2g biotin, and 5.0ml sulfuric acid. Add water to a final volume of 1L. If a precipitate forms, filter the solution and store at room temperature for later use.

[0073] Fermentation process operation:

[0074] Inoculate the seed culture at a rate of 10% into the fermentation medium and ferment for 3-4 days at 30℃, pH 5.0-6.0, dissolved oxygen >20%, stirring speed 500-1500 rpm, and aeration rate of 0.1-1.0 vvm.

[0075] Glycerol batch culture stage: After sterilizing and cooling the fermenter with a basal salt medium containing 4% glycerol, adjust the temperature, stirring, aeration, and pH. Aseptically add PTM microsalt and culture until glycerol is depleted (DO reaches 100%). During this period, maintain DO > 20% and take samples regularly. Cell yield at this stage is 90-150 g / L wet cells, without recombinant protein.

[0076] Feed-on-batch culture phase with glycerol: At the start of glycerol depletion, feed 50% w / v glycerol containing 12 ml PTM trace salt / L at an initial fermentation volume rate of 18.15 ml / hr / L. Feed for approximately 4 hours or longer. At the end of the fermentation, cell yield should be 180-220 g / L wet cells with no significant recombinant protein. Feeding length can be optimized; a cell mass of 50-300 g / L wet cells is recommended, with a maximum glycerol content of 4% during the batch phase. Stop feeding when dissolved oxygen is low, and adjust aeration parameters after the DO peak.

[0077] In the fed-batch methanol culture stage: after stopping glycerol feeding, feed 100% methanol containing 12 ml / L of PTM trace salt at an initial fermentation volume rate of 3.6 ml / hr / L. The dissolved oxygen (DO) concentration (DO) in methanol is unstable for the first 2-3 hours, then stabilizes. If DO cannot be maintained above 20%, stop feeding methanol. After the DO peak, continue feeding, using methods such as increased stirring to maintain DO. After acclimatization to methanol (2-4 hours), maintain a low feed rate for 1 hour, then double it to 7.3 ml / hr / L. After 2 hours, increase it again to 10.9 ml / hr / L until fermentation ends, a total of approximately 70 hours. The initial methanol volume is approximately 740 ml / L, and the cell density can reach 350-450 g / L wet cells.

[0078] (3) Enzyme isolation and purification:

[0079] After fermentation is complete, the supernatant is collected by centrifugation.

[0080] High-purity pectin lyase was obtained by separating and purifying the pectin lyase in the fermentation broth using methods such as gel filtration and affinity chromatography.

[0081] Example 5: Application of pectin methylesterase combined with pectin lyase in tobacco

[0082] Dilute pectin methyl esterase and pectin lyase with water respectively, and spray them evenly on the surface of tobacco leaves according to the application amount in Table 1. Ferment for 12-48 hours at 20-45℃ and 45-70% humidity. After the treatment, heat the tobacco leaves (e.g., heat at 80-120℃ for 2-5 minutes) to deactivate the enzymes.

[0083] To determine the effects of pectin degradation and sensory quality improvement on tobacco leaves, a blank control group (CK) was established (equal amounts of water were evenly sprayed onto the surface of tobacco leaves). The pectin degradation rate in the control group and different treatment groups was measured, and sensory quality was evaluated. Pectin content was determined using the carbazole sulfuric acid spectrophotometric method. Sensory quality evaluation was conducted by professional judges, who assessed the aroma quality (A), aroma quantity (B), concentration (C), smoothness (D), aftertaste (E), off-flavors (F), and irritation (G) of the tobacco leaves. Each indicator was scored on a 9-point scale. The total sensory evaluation score (T) was calculated as (A+B)×2.3+C×1.5+D+E+F+G.

[0084] As shown in Tables 2 and 3, when a single enzyme preparation is used for treatment, as the amount of pectin methyl esterase and pectin lyase applied increases, the pectin content in tobacco leaves continues to decrease, and the sensory quality of tobacco leaves continues to improve. The pectin degradation rate can reach 31.00% and 32.73%, respectively, and the total sensory quality score can be increased by 1.58 points and 1.53 points, respectively.

[0085] When two enzyme preparations are used in combination, the pectin content in tobacco leaves continuously decreases and the sensory quality of tobacco leaves continuously improves with increasing application rates of pectin methyl esterase and pectin lyase. Furthermore, the effects of pectin degradation and sensory quality improvement are significantly higher than those achieved with a single enzyme preparation. When both pectin methyl esterase and pectin lyase are applied at 0.03%, the pectin degradation rate reaches 35.02%, and the total sensory quality score improves by 2.68 points. As the application rates of pectin methyl esterase and pectin lyase continue to increase, although the pectin degradation rate slightly improves, the sensory quality of tobacco leaves decreases slightly. Considering factors such as application cost, the optimal application rate for the combined use of pectin methyl esterase and pectin lyase is 0.03%.

[0086] Table 1. Application rates of pectin methyl esterase and pectin lyase in tobacco leaves

[0087]

[0088] Table 2. Effects of different amounts of pectin methylesterase and pectin lyase on the degradation rate of pectin in tobacco leaves.

[0089]

[0090]

[0091] Table 3. Effects of different amounts of pectin methylesterase and pectin lyase on the sensory quality of tobacco leaves.

[0092]

[0093] Although the present invention has been disclosed above with reference to embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various different choices and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention is defined by the claims and their equivalents.

Claims

1. The application of pectin methyl esterase combined with pectin lyase in the degradation of tobacco pectin, characterized in that, The application includes the following steps: (1) Enzyme solution preparation: Weigh recombinant pectin methyl esterase at a ratio of 0.01-0.05% of the tobacco leaf weight, and weigh recombinant pectin lyase at a ratio of 0.01-0.05% of the tobacco leaf weight. Dilute them separately with deionized water and mix them to obtain an enzyme mixture. (2) Spraying treatment: Spray the enzyme mixture evenly onto the surface of the tobacco leaves to ensure that the surface of each tobacco leaf is evenly covered by the enzyme solution. (3) Fermentation treatment: Place the sprayed tobacco leaves in an environment of 20-45℃ and 45-70% relative humidity for 12-48 hours for fermentation treatment; (4) Inactivation treatment: After the fermentation treatment is completed, the tobacco leaves are heated at 80-120℃ for 2-5 minutes to inactivate the enzymes; The nucleotide sequence of the recombinant pectin methylesterase is shown in SEQ ID NO.3, and the amino acid sequence of its encoded protein is shown in SEQ ID NO.2; the nucleotide sequence of the recombinant pectin lyase is shown in SEQ ID NO.6, and the amino acid sequence of its encoded protein is shown in SEQ ID NO.

5.

2. The application according to claim 1, characterized in that, In step (1), the mass ratio of recombinant pectin methylesterase to recombinant pectin lyase is 1:

1.

3. The application according to claim 1, characterized in that, In step (1), the amount of recombinant pectin methyl esterase and recombinant pectin lyase added is 0.03% of the tobacco leaf mass.

4. The application according to claim 1, characterized in that, In step (3), the tobacco leaf treatment conditions are: temperature 30℃, relative humidity 55%, and static fermentation treatment for 30h.

5. The application according to claim 1, characterized in that, In step (4), the heating conditions are 100℃ for 3 to 4 minutes.

6. The application according to claim 1, characterized in that, The preparation method of the recombinant pectin methyl esterase includes the following steps: (1) Construction of engineered bacteria: an engineered bacteria containing a recombinant expression vector was constructed. The recombinant expression vector was based on the Pichia pastoris expression vector pPICZαA and contained, in sequence, an AOX1 promoter, a yeast α-factor signal peptide coding sequence, the pectin methyl esterase coding gene shown in SEQ ID NO.1, a 6His purification tag coding sequence, and an AOX1 terminator. (2) Seed culture: The engineered bacteria were inoculated into BMGY medium and cultured at 30℃ and 200r / min for 16-24 hours with shaking until the bacterial culture reached OD. 600 =2-6, to obtain seed liquid; (3) Fermentation culture: Inoculate the seed liquid into BMMY fermentation medium at an inoculation rate of 10%, and ferment for 3-4 days at 30℃, pH 5.0-6.0, dissolved oxygen >20%, stirring speed 500-1500rpm, and aeration rate 0.1-1.0vvm. (4) Separation and purification: After fermentation, the supernatant was collected by centrifugation; the pectin methyl esterase in the supernatant was purified by gel filtration chromatography and affinity chromatography to obtain high-purity pectin methyl esterase.

7. The application according to claim 1, characterized in that, The preparation method of the recombinant pectin lyase includes the following steps: (1) Construction of engineered bacteria: an engineered bacteria containing a recombinant expression vector was constructed. The recombinant expression vector was based on the Pichia pastoris expression vector pPICZαA and contained, in sequence, an AOX1 promoter, a yeast α-factor signal peptide coding sequence, the pectin lyase coding gene shown in SEQ ID NO.4, a 6His purification tag coding sequence, and an AOX1 terminator. (2) Seed culture: The engineered bacteria were inoculated into BMGY medium and cultured at 30℃ and 200r / min for 16-24 hours with shaking until the bacterial culture reached OD. 600 =2-6, to obtain seed liquid; (3) Fermentation culture: Inoculate the seed liquid into BMMY fermentation medium at an inoculation rate of 10%, and ferment for 3-4 days at 30℃, pH 5.0-6.0, dissolved oxygen >20%, stirring speed 500-1500rpm, and aeration rate 0.1-1.0vvm. (4) Separation and purification: After fermentation, the supernatant was collected by centrifugation; the pectin lyase in the supernatant was purified by gel filtration chromatography and affinity chromatography to obtain high-purity pectin lyase.

Images