Gene editing to improve joint function

Abstract

The present invention provides compositions and methods for treating joint disorders characterized by inflammatory components. In certain aspects, the compositions and methods are useful for preventing the progression of and treating osteoarthritis and other arthritis in mammalian joints.

Description

[0001] This application is a divisional of Chinese Invention Patent Application No. 2020800196186, filed on January 17, 2020, with the title of “Gene Editing to Improve Joint Function”.

[0002] Cross Reference to Related Applications

[0003] This application claims priority to U.S. Provisional Patent Application No. 62 / 794,340, filed January 18, 2019, U.S. Provisional Patent Application No. 62 / 894,184, filed August 30, 2019, and U.S. Provisional Patent Application No. 62 / 914,635, filed October 14, 2019, which are incorporated by reference in their entirety. TECHNICAL FIELD

[0004] Described herein are compositions and methods for treating synovial joint dysfunction. In addition, disclosed herein are methods of gene editing synovial cells and / or synoviocytes, chondrocytes, synovial macrophages, and synovial fibroblasts, and uses of gene edited synovial cells and / or synoviocytes, chondrocytes, synovial macrophages, and synovial fibroblasts in treating diseases such as osteoarthritis. BACKGROUND

[0005] Treatment of osteoarthritis, degenerative joint disease, and other joint dysfunctions is complex and there are few long-term options for symptom relief or restoration of joint function. Osteoarthritis (OA) is a leading cause of disability due to pain. Neogi, Osteoarthritis Cartilage 2013; 21: 1145-53. All mammalian species are affected: depending on the extent of disease progression, working animals, domesticated pets, and their owners all suffer from the discomfort, pain, and disability associated with OA.

[0006] OA is a complex disease characterized by a progressive, disabling process. Systemic inflammation is associated with OA and OA disease progression. Inflammation is driven by elevated levels of pro-inflammatory cytokines. There is an urgent need for new methods and compositions to treat this disease. Disclosed herein are compositions and methods useful for treating OA, as well as other inflammatory joint disorders.

[0007] Reference to a “Sequence Listing,” Table, or Computer Program Appendix Submitted on Compact Disc

[0008] The sequence listing, which is contained in the file named "Sequence_Listing_123994-5001-WO.txt" and having a size of 17.1 KB, was filed herewith via EFS-Web and is hereby incorporated by reference in its entirety. SUMMARY

[0009] The present disclosure provides compositions and methods for treating joint disorders characterized by an inflammatory component. In certain instances, the compositions and methods are used to prevent the progression of and treat osteoarthritis and other arthritic conditions in a joint of a mammal. According to exemplary embodiments, at least a portion of the synovial cells and / or synoviocytes, chondrocytes, synovial macrophages, or synovial fibroblasts in the joint are genetically edited to reduce the expression of inflammatory cytokines. In certain instances, at least a portion of the synovial cells and / or synoviocytes, chondrocytes, synovial macrophages, or synovial fibroblasts in the joint are genetically edited to reduce the expression of IL-1a, IL-1b, or both IL-1a and IL-1b.

[0010] In certain embodiments, the genetic editing silences or reduces the expression of one or more cytokine and / or growth factor genes in at least a portion of the cells comprising the joint of the mammal. In certain instances, the cells are synovial cells and / or synoviocytes. In certain instances, the cells are synovial fibroblasts. In certain instances, the cells are synovial cells and / or synoviocytes. In certain instances, the cells are chondrocytes. In certain instances, the cells are synovial macrophages.

[0011] In certain embodiments, the one or more cytokine and / or growth factor genes are selected from the group consisting of IL-1a and IL-1b.

[0012] In certain embodiments, the genetic editing comprises the use of a programmable nuclease that mediates the generation of a double-stranded or single-stranded break at the one or more cytokine and / or growth factor genes.

[0013] In certain embodiments, the genetic editing comprises one or more methods selected from the group consisting of CRISPR methods, TALE methods, zinc finger methods, and combinations thereof.

[0014] In certain embodiments, the genetic editing comprises a CRISPR method.

[0015] In certain embodiments, the CRISPR method is a CRISPR-Cas9 method.

[0016] In certain embodiments, the gene editing comprises a TALE method.

[0017] In certain embodiments, the gene editing comprises a zinc finger method.

[0018] In certain embodiments, the gene editing silences or reduces expression of one or more cytokine and / or growth factor genes in at least a portion of cells comprising the joint. In certain embodiments, the portion of edited cells are synovial cells and / or synoviocytes. In one instance, the portion of edited cells are synovioblasts. In certain embodiments, the portion of edited cells are synovial cells and / or synoviocytes. In certain embodiments, the portion of edited cells are chondrocytes. In certain embodiments the portion of edited cells are synovioblast macrophages.

[0019] In certain embodiments, the gene editing system is delivered using an adeno-associated virus (AAV) delivery system. In certain embodiments, the AAV delivery system is injected into the joint.

[0020] Certain aspects of the present disclosure provide a pharmaceutical composition for treating or preventing a joint disease or disorder, comprising a gene editing system and a pharmaceutically acceptable carrier. In one instance, the gene editing system comprises one or more nucleic acids targeting one or more loci selected from the group consisting of IL-1a, IL-1b, TNF-a, IL-6, IL-8, and IL-18.

[0021] One embodiment provides a method of treating a dog's lameness, the method comprising administering a gene editing composition, wherein the composition silences or reduces expression of IL-1a and IL-1b in a portion of synovial cells, chondrocytes, synovioblast macrophages, or synovioblast fibroblasts in a joint of the lameness.

[0022] In certain embodiments, the above methods further comprise one or more features recited in any of the methods and compositions described herein. BRIEF DESCRIPTION OF DRAWINGS

[0023] The presently disclosed embodiments will be further explained with reference to the drawings. The illustrated embodiments are not necessarily drawn to scale, but emphasis instead is placed upon illustrating the principles of the presently disclosed embodiments.

[0024] Figure 1A Figure 1 shows the use of 0.5 pg SpyCas9 (TrueCut TMAgarose gel electrophoresis analysis of 100 ng of mouse DNA (gBlocks, Integrated DNA Technologies) designed against mouse Il1a and Il1b genes cleaved in vitro with Cas9 protein v2 (ThermoFisher Scientific) and 200 ng of phosphorothioate-modified single guide (sg) RNAs targeting the Il1a gene (#43-46) and the Il1b gene (#47-50); Figure 1B Agarose gel electrophoresis analysis of 100 ng of mouse DNA (gBlocks, Integrated DNA Technologies) designed against mouse Il1a and Il1b genes cleaved with 0.5 pg SauCas9 (GeneSnipper TM Agarose gel electrophoresis analysis of 100 ng of mouse DNA (gBlocks, Integrated DNA Technologies) designed against mouse Il1a and Il1b genes cleaved with Cas9 (BioVision) and 200 ng of phosphorothioate-modified guide sgRNAs against the Il1a (#51-53) and IL1b (#54-56) genes.

[0025] Figure 2A 2D plot showing editing efficiency of SpyCas9 and SauCas9 with various guide RNAs in J774.2 (“J”) and NIH3T3 (“N”) cells; Figure 2A In vivo cleavage of Il1a edited with 4x sgRNAs (Spy Cas9) in two cell lines, NIH 3T3 (“N”) and J774.2 (“J”), in two independent pools (pool 1 and 2); Figure 2B In vivo cleavage of Il1b edited with 4x sgRNAs (Spy Cas9) in two cell lines, NIH 3T3 (“N”) and J774.2 (“J”), in two independent pools (pool 1 and 2); Figure 2C In vivo cleavage of Il1a edited with 3x sgRNA (Sau Cas9) in two cell lines, NIH 3T3 (“N”) and J774.2 (“J”), in two independent pools (pool 1 and 2); Figure 2D In vivo cleavage of Il1b edited with 3x sgRNAs (saCas9) in two cell lines, NIH 3T3 (“N”) and J774.2 (“J”), in two independent pools (pool 1 and 2); editing efficiency determined using deconvolution of Sanger sequencing traces (ICE tool, Synthego) for each pool.

[0026] Figure 3GFP expression was shown using the IVIS system. Flux values are based on regions of interest centered on the injected knee joint of the animal. Data are presented as the mean (SD) of four samples per group.

[0027] As explained in the discussion, other embodiments are contemplated as the above-defined figures illustrate the presently disclosed embodiments. The present disclosure presents exemplary embodiments in a representative, but not limiting, manner. Those skilled in the art can devise numerous other modifications and embodiments falling within the scope and spirit of the presently disclosed embodiments. DETAILED DESCRIPTION

[0028] As used herein, embodiments of the present application provide compositions and methods for improving joint function and treating joint disease. In particular embodiments, compositions and methods are provided for gene editing of synovioblasts, synoviocytes, chondrocytes, or synoviocyte macrophages to reduce expression of inflammatory cytokines such as IL-1a, IL-1b, TNF-a, IL-6, IL-8, IL-18, one or more matrix metalloproteinases (MMPs), or one or more components of the NLRP3 inflammasome. Embodiments are used to treat osteoarthritis and other inflammatory joint diseases. Embodiments are also useful for treating canine lameness resulting from osteoarthritis. Embodiments are also useful for treating equine lameness resulting from joint disease. Embodiments are also useful for treating post-traumatic arthritis, gout, pseudogout, and other inflammation-mediated or immune-mediated joint diseases.

[0029] DEFINITIONS

[0030] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. All patents and publications referred to herein are incorporated by reference in their entirety.

[0031] The term "in vivo" refers to an event that occurs within the body of a subject.

[0032] The term "in vitro" refers to an event that occurs outside the body of a subject. In vitro assays encompass cell-based assays using live or dead cells, and can also encompass cell-free assays that do not use intact cells.

[0033] The term "ex vivo" refers to an event that involves the treatment or performance of a procedure on cells, tissues, and / or organs that have been removed from the body of a subject. The cells, tissues, and / or organs can be returned to the body of the subject in a surgical or therapeutic procedure, as appropriate.

[0034] The term "IL-1" (also referred to herein as "IL1") refers to the proinflammatory cytokine known as interleukin-1 and includes all forms of IL-1, including IL1-alpha and IL-1 beta, human and mammalian forms, conserved amino acid substitutions, glycoforms, biosimilars, and variants thereof. IL-1 alpha and IL-1 beta bind to the same receptor molecule, which is known as the type I IL-1 receptor (IL-1RI). A third ligand for this receptor exists: interleukin 1 receptor antagonist (IL-1Ra), which does not activate downstream signaling and thus acts as an inhibitor of IL-1 alpha and IL-1 beta signaling by competing with IL-1 alpha and IL-1 beta for the binding site of the receptor. See, e.g., Dinarello, Blood 117:3720-32 (2011) and Weber et al., Science Signaling 3(105):cm1, doi:10.1126 / scisignal.3105cm1. IL-1 is described, e.g., in Dinarello, Cytokine Growth Factor Rev. 8:253-65 (1997), the disclosure of which is incorporated herein by reference. For example, the term IL-1 encompasses human, recombinant forms of IL-1.

[0035] Table 1. Amino acid sequences of interleukins

[0036]

[0037]

[0038] The term "NLRP3 inflammasome" refers to a multi-protein complex responsible for the activation of certain inflammatory responses. The NMRP3 inflammasome promotes the production of functional proinflammatory cytokines such as IL-1 beta and IL-18. The core components of the NLRP3 inflammasome are NLRP3, ASC (apoptosis-associated speck-like protein containing CARD), and caspase-1, as described in Lee et al., Lipids Health Dis. 16:271 (2017) and Groslambert and Py, J. Inflamm. Res. 11:359-374 (2018).

[0039] The terms "matrix metalloproteinase" and "MMP" are defined as any member of the matrix metalloproteinase family of zinc endopeptidases, as characterized by Fanjul-Fernandez et al., Biochem. Biophys. Acta 1803:3-19 (2010). In the art, family members are often referred to as pro-MMPs, gelatinases, matrilysins, and / or furin-activatable MMPs. As used herein, "matrix metalloproteinase" and "MMP" encompass the entire MMP family, including but not limited to MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-10, MMP-11, MMP-12, MMP-13, MMP-14, MMP-15, MMP-16, MMP-17, MMP-18, MMP-19, MMP-20, MMP-21, MMP-23, MMP-25, MMP-26, MMP-27, and MMP-28.

[0040] As used herein, the terms "co-administration" or "co-administering," "administered in combination with" or "administering in combination with," and "simultaneous" or "concurrent" encompass the administration of two or more active pharmaceutical ingredients (in preferred embodiments of the application, for example, at least one anti-inflammatory compound in combination with a viral vector functionally engineered to deliver a gene editing nucleic acid described herein) to a subject such that both active pharmaceutical ingredients and / or their metabolites are present in the subject at the same time. Co-administration includes administration in separate compositions, administration at different times in separate compositions, or administration in a composition in which two or more active pharmaceutical ingredients are present. Administration in separate compositions and administration in a composition in which two agents are present are preferred.

[0041] The term "effective amount" or "therapeutically effective amount" refers to the amount of a composition or combination of compositions described herein that is sufficient to achieve a desired application including but not limited to the treatment of a disease. The therapeutically effective amount can vary depending on the desired application (in vitro or in vivo) or the subject and disease condition being treated (e.g., the weight, age, and sex of the subject), the severity of the disease condition, or the mode of administration. The term also applies to a dose that induces a specific response in target cells (e.g., a reduction in platelet adhesion and / or cell migration). The specific dose will vary depending on the particular composition chosen, the dosing regimen being followed, whether the composition is being administered in combination with other compositions or compounds, the timing of administration, the tissue to which it is being administered, and the physical delivery system carrying the composition.

[0042] The terms "treatment," "treating," "treat," and the like, refer to obtaining a desired pharmacologic and / or physiologic effect. The effect can be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or can be therapeutic in terms of a partial or complete cure for a disease and / or adverse effect attributable to the disease. "Treatment" as used herein covers any treatment of a disease in a mammal, particularly in a human, canine, feline, or equine, and includes: (a) preventing the disease from occurring in a subject which can be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development or progression; and (c) relieving the disease, i.e., causing regression of the disease and / or alleviating one or more symptoms of the disease. "Treatment" is also meant to encompass the delivery of a pharmaceutical agent so as to provide a pharmacological effect, even in the absence of a disease or condition. For example, "treatment" encompasses the delivery of a composition that can elicit an immune response or confer immunity, such as in the case of a vaccine, in the absence of a disease condition. It is understood that the compositions and methods of the present application are applicable to the treatment of all mammals, including, but not limited to, human, canine, feline, equine, and bovine subjects.

[0043] The term "heterologous," when used in reference to a portion of a nucleic acid or protein, indicates that the nucleic acid or protein comprises two or more subsequences that are not found in the same relationship to each other in nature. For example, the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged in a new configuration, e.g., a promoter from one source and a coding region from another source, or multiple coding regions from different sources. Similarly, a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).

[0044] In the context of two or more nucleic acids or polypeptides, the terms "sequence identity," "percent identity," and "percent sequence identity" (or synonyms thereof, e.g., "99% identical") mean that two or more sequences or subsequences are identical, or that a specified percentage of nucleotides or amino acid residues are identical, when aligned for maximum correspondence, and compared, over the entire length of the sequences or subsequences, and that any conservative substitutions are not considered as part of the sequence identity. Percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various different algorithms and software are known in the art for obtaining an alignment of amino acid or nucleotide sequences. Programs suitable for determining percent sequence identity include, for example, the BLAST suite of programs available from the National Center for Biotechnology Information BLAST web site of the United States government. Comparison between two sequences can be performed using the BLASTN or BLASTP algorithm. BLASTN is used for comparing nucleic acid sequences, while BLASTP is used for comparing amino acid sequences. ALIGN, ALIGN-2 (Genentech, South San Francisco, California), or MegAlign, available from DNASTAR, are other publicly available software programs that can be used to align sequences. ClustalW and ClustalX can be used to produce alignments, Larkin et al., Bioinformatics 23:2947-2948 (2007); Goujon et al., Nucleic Acids Research, 38 Suppl: W 695-9 (2010); and McWilliam et al., Nucleic Acids Research 41 (Web

[0045] The term "variant" when used herein includes, but is not limited to, an antibody or fusion protein comprising an amino acid sequence that differs from that of a reference antibody by one or more substitutions, deletions, and / or additions in certain positions within or near the amino acid sequence of the reference antibody. The variant can comprise one or more conservative substitutions in its amino acid sequence compared to the amino acid sequence of the reference antibody. Conservative substitutions can include, for example, substitutions of amino acids with similar charges or no charge. The variant retains the ability to specifically bind to an antigen of the reference antibody. The term variant also includes a PEGylated antibody or protein.

[0046] As used herein, "carrier" or "vehicle" refers to a carrier material that is suitable for pharmaceutical administration. Carriers and vehicles useful herein include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and inert ingredients known in the art. The use of such media and agents for pharmaceutically active substances is known in the art.

[0047] The phrase "pharmaceutically acceptable" means a compound, material, composition, and / or dosage form that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit / risk ratio.

[0048] The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and inert ingredients in the formulation of active pharmaceutical ingredients. The use of such media and agents for active pharmaceutical ingredients is known in the art. Except insofar as any conventional media or agent is incompatible with the active pharmaceutical ingredients, its use in the therapeutic compositions of the application is contemplated. Other active pharmaceutical ingredients, such as other drugs, can also be incorporated into the compositions and methods described.

[0049] The term "pharmaceutically acceptable excipient" is intended to include media and vehicles that are capable of enhancing the performance of a compound co-administered therewith to facilitate the manifestation of its intended function. The use of such media in pharmaceutical active substances is well known in the art. Examples of such media and vehicles include solutions, solvents, dispersion media, retardants, emulsions, and the like. Any other conventional carrier suitable for use with the multi-binding compound is also within the scope of the present disclosure.

[0050] As used herein, the singular forms "a", "an" and "the" are intended to include both singular and plural forms, unless the context clearly indicates otherwise.

[0051] The terms "about" and "approximately" mean within a statistically meaningful range of values. Such a range can be within one order of magnitude of a given value or range, preferably within 50% of a given value or range, more preferably within 20%, more preferably within 10%, even more preferably within 5%. The permissible variation encompassed by the terms "about" or "approximately" will depend on the particular system under study and can be readily appreciated by one of ordinary skill in the art. Moreover, the terms "about" and "approximately," when used herein, mean that a dimension, size, formula, parameter, shape or other quantity or characteristic is not and need not be exact, but can be approximated and / or greater or lesser, reflecting tolerances, conversion factors, rounding off, measurement error, and the like, as well as the other factors known to those of skill in the art. In general, a dimension, size, formula, parameter, shape or other quantity or characteristic is "about" or "approximately," whether or not expressly stated. It should be noted that embodiments that differ very significantly from the shape and the dimensions described can utilize the arrangements described.

[0052] The term "substantially," when used in the present disclosure, can mean a majority or a substantial number, such as at least about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or at least about 99.999% or more.

[0053] The transitional terms "comprising," "consisting essentially of, and "consisting of," when used in the appended claims, define the scope of the claims in which the transitional terms are used in relation to those elements or steps that are recited in the claims. The term "comprising" is intended to be inclusive or open-ended and does not exclude any additional, unrecited elements, method steps, or materials. The term "consisting of" excludes any element, step, or material not specified in the claim, and in the latter case, excludes impurities that are normally associated with the specified materials. The term "consisting essentially of" limits the scope of a claim to the specified elements, steps, or materials plus those that do not materially affect the basic and novel characteristic(s) of the claimed application. In alternative embodiments of the present application, all the compositions, methods, and kits described herein can be defined in the alternative using any of the transitional terms "comprising," "consisting essentially of," and "consisting of."

[0054] "Joint disease" is defined as a measurable abnormality in the cells or tissues of a joint that can cause disease, such as metabolic and molecular derangements that initiate anatomic and / or physiologic changes in the joint. This includes, but is not limited to, radiographic detection of joint space narrowing, subchondral sclerosis, subchondral cysts, and osteophyte formation.

[0055] “Joint morbidity” is defined in a human subject as a symptom, such as pain, stiffness, swelling, or inability to move, reported by the subject that drives the subject to seek medical intervention. For non-human mammals, “joint morbidity” is defined as an observable change in, for example, lameness, gait, weight bearing, allodynia, or exploratory behavior.

[0056] As used herein, sgRNA (single guide RNA) is an RNA, preferably a synthetic RNA, composed of a targeting sequence and a scaffold. It is used to guide Cas9 to a specific genomic locus in genome engineering experiments. The sgRNA can be administered or formulated, for example, as a synthetic RNA or as a nucleic acid comprising a sequence encoding the gRNA, which is then expressed in the target cell.

[0057] As used herein, “Cas9” refers to a CRISPR-associated protein; Cas9 nuclease is the active enzyme used for type II CRISPR system. “nCas9” refers to a Cas9 in which one of the two nuclease domains, either the RuvC or HNH domain, is inactivated. nCas9 can only cut one strand of the target DNA (“nickase”).

[0058] As used herein, “PAM” refers to a protospacer adjacent motif, which is necessary for Cas9 to bind to a target DNA and immediately follows the target sequence. The Cas9 can be administered or formulated, for example, as a protein (e.g., a recombinant protein) or as a nucleic acid comprising a sequence encoding the Cas9 protein, which is then expressed in the target cell.

[0059] A subject treated by any of the methods or compositions described herein can be of any age, and can be an adult, infant, or child. In certain cases, the subject is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 years old, or within a range therein (e.g., but not limited to between 2 and 20 years old, between 20 and 40 years old, or between 40 and 90 years old). The subject can be a human or a non-human subject. Particular classes of subjects that can benefit from the compositions and methods of the disclosure include subjects over the age of 40, 50, or 60. Another class of subjects that can benefit from the compositions and methods of the disclosure are subjects with arthritis (e.g., osteoarthritis).

[0060] Any of the compositions disclosed herein can be administered to a non-human subject, such as a laboratory or farm animal. Non-limiting examples of non-human subjects include laboratory or research animals, pets, wild or domesticated animals, farm animals, and the like, such as dogs, goats, guinea pigs, hamsters, mice, pigs, non-human primates (e.g., gorillas, apes, orangutans, lemurs, baboons, and the like), rats, sheep, horses, cows, and the like.

[0061] The present disclosure provides compositions that can be used to treat joint disorders with an inflammatory component. In certain cases, the compositions can be used to prevent the progression of osteoarthritis and treat osteoarthritis in a joint of a mammal.

[0062] In certain cases, the pharmaceutical composition comprises a gene editing system, wherein the gene editing system causes expression of at least one genetic locus associated with joint function to be silenced or reduced in at least a portion of cells comprising a joint.

[0063] In one instance, the pharmaceutical composition comprises a gene editing system, wherein the gene editing system targets one or more of IL-1a and IL-1b. In certain instances, the pharmaceutical composition comprises a gene editing system, wherein the gene editing system targets one or more of TNF-a, IL-6, IL-8, IL-18, a matrix metalloproteinase (MMP), or a component of the NLRP3 inflammasome.

[0064] In certain instances, the pharmaceutical composition comprises a gene editing system, wherein the gene editing comprises the use of a programmable nuclease that mediates the generation of a double-stranded or single-stranded break at the at least one locus associated with joint function. In certain embodiments, the gene editing system reduces gene expression of the target locus or target site. In certain embodiments, the at least one locus associated with joint tissue is silenced or reduced in the at least a portion of cells comprising a joint.

[0065] In certain instances, the cells comprising the joint are synoviocytes. In certain instances, the cells are synoviocyte macrophages. In certain instances, the cells are synoviocyte fibroblasts. In certain instances, at least a portion of the synoviocyte cells are edited. In certain instances, the cells comprising a joint are chondrocytes.

[0066] In certain instances, the pharmaceutical composition targets the one or more cytokine and / or growth factor genes selected from the group consisting of IL-1a, IL-1b, TNF-a, IL-6, IL-8, IL-18, a matrix metalloproteinase (MMP), or a component of the NLRP3 inflammasome. In certain embodiments, the component of the NLRP3 inflammasome comprises NLRP3, ASC (apoptosis-associated speck-like protein containing a CARD), caspase-1, and combinations thereof.

[0067] Also provided are pharmaceutical compositions, wherein the gene editing enhances expression of one or more cytokine and / or growth factor genes in at least a portion of cells comprising a joint, the cytokine and / or growth factor genes selected from the group consisting of IL-1Ra, TIMP-1, TIMP-2, TIMP-3, TIMP-4, and combinations thereof.

[0068] In certain embodiments, the pharmaceutical composition provides gene editing, wherein the gene editing comprises the use of a programmable nuclease that mediates the generation of a double-stranded or single-stranded break at the one or more cytokine and / or growth factor genes. In certain embodiments, the gene editing comprises one or more methods selected from the group consisting of CRISPR methods, TALE methods, zinc finger methods, and combinations thereof.

[0069] In one instance, the gene editing comprises a CRISPR method. In other instances, the CRISPR method is a CRISPR-Cas9 method. In certain instances, the Cas9 is mutated to enhance function.

[0070] Animal models of osteoarthritis

[0071] Several animal models for osteoarthritis are known in the art. Exemplary, but not limiting, animal models are summarized; however, it should be understood that various different models can be used. Animals of many different species have been used to model OA, for example mice, rats, rabbits, guinea pigs, dogs, pigs, horses, and even other animals have been studied. See, e.g., Kuyinu et al., J Orthop Surg Res. 11 : 19 (2016) (hereinafter “Kuyinu, 2016”).

[0072] It should be understood that various different methods for inducing OA can be used in any mammal. In mice, spontaneous, chemical induction, surgical induction, and non-invasive induction are commonly used. See, e.g., Kuyinu, 2016; Bapat et al., Clin Transl Med. 7: 36 (2018) (hereinafter “Bapat, 2018”); and Poulet, Curr Rheumatol Rep 18: 40 (2016). In horses, the skeletal cartilage fragment movement model, chemical induction, trauma induction, and overuse induction are commonly used. In sheep, surgical induction is most common; in guinea pigs, surgical induction, chemical induction, and spontaneous (Durkin Hartley) methods are commonly used. See, e.g., Bapat, 2018.

[0073] Destabilization of the medial meniscus (DMM) is commonly used to model post-traumatic osteoarthritis in mice, e.g., Culley et al., Methods Mol Biol. 1226:143-73 (2015). The DMM model mimics a clinical meniscal injury, a known predisposing factor for human OA development, and allows for the study of structural and biological changes during the course of the disease. Mice are an attractive model organism because mouse strains with defined genetic backgrounds can be used. In addition, knock-out or other genetically manipulated mouse strains can be used to assess the importance of various different molecular pathways in responding to various different OA treatment modalities and regimens. For example, STR / ort mice have characteristics that make the strain particularly susceptible to OA, including elevated levels of the inflammatory cytokine IL1β, Bapat et al., Clin Transl Med. 7:36 (2018). These mice often develop OA in the knees, ankles, elbows, and temporomandibular joints, Jaeger et al., Osteoarthritis Cartilage 16:607-614 (2018). Other useful mouse mutant strains are known to the skilled artisan, e.g., Col9a1(- / -) mice, Allen et al., Arthritis Rheum, 60:2684-2693 (2009).

[0074] Another commonly used surgical model of OA is the anterior cruciate ligament transection (ACLT) model. Little and Hunter, Nat Rev Rheumatol., 9(8):485-497 (2013). The subject’s ACL is surgically transected, destabilizing the joint. The anterior drawer test of the flexed joint is used to confirm that transection of the ligament has occurred. In some cases, other ligaments can be transected, e.g., the posterior cruciate ligament, the medial collateral ligament, the lateral collateral ligament, and / or either meniscus. As with the DMM model, various different mouse strains can be used to study various different molecular pathways.

[0075] Depending on the technical goal, the use of animals of different sizes can be selected. Rodents are useful because the time required for skeletal maturation is short, so the time to develop OA after surgery or other techniques to induce OA is short. Large animals are particularly useful for evaluating therapeutic interventions. The anatomy of large animals is very similar to humans; for example, in dogs, the thickness of the cartilage is less than about half that of humans; this striking similarity is an example of why such studies of cartilage degradation and skeletal cartilage defects are far more useful in large animal models. For example, McCoy, Vet. Pathol., 52:803-18 (2015); and Pelletier et al., Therapy, 7:621-34 (2010).

[0076] Gene editing process

[0077] SUMMARY: Compositions for gene editing of synoviocytes

[0078] Embodiments of the present invention relate to methods for gene editing of synoviocytes, comprising one or more steps of gene editing at least a portion of the synoviocytes in a joint to treat osteoarthritis or other joint disorder. As used herein, "gene editing" and "genome editing" refer to a type of genetic modification in which DNA in the genome of a cell is permanently modified, e.g., DNA is inserted, deleted, modified, or replaced within the genome of the cell. In certain embodiments, gene editing causes the expression of a DNA sequence to be silenced (sometimes referred to as a gene knockout) or inhibited / reduced (sometimes referred to as a gene knockdown). In other embodiments, gene editing causes the expression of a DNA sequence to be enhanced (e.g., by causing overexpression). According to embodiments of the present invention, gene editing techniques are used to reduce the expression of proinflammatory genes or to silence proinflammatory genes and / or to enhance the expression of regenerative genes.

[0079] Interleukins

[0080] According to other embodiments, the gene editing methods of the present invention can be used to increase the expression of one or more of certain interleukins, such as IL-1a, IL-1b, IL-4, IL-6, IL-8, IL-9, IL-10, IL-13, IL-18, and TNF-a. Certain interleukins have been shown to enhance inflammatory responses in joint tissue and to be associated with disease progression.

[0081] Expression constructs

[0082] Expression constructs encoding one or both of a guide RNA and / or a Cas9 editing enzyme can be administered in any effective vehicle, e.g., any formulation or composition capable of effectively delivering the component genes to cells in vivo. Methods include, e.g., electroporation and / or insertion of the genes into viral vectors including recombinant retroviruses, adenoviruses, adeno-associated viruses, lentiviruses, and herpes simplex virus-1, or recombinant bacterial or eukaryotic plasmids. Viral vectors transfect cells directly; plasmid DNA can be delivered naked or with the aid of, e.g., cationic liposomes (lipofectamine) or derivatized (e.g., antibody-conjugated), polylysine conjugates, gramicidin S, artificial viral envelopes, or other such intracellular carriers, as well as direct injection of the gene construct or CaP04 precipitation in vivo.

[0083] A preferred method for in vivo introduction of nucleic acids into cells is the use of viral vectors containing nucleic acids, such as cDNA. The advantage of infecting cells with viral vectors is that a large proportion of target cells can take up the nucleic acid. In addition, molecules encoded by, for example, cDNA contained in the viral vector, are efficiently expressed in cells that have taken up the viral vector nucleic acid.

[0084] Retroviral and adeno-associated viral vectors can be used as recombinant gene delivery systems for the transfer of foreign genes in vivo, particularly into humans. These vectors provide for efficient delivery of genes into cells. In some cases, the transferred nucleic acid stably integrates into the host's chromosomal DNA. In other cases, particularly for adeno-associated viral vectors, stable integration into the host DNA can be a rare event, allowing for episomal expression of the transferred gene and transient expression of the transferred gene.

[0085] The development of special cell lines that produce only replication-defective retroviruses, known as "packaging cells," has increased the use of retroviruses in gene therapy, and defective retroviruses for gene transfer for gene therapy purposes have been characterized (for review, see Miller, Blood 76:271 (1990)). Replication-defective retroviruses can be packaged into virions, which can be used to infect target cells by standard techniques, by using helper viruses. Protocols for producing recombinant retroviruses and using such viruses to infect cells in vitro or in vivo can be found in Ausubel et al., eds., Current Protocols in Molecular Biology, Greene Publishing Associates, (1989), Sections 9.10-9.14, and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE, and pEM, known to those skilled in the art. Examples of suitable packaging virus lines for both ecotropic and amphotropic retroviral systems include ψCrip, ψCre, ψ2, and ψAm.Retroviruses have been used to introduce a variety of different genes into a number of different cell types, including epithelial cells, in vitro and / or in vivo (see, e.g., EgHts et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science 254:1802-1805; van Beusechem et al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89:10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-4115; U.S. Patent No. 4,868,116; U.S. Patent No. 4,980,286; PCT Application WO 89 / 07136; PCT Application WO 89 / 02468; PCT Application WO 89 / 05345; PCT Application WO 92 / 07573, each of which is incorporated herein by reference in its entirety for all purposes).

[0086] Another viral gene delivery system useful in the present application utilizes adenovirus-derived vectors. The genome of adenovirus can be manipulated to encode and express a gene product of interest, but be inactivated with respect to its ability to replicate in the normal viral lytic life cycle. See, e.g., Berkner et al., BioTechniques 6:616 (1988); Rosenfeld et al., Science 252:431-434 (1991); and Rosenfeld et al., Cell 68:143-155 (1992). Suitable adenoviral vectors can be derived from any adenoviral strain (e.g., Ad2, Ad3, Ad5, or Ad7, etc.), including adenovirus serotypes from other species (e.g., mouse, dog, human, etc.) known to those skilled in the art. The virions are relatively stable, easy to purify and concentrate, and can be modified to affect the spectrum of infection as described above. In addition, the introduced adenoviral DNA (and foreign DNA contained therein) does not integrate into the host cell's genome, but remains episomal, thereby avoiding potential problems that can occur as a result of in situ insertion mutagenesis, in which the introduced DNA becomes integrated into the host genome (e.g., retroviral DNA). Furthermore, the adenoviral genome has a large capacity for foreign DNA (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al., supra; Haj-Ahmand and Graham, J. Virol. 57:267 (1986).

[0087] Helper-dependent (HDAd) vectors can also be generated in which all adenoviral sequences are deleted except for the DNA replication origin at each end of the viral DNA and the packaging signal at the 5 '-end of the genome downstream of the left-hand packaging signal. HDAd vectors are constructed and propagated in the presence of a replication-competent helper adenovirus, which provides the necessary early and late proteins required for replication.

[0088] Another viral vector system that can be used for nucleic acid delivery is an adeno- associated virus (AAV). Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as adenovirus or herpes virus, as a helper virus to achieve efficient replication and productive life cycle. (For review, see Muzyczka et al., Curr. Topics in Micro. and Immunol. 158:97-129 (1992). It is also one of the few viruses that can integrate its DNA into non-dividing cells and exhibits a high frequency of stable integration (see, e.g., Flotte et al., Am. J. Respir. Cell. Mol. Biol. 7:349-356 (1992); Samulski et al., J. Virol. 63:3822-3828 (1989); and McLaughlin et al., J. Virol. 62:1963-1973 (1989)). Vectors for AAV, containing as little as 300 base pairs, can be packaged and can integrate. The foreign DNA is limited to about 4.5 kb in size. AAV vectors, as described in Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985), can be used to introduce DNA into cells. AAV vectors have been used to introduce a variety of different nucleic acids into different cell types (see, e.g., Hermonat et al., Proc. Natl. Acad. Sci. USA 81 :6466-6470 (1984); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1985); Wondisford et al., Mol. Endocrinol. 2:32-39 (1988); Tratschin et al., J. Virol. 51 :611-619 (1984); and Flotte et al., J. Biol. Chem. 268:3781-3790 (1993)). The identification of Staphylococcus aureus (SaCas9) and other smaller Cas9 enzymes that can be packaged in adeno-associated virus (AAV) vectors that are highly stable and effective in vivo, easy to produce, FDA-approved, and tested in multiple clinical trials, opens new avenues for therapeutic gene editing.

[0089] In certain embodiments, nucleic acids encoding CRISPR IL-1 alpha or IL-1 beta gene editing complexes (e.g., Cas9 or gRNA) are packaged in liposomes with a positive charge on the surface (e.g., lipofectin), which can be labeled with antibodies to cell surface antigens of the target cells. These delivery vehicles can also be used to deliver Cas9 protein / gRNA complexes.

[0090] In a clinical setting, the gene delivery system for the nucleic acid encoding the CRISPR IL-1a or IL-1b gene editing complex can be introduced into a subject by any of a variety of methods, each of which is well known in the art. For example, the pharmaceutical preparation of the gene delivery system can be introduced systemically, e.g., by intravenous injection, and the occurrence of specific transduction of the protein in target cells is due primarily to transfection specificity provided by the gene delivery vector, cell type or tissue type expression due to transcriptional regulatory sequences controlling expression of the recipient gene, or a combination thereof. In other embodiments, the initial delivery of the nucleic acid encoding the CRISPR IL-1a or IL-1b gene editing complex is more limited, wherein introduction in the subject is fairly localized. For example, the nucleic acid encoding the CRISPR IL-1a or IL-1b gene editing complex can be introduced by intra-articular injection into a joint exhibiting joint disease, e.g., osteoarthritis. In certain embodiments, the nucleic acid encoding the CRISPR IL-1a or IL-1b gene editing complex is administered during or after surgery; in certain embodiments, a controlled release hydrogel comprising the nucleic acid encoding the CRISPR IL-1a or IL-1b gene editing complex is administered at the end of surgery prior to closure to prevent reduction or elimination of osteoarthritis by providing a steady dose of the nucleic acid encoding the CRISPR IL-1a or IL-1b gene editing complex over time.

[0091] The pharmaceutical preparation of the nucleic acid encoding the CRISPR IL-1a or IL-1b gene editing complex can consist essentially of the gene delivery system, e.g., viral vector, in an acceptable diluent, or can include a slow release matrix in which the gene delivery vector is entrapped. Alternatively, where the complete gene delivery system can be produced intact from a recombinant cell, e.g., adenovirus vector. The pharmaceutical preparation can include one or more cells that produce the gene delivery system.

[0092] Preferably, the CRISPR IL-1a or IL-1b editing complex is specific, i.e., preferentially induces genomic alterations at the target site (IL-1a or IL-1b) and does not induce alterations at other sites, or induces alterations at other sites rarely. In certain embodiments, the CRISPR IL-1a or IL-1b editing complex has an editing efficiency of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. In certain embodiments, the sequence of the guide RNA (e.g., single guide RNA) can be modified to improve editing efficiency and / or reduce off-target effects. In certain embodiments, the sequence of the guide RNA can differ from the target sequence by about 1 base, about 2 bases, about 3 bases, about 4 bases, about 5 bases, about 5 bases, about 6 bases, about 7 bases, about 8 bases, about 9 bases, about 10 bases, about 15 bases, or more than about 15 bases. In certain embodiments, the sequence of the guide RNA can differ from the target sequence by about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, or more than about 20%. As used herein, variation from the target sequence can refer to degree of complementarity.

[0093] Gene editing methods

[0094] As discussed above, embodiments of the present application provide compositions and methods for treating joint disorders, wherein a portion of the joint cells are genetically modified by gene editing in order to treat the joint disorder. Embodiments of the present application include genetic editing by nucleotide insertion (RNA or DNA) or recombinant protein insertion into the population of synoviocytes for promoting expression of one or more proteins and inhibiting expression of one or more proteins and combinations thereof. Embodiments of the present application further provide methods for delivering gene editing compositions to joint cells, in particular, delivering gene editing compositions to synoviocytes. There are several gene editing technologies that can be used to genetically modify joint cells that are suitable for use in accordance with the present application.

[0095] In certain embodiments, the method of genetically modifying joint cells comprises a step of stably incorporating a gene for production of one or more proteins. In one embodiment, the method of genetically modifying a portion of joint synovial cells comprises a step of retroviral transduction. In one embodiment, the method of genetically modifying a portion of joint synovial cells comprises a step of lentiviral transduction. Lentiviral transduction systems are known in the art and described in, for example, Levine et al., Proc. Nat'l Acad. Sci. 2006, 103, 17372-77; Zufferey et al., Nat. Biotechnol. 1997, 15, 871-75; Dull et al., J. Virology 1998, 72, 8463-71 and U.S. Patent No. 6,627,442, the disclosures of each of which are incorporated herein by reference. In one embodiment, the method of genetically modifying a portion of joint synovial cells comprises a step of gamma-retroviral transduction. Gamma-retroviral transduction systems are known in the art and described in, for example, Cepko and Pear, Cur. Prot. Mol. Biol. 1996, 9.9.1-9.9.16, the disclosure of which is incorporated herein by reference. In one embodiment, the method of genetically modifying a portion of joint synovial cells comprises a step of transposon-mediated gene transfer. Transposon-mediated gene transfer systems are known in the art and include systems in which the transposase is provided as a DNA expression vector, or as an expressible RNA or protein such that long-term expression of the transposase does not occur in the transgenic cells, for example the transposase is provided as an mRNA (e.g., an mRNA comprising a cap structure and a poly-A tail). Suitable transposon-mediated gene transfer systems, including salmonid-type Tel-like transposases (SB or Sleeping Beauty transposases) such as SB10, SB11 and SB100x, and engineered enzymes with improved enzymatic activity, are described in, for example, Hackett et al., Mol. Therapy 2010, 18, 674-83 and U.S. Patent No. 6,489,458, the disclosures of each of which are incorporated herein by reference.

[0096] In certain instances, a gene editing system is introduced into a cell comprising a joint using a viral vector or system. In certain instances, the cell is a synoviocyte. In certain instances, the viral vector is an AAV vector. In certain instances, the AAV vector comprises a serotype selected from the group consisting of: AAV1, AAV1 (Y705+731F+T492V), AAV2 (Y444+500+730F+T491V), AAV3 (Y705+731F), AAV4, AAV5, AAV5 (Y436+693+719F), AAV6, AAV6 (VP3 variant Y705F / Y731F / T492V), AAV-7m8, AAV8, AAV8 (Y733F), AAV9, AAV9 (VP3 variant Y731F), AAV10 (Y733F), AAV-ShH10, and AAV-DJ / 8. In certain instances, the AAV vector comprises a serotype selected from the group consisting of: AAV1, AAV5, AAV6, AAV6 (Y705F / Y731F / T492V), AAV8, AAV9, and AAV9 (Y731F).

[0097] In certain instances, the viral vector is a lentivirus. In one instance, the lentivirus is selected from the group consisting of: human immunodeficiency virus-1 (HIV-1), human immunodeficiency virus-2 (HIV-2), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), Jembrana disease virus (JDV), equine infectious anemia virus (EIAV), and caprine arthritis encephalitis virus (CAEV).

[0098] In one embodiment, the method of genetically modifying a portion of articular synovial cells comprises a step of stably incorporating a gene for the production or suppression (e.g., silencing) of one or more proteins. In one embodiment, the method of genetically modifying a portion of articular synovial cells comprises a step of lipofection. Lipofection methods, such as methods using a 1 : 1 (w / w) liposome formulation of the cationic lipid N-[l-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride (DOTMA) and dioleoylphosphatidylethanolamine (DOPE) in filtered water, are known in the art and described in Rose et al., Biotechniques 1991, 10, 520-525 and Feigner et al., Proc. Natl. Acad. Sci. USA, 1987, 84, 7413-7417, and U.S. Patent Nos. 5,279,833, 5,908,635, 6,056,938, 6,110,490, 6,534,484, and 7,687,070, the disclosures of each of which are incorporated herein by reference. In one embodiment, the method of genetically modifying a portion of articular synovial cells comprises a transfection step using methods described in U.S. Patent Nos. 5,766,902, 6,025,337, 6,410,517, 6,475,994, and 7,189,705, the disclosures of each of which are incorporated herein by reference.

[0099] According to one embodiment, the gene editing process can comprise the use of programmable nucleases that mediate the production of double- or single-strand breaks at one or more immune checkpoint genes. Such programmable nucleases are capable of precise genome editing by introducing breaks at specific genomic sites, i.e., they rely on the recognition of a specific DNA sequence within the genome to target a nuclease domain to that location and mediate the production of a double-strand break at the target sequence. The double-strand break in the DNA subsequently summons endogenous repair machinery to the break site, mediating genome editing through non-homologous end joining (NHEJ) or homology-directed repair (HDR). Thus, repair of the break can allow the introduction of an insertion / deletion mutation that disrupts (e.g., silences, suppresses, or enhances) the target gene product.

[0100] The major classes of nucleases that have been developed to enable site-specific genome editing include zinc finger nucleases (ZFNs), transcription activator-like nucleases (TALENs), and CRISPR-associated nucleases (e.g., CRISPR-Cas9). These nuclease systems can be broadly classified into two categories according to their DNA recognition mode: ZFNs and TALENs achieve specific DNA binding through protein-DNA interactions, while the CRISPR system, e.g., Cas9, targets specific DNA sequences through a short RNA guide molecule that directly base pairs with the target DNA and through protein-DNA interactions. See, e.g., Cox et al., Nature Medicine, 2015, Vol. 21, No. 2.

[0101] Non-limiting examples of gene editing methods that can be used in accordance with the methods of the present application include CRISPR methods, TALE methods, and ZFN methods, which are described in more detail below.

[0102] CRISPR methods

[0103] A pharmaceutical composition for treating or preventing a joint disease or disorder comprises a gene editing system, wherein the gene editing system targets at least one locus associated with joint function, wherein gene editing of at least a portion of joint synoviocytes is performed by a CRISPR method (e.g., CRISPR-Cas9, CRISPR-Cas13a, or CRISPR / Cpfl (also known as CRISPR-Cas12a)). According to particular embodiments, gene editing of joint synoviocytes using a CRISPR method results in silencing or reduction of expression of one or more immune checkpoint genes in at least a portion of the joint synoviocytes.

[0104] CRISPR stands for “Clustered Regularly Interspaced Short Palindromic Repeats.” Methods for gene editing using the CRISPR system are also referred to herein as CRISPR methods. There are three types of CRISPR systems that combine RNA with Cas proteins and can be used in accordance with the present application: Type II, Type V, and Type VI. Type II CRISPR (using Cas9 as an example) is one of the most well-characterized systems.

[0105] The CRISPR technology is adapted from the natural defense system of bacteria and archaea (the domain of single-celled microorganisms). These organisms use CRISPR-derived RNAs and various different Cas proteins, including Cas9, to foil attacks by viruses and other foreign invaders by cutting and destroying their DNA or RNA. CRISPR is a specialized DNA region with two distinct features: the presence of nucleotide repeat sequences and spacer regions. Nucleotide repeat sequences are distributed throughout the CRISPR region interspersed with short segments of foreign DNA (spacer regions). In type II CRISPR-Cas systems, spacer regions are integrated within CRISPR genomic sites and transcribed and processed into short CRISPR RNAs (crRNAs). These crRNAs anneal to trans-activating crRNAs (tracrRNAs) and direct the sequence-specific cleavage and silencing of pathogenic DNA by Cas proteins. Target recognition by Cas9 protein requires a "seed" sequence within the crRNA and a conserved dinucleotide-containing protospacer adjacent motif (PAM) sequence upstream of the crRNA binding region. Thus, by redesigning the crRNA, the CRISPR-Cas system can be redirected to cleave virtually any DNA sequence. The crRNA and tracrRNA in the natural system can be simplified into a single guide RNA (sgRNA) of about 100 nucleotides for genetic engineering. The CRISPR-Cas system is directly transplanted into human cells by co-delivery of plasmids expressing the Cas9 endonuclease and the necessary crRNA and tracrRNA (or sgRNA) components. Different variants of Cas proteins can be used to reduce targeting restrictions (e.g., orthologs of Cas9 such as Cpfl).

[0106] Non-limiting examples of genes that can be silenced or inhibited by permanent genetic editing of synoviocytes using CRISPR methods include IL-1a, IL-1b, IL-4, IL-9, IL-10, IL-13, and TNF-a.

[0107] Non-limiting examples of genes that can be enhanced by permanent genetic editing of synoviocytes using CRISPR methods include IL-1a, IL-1b, IL-4, IL-9, IL-10, IL-13, and TNF-a.

[0108] Examples of systems, methods, and compositions for altering the expression of a target gene sequence by CRISPR methods that can be used in accordance with embodiments of the present application are described in U.S. Patent Nos. 8,697,359; 8,993,233; 8,795,965; 8,771,945; 8,889,356; 8,865,406; 8,999,641; 8,945,839; 8,932,814; 8,871,445; 8,906,616; and 8,895,308, which are incorporated herein by reference. Resources for performing CRISPR methods, such as plasmids for expressing CRISPR-Cas9 and CRISPR-Cpf1, are commercially available from companies such as GenScript.

[0109] In one embodiment, genetic modification of at least a portion of the articular synoviocytes described herein can be performed using the CRISPR-Cpf1 system described in U.S. Patent No. US 9,790,490, the disclosure of which is incorporated herein by reference. In one embodiment, genetic modification of at least a portion of the articular synoviocytes described herein can be performed using the CRISPR-Cas system comprising a single vector system described in U.S. Patent No. 9,907,863, the disclosure of which is incorporated herein by reference.

[0110] TALE method

[0111] A pharmaceutical composition for treating or preventing a joint disease or disorder comprises a gene editing system, wherein the gene editing system targets at least one locus associated with joint function, wherein the method further comprises genetically editing at least a portion of the articular synoviocytes by a TALE method. According to a particular embodiment, at least one locus associated with joint function is targeted using a TALE method, wherein at least a portion of the articular synoviocytes are genetically edited. Alternatively, a TALE method is used during targeting of at least one locus associated with joint function, wherein at least a portion of the synoviocytes are genetically edited such that expression of the at least one locus associated with joint function is enhanced in at least a portion of the articular synoviocytes.

[0112] TALEs are naturally occurring proteins from the plant pathogenic bacterium genus Xanthomonas and contain a DNA-binding domain composed of a series of 33-35 amino acid repeat domains that each recognize a single base pair. The specificity of TALEs is determined by two hypervariable amino acids known as repeat variable diresidues (RVDs). Modular TALE repeats are linked together to recognize contiguous DNA sequences. The specific RVDs in the DNA-binding domain recognize bases in the target locus, providing a structural feature for assembling predictable DNA-binding domains. The DNA-binding domain of TALEs is fused to the catalytic domain of the type IIS Fokl endonuclease to make targetable TALE nucleases. To induce site-specific mutations, two separate TALEN arms, separated by a 14-20 base pair spacer, bring Fokl monomers close enough to dimerize and create a directed double-strand break.

[0113] Several large-scale studies utilizing various assembly methods have shown that TALE repeats can be combined to recognize virtually any user-defined sequence. Custom-designed TALE arrays are also commercially available through Cellectis Bioresearch (Paris, France), Transposagen Biopharmaceuticals (Lexington, KY, USA), and Life Technologies (Grand Island, NY, USA). TALE and TALEN methods suitable for use in the present application are described in U.S. Patent Application Publication Nos. US2011 / 0201118 Al, US2013 / 0117869 Al, US2013 / 0315884 Al, US2015 / 0203871 Al, and US2016 / 0120906 Al, the disclosures of which are incorporated herein by reference.

[0114] Non-limiting examples of genes that can be silenced or inhibited by permanent genetic editing of synoviocytes using TALE methods include IL-1a, IL-1b, IL-4, IL-9, IL-10, IL-13, and TNF-a.

[0115] Non-limiting examples of genes that can be enhanced by permanent genetic editing of synoviocytes using TALE methods include IL-1a, IL-1b, IL-4, IL-9, IL-10, IL-13, and TNF-a.

[0116] Examples of systems, methods, and compositions for altering the expression of a target gene sequence by TALE methods that can be used in accordance with embodiments of the present application are described in U.S. Patent No. 8,586,526, which is incorporated herein by reference.

[0117] Zinc finger methods

[0118] A pharmaceutical composition for treating or preventing a joint disease or disorder comprises a gene editing system, wherein the gene editing system targets at least one locus associated with joint function, wherein the method further comprises genetically editing at least a portion of joint synoviocytes by zinc finger or zinc finger nuclease methods. According to a particular embodiment, at least one locus associated with joint function is targeted using zinc finger methods, wherein at least a portion of joint synoviocytes are genetically edited. Alternatively, zinc finger methods are used during targeting of at least one locus associated with joint function, wherein genetically editing at least a portion of joint synoviocytes results in the expression of at least one locus associated with joint function being enhanced in at least a portion of the joint synoviocytes.

[0119] In the conserved betaalpha configuration, a single zinc finger contains approximately 30 amino acids. Several amino acids on the alpha-helix surface typically contact 3 bp in the major groove of DNA, with varying levels of selectivity. Zinc fingers have two protein domains. The first domain is the DNA-binding domain, which includes eukaryotic transcription factors and contains zinc fingers. The second domain is the nuclease domain, which includes the Fokl restriction enzyme and is responsible for the catalytic cleavage of DNA.

[0120] The DNA-binding domain of a single ZFN typically contains between 3 and 6 individual zinc finger repeats, which can each recognize between 9 and 18 base pairs. If zinc finger domains are specific for their target sites, then even a pair of 3-finger ZFNs recognizing a total of 18 base pairs can, in theory, target a single locus in the mammalian genome. One method of generating new zinc finger arrays is to combine smaller zinc finger "modules" of known specificity. The most commonly used modular assembly process involves combining 3 individual zinc fingers of DNA sequences that can each recognize 3 base pairs to generate a 3-finger array that can recognize a target site of 9 base pairs. Alternatively, new zinc finger arrays can be selected from random libraries using selection-based methods such as oligomer pool engineering (OPEN), which takes into account context-dependent interactions between adjacent zinc fingers. Engineered zinc fingers are commercially available; Sangamo Biosciences (Richmond, CA, USA) has developed a specialized platform for zinc finger construction in collaboration with Sigma-Aldrich (St. Louis, MO, USA)

[0121] Non-limiting examples of genes that can be silenced or inhibited by permanent genetic editing of synoviocytes using zinc finger methods include IL-1a, IL-1b, IL-4, IL-9, IL-10, IL-13, TNF-a, IL-6, IL-8, IL-18, a component of the matrix metalloproteinase (MMP), or NLRP3 inflammasome. In certain embodiments, the component of the NLRP3 inflammasome comprises NLRP3, ASC (apoptosis-associated speck-like protein containing CARD), caspase-1, and combinations thereof.

[0122] Non-limiting examples of genes that can be enhanced by permanent genetic editing of synoviocytes using zinc finger methods include the group consisting of IL-1Ra, TIMP-1, TIMP-2, TIMP-3, TIMP-4, and combinations thereof. In one instance, the present application provides a composition for upregulating anti-inflammatory cytokines.

[0123] Examples of systems, methods, and compositions for altering expression of a target gene sequence by zinc finger methods that can be used in accordance with embodiments of the present application are described in U.S. Patent Nos. 6,534,261, 6,607,882, 6,746,838, 6,794,136, 6,824,978, 6,866,997, 6,933,113, 6,979,539, 7,013,219, 7,030,215, 7,220,719, 7,241,573, 7,241,574, 7,585,849, 7,595,376, 6,903,185, and 6,479,626, which are incorporated herein by reference.

[0124] In certain instances, cells can be genetically edited ex vivo, wherein the genetic editing targets one or more anti-inflammatory cytokine loci. In certain instances, the cells are non-synoviocyte cells. In certain instances, the cells are mesenchymal stem cells. In certain instances, the cells are macrophages. In certain instances, the present application provides a pharmaceutical composition for treating or preventing a joint disease or disorder comprising a population of genetically edited cells, wherein the genetically edited cells are edited by a genetic editing system that targets at least one locus associated with joint function. In one instance, the population of genetically edited cells is injected into a synovial joint.

[0125] Other examples of systems, methods, and compositions for altering expression of a target gene sequence by zinc finger methods that can be used in accordance with embodiments of the present application are described in Beane et al., Mol. Therapy, 2015, 23 1380-1390, the disclosure of which is incorporated herein by reference.

[0126] Methods of treating osteoarthritis and other diseases

[0127] The compositions and methods described herein can be used in methods of treating diseases. In one embodiment, they are used to treat inflammatory joint disorders. They can also be used to treat other disorders described herein and in the paragraphs that follow. In one instance, the compositions and methods are used to treat osteoarthritis (OA).

[0128] In certain embodiments, the disclosure provides a method for treating or preventing a joint disease or disorder, the method comprising introducing a gene editing system, wherein the gene editing system targets at least one locus associated with joint function. In certain embodiments, the joint disease is osteoarthritis. In one instance, the method is used to treat a canine with osteoarthritis. In another instance, the method is used to treat a mammal with degenerative joint disease. In certain instances, the method is used to treat a canine or equine with a joint disease. In certain instances, the method is used to treat osteoarthritis, post-traumatic arthritis, post-infectious arthritis, rheumatoid arthritis, gout, pseudogout, autoimmune-mediated arthritis, inflammatory arthritis, inflammation-mediated and immune-mediated joint disease.

[0129] In certain embodiments, the method further comprises gene editing a portion of the joint synoviocytes to reduce or silence expression of one or more of IL-1a, IL-1b, IL-4, IL-9, IL-10, IL-13, and TNF-a. In one instance, the method further comprises gene editing a portion of the joint synoviocytes to reduce or silence expression of one or more of IL-1a, IL-1b.

[0130] In one instance, the method further comprises gene editing, wherein the gene editing comprises one or more methods selected from the group consisting of CRISPR methods, TALE methods, zinc finger methods, and combinations thereof.

[0131] In certain instances, the methods further comprise delivering the gene edit using an AAV vector, a lentivirus vector, or a retrovirus vector. In preferred embodiments, the methods further comprise delivering the gene edit using AAV1, AAV1 (Y705+731F+T492V), AAV2 (Y444+500+730F+T491V), AAV3 (Y705+731F), AAV5, AAV5 (Y436+693+719F), AAV6, AAV6 (VP3 variant Y705F / Y731F / T492V), AAV-7m8, AAV8, AAV8 (Y733F), AAV9, AAV9 (VP3 variant Y731F), AAV10 (Y733F), and AAV-ShH10. In certain instances, the AAV vector comprises a serotype selected from the group consisting of AAV1, AAV5, AAV6, AAV6 (Y705F / Y731F / T492V), AAV8, AAV9, and AAV9 (Y731F).

[0132] Pharmaceutical compositions and methods of administration

[0133] The methods described herein include the use of pharmaceutical compositions comprising a CRISPR gene editing complex as an active ingredient.

[0134] Depending on the method / route of administration, pharmaceutical dosage forms are classified into several types. These include a variety of liquid, solid, and semisolid dosage forms. Common pharmaceutical dosage forms include pills, tablets, or capsules, draughts or syrups, and natural or herbal forms such as a variety of plants or food items, among many others. Notably, the route of administration (ROA) for drug delivery depends on the dosage form of the substance in question. Liquid pharmaceutical dosage forms are liquid forms of a chemical compound intended for administration or ingestion in a specific dose as a drug or medicine.

[0135] In one embodiment, the compositions of the present disclosure can be delivered to a subject subcutaneously (e.g., intra-articular injection), transdermally (e.g., through a patch transdermally), and / or by implantation. Exemplary pharmaceutical dosage forms include, for example, pills, osmotic delivery systems, elixirs, emulsions, hydrogels, suspensions, syrups, capsules, tablets, orally dissolving tablets (ODTs), gel capsules, films, adhesive topical patches, lollipops, lozenges, chewing gum, dry powder inhalers (DPIs), vaporizers, nebulizers, metered dose inhalers (MDIs), ointments, transdermal patches, intradermal implants, subcutaneous implants, and transcutaneous implants.

[0136] As used herein, "transdermal delivery" or "transdermal administration" can refer to an administration route in which a pharmaceutical dosage form is applied to or through the dermis (i.e., the skin layer between the epidermis (which together with it makes up the skin) and the subcutaneous tissue). "Subcutaneous delivery" can refer to an administration route in which a pharmaceutical dosage form is applied to or below the subcutaneous tissue layer.

[0137] Methods of formulating suitable pharmaceutical compositions are known in the art, see, e.g., Remington: The Science and Practice of Pharmacy, 21stEd., 2005; and the books in the series Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs (Dekker, N.Y.). For example, solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates; and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

[0138] Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL TM(BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of coating such as lecithin, by the maintenance of required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by the inclusion of agents which delay absorption, for example, aluminum monostearate and gelatin.

[0139] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0140] As nucleic acids or therapeutic compounds comprising nucleic acids can be administered by any method suitable for the delivery of nucleic acid agents, such as DNA vaccines. These methods include gene guns, biological injectors and skin patches and needle-free methods, such as the microparticle DNA vaccine technology disclosed in U.S. Patent No. 6,194,389 and the mammalian transdermal needle-free vaccination using a powder form of the vaccine disclosed in U.S. Patent No. 6,168,587. In addition, intranasal delivery is possible, as described in Hamajima et al., Clin. Immunol. Immunopathol., 88(2), 205-10 (1998), inter alia. Liposomes (as described in U.S. Patent No. 6,472,375) and microencapsulation can also be used. Biodegradable, targetable microparticle delivery systems (as described in U.S. Patent No. 6,471,996) can also be used.

[0141] Therapeutic compounds can be prepared with carriers that protect such therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable biocompatible polymers can be used, such as collagen, ethylene vinyl acetate, poly anhydrides (e.g., poly[l,3-bis(carboxyphenoxy)propane-co-sebacic anhydride] (PCPP-SA) matrices, fatty acid dimer-sebacic acid (FAD-SA) copolymers, poly(lactide-co-glycolide)), polyglycolic acid, collagen, polyorthoesters, polyethylene glycol-coated liposomes, and polylactic acid. Such formulations can be prepared using standard techniques, or are commercially available, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions, including liposomes targeted to selected cells with monoclonal antibodies specific for cell antigens, can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811. Semi-solid, gel, soft gel, or other formulations (including controlled release formulations) can be used, for example, when administration to a surgical site is desired. Methods of making such formulations are known in the art, and can include the use of biodegradable biocompatible polymers. See, e.g., Sawyer et al., Yale J Biol Med. 2006 December; 79(3-4): 141-152.

[0142] The pharmaceutical composition can be included in a container, pack, pack, or dispenser together with instructions for administration. Examples

[0143] The embodiments encompassed herein are now described with reference to the following examples. These examples are provided only for illustrating the disclosure encompassed herein and should in no way be construed as limiting the disclosure encompassed herein, which should be construed as encompassing any and all variations that become evident as a result of the teaching provided herein.

[0144] Example 1. Reducing expression of IL-1 by CRISPR gene engineering in a mouse model of osteoarthritis

[0145] Sixty C57B mice were selected and divided into four groups, 15 mice per group. OA was induced in each mouse using the DMM surgical method. Once the mice developed OA, the mice were treated as follows:

[0146] Group 1 : Direct injection of CRISPR AAV vectors engineered to target IL-1a and IL-1b and silence or reduce expression of IL-1 protein in the OA joint.

[0147] Group 2: Direct injection into OA joints with a "no intent" payload engineered CRISPR AAV vector that does not affect IL-1 production; negative control.

[0148] Group 3: Direct injection into OA joints with a CRISPR AAV vector engineered to target IL-1Ra and silence or reduce expression of IL-1Ra protein.

[0149] Group 4: Direct injection into OA joints with sterile buffered saline; control for injection procedure.

[0150] The mice are monitored before and after treatment to assess the effect on their locomotion and exploratory activity. Mechanical sensitivity and gait changes are also monitored. Abnormal pain and hind limb grip strength can also be monitored.

[0151] After about 8 weeks, the animals are sacrificed and the OA joint tissue is evaluated for overall histopathology and IL-1 expression by IHC. Inflammatory biomarkers, such as MMP-3 expression in OA joints, are also evaluated.

[0152] The Group 1 mice treated with a CRISPR AAV vector engineered to target IL-1a and IL-1b and silence or reduce expression of IL-1 protein show reduced levels of IL-1 by IHC, tissue regeneration by histopathology, and lower levels of inflammatory biomarkers compared to any of the other three groups. The Group 3 mice show relatively higher levels of inflammatory biomarkers compared to any of the other three groups.

[0153] Example 2. Assessing guide cleavage efficiency against mouse IL1A and IL1B

[0154] In vitro cleavage assay

[0155] CRISPR guide RNAs (thiophosphorothioate modified sgRNAs, Table 3) were designed against exon 4 of Il la and exon 4 of Il lb (Il la-201 ENSMUST00000028882.1 and Il lb-201 ENSMUST00000028881.13; see Table 2 for target sequences on exon 4 of Il la and exon 4 of Il lb). Exon 4 of Il la and Il lb were amplified by PCR (Phusion High-Fidelity DNA Polymerase, NEB cat#M0530S) using C57BL / 6 mouse genomic DNA; Il la primer fwd: CATTGGGAGGATGCTTAGGA, Il la primer rev: GGCTGCTTTCTCTCCAACAG, Il lb primer fwd: AGGAAGCCTGTGTCTGGTTG, Il lb primer rev: TGGCATCGTGAGATAAGCTG. Amplicons were PCR purified (QiaQuick PCR Purification Kit, cat#28106). Guide cutting efficiency was determined using an in vitro cutting assay using 100 ng of purified PCR product, 200 ng of modified guide RNA (Sigma Aldrich), and 0.5 pg TrueCut Spy Cas9 protein V2 (Invitrogen A36498) or 0.5 pg Gene Snipper NLS Sau Cas9 (BioVision Cat#M1281-50-1). Editing efficiency was compared between the two types of Cas9, S. pyogenes Cas9 and S. aureus Cas9. Cutting assays were qualitatively read out using 2% agarose gels.

[0156] Editing cell lines

[0157] CRISPR guide RNAs (thiophosphorylated sgRNAs, Table 2) were designed for exon 4 of Il1a and exon 4 of Il1b (Il1a-201 ENSMUST00000028882.1 and Il1b-201 ENSMUST00000028881.13). Guide RNA cleavage efficiency was determined in a pool of J774.2 and NIH3T3 cells using Sanger sequencing and the Synthego ICE (see e.g. “Inference of CRISPR Edits from Sanger Trace Data”, Hsiau T, Maures T, Waite K, Yang J, et al. biorxiv.2018, which is incorporated herein by reference for all purposes) or TIDE (see e.g. “Easy quantitative assessment of genome editing by sequence trace decomposition”, Brinkman E, Chen T, Amendola M, and Van Steensel B, Nucleic Acids res 2014, which is incorporated herein by reference for all purposes) web tools to calculate percent edits. The experiment also compared the efficiency of S. pyogenes Cas9 and S. aureus Cas9. The cells were electroporated (Amaxa 4D Nucleofector device, Lonza) with 5 pg TrueCut SpyCas9 protein V2 (Invitrogen A36498) or 5 pg EnGen Sau Cas9 protein (NEB M0654T) and 100 pmol of modified guide RNA (Sigma Aldrich). SF nucleofector solution and program CM139 were used for J774.2 cells and SG nucleofector solution and program EN158 were used for NIH3T3 cells. Cell pellets were taken 3 days after electroporation and gDNA was extracted (Qiagen, DNeasy Blood and Tissue Kit, 69506) from each pool. Exon 4 of Il1a or Il1b was amplified by PCR (Phusion High-Fidelity DNA Polymerase, NEB, cat#M0530S) in appropriate pools.Il1a primers fwd: TGGTTTCAGGAAAACCCAAG, Il1a primers rev: GCAGTATGGCCAAGAAAGGA, Il1b primers fwd: AGGAAGCCTGTGTCTGGTTG, Il1b primers rev: CTGGGCAAGAACATTGGATT. Amplicons were Sanger sequenced and analyzed using Synthego ICE or TIDE web tools to determine the absence of wild type sequence and the presence of indels that cause frameshifts in the cDNA sequence in each clone.

[0158] Table 2. Il1a and Il1b target sequences

[0159]

[0160]

[0161] Table 3. CRISPR guide RNAs

[0162]

[0163] Each cRNA (see, e.g., Table 3) was synthesized as a single guide RNA consisting of the upper cRNA sequence fused to the lower tracrRNA sequence (see, e.g., SEQ ID Nos: 35-36). In certain embodiments, an A<>U flip was used to improve guide RNA activity.

[0164] Sau Cas9: GUUAUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAU UUUU (SEQ ID NO: 35)

[0165] Spy Cas9: GUUAUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC UUUUUU (SEQ ID NO: 36)

[0166] In vitro cleavage assay

[0167] Figure 1AAgarose gel electrophoresis analysis of 100 ng of mouse DNA cut with 0.5 μg SpyCas9 and 200 ng of modified guide RNA (43-46 for IL1a and 47-50 for IL1B) is shown. The DNA was cut with Cas9 at specific sites using the guide RNA to produce a predictable banding pattern on the agarose gel compared to an uncut control (without being bound by any particular theory, the agarose gel electrophoresis of sg8* appears to show a failed synthesis).

[0168] Figure 1B Agarose gel electrophoresis analysis of 100 ng of mouse DNA cut with 0.5 μg Sau Cas9 and 200 ng of modified guide RNA (51-53 for Il1a and 54-56 for Il1b) is shown. The DNA was cut with Cas9 at specific sites using the guide RNA to produce a predictable banding pattern on the agarose gel compared to an uncut control.

[0169] Edited cell lines

[0170] Genomic DNA was extracted from the edited merges, and exon 4 of Il1a or Il1b was amplified by PCR in suitable merges. The PCR products were sent for Sanger sequencing and then deconvolved using TIDE or Synthego ICE software. Synthego ICE was used to deconvolve SpyCas9 merges. This software can determine the editing pattern in each merge based on the guide RNA sequence and PAM sites. It can distinguish between in-frame deletions that result in truncated functional proteins and frameshift mutations that result in true knockouts. The SauCas9 merges were analyzed using TIDE because Synthego ICE software cannot deconvolve SauCas9 edits. TIDE analysis works in a similar manner to ICE by determining the editing pattern in the merge based on the guide RNA and PAM sites. However, instead of giving a true knockout score, it gives an editing efficiency score, which cannot distinguish between in-frame and frameshift editing patterns. Therefore, the editing efficiency score may overrepresent the guide RNA's ability to knock out proteins. SpyCas9 is a standard protein used in CRISPR gene editing. However, it is 4101bp, compared to Sau Cas9's 3156bp. Due to size limitations for packaging certain viruses such as AAV, it was decided to compare the editing capabilities of Sau Cas9 and SpyCas9 to see if the smaller Sau Cas9 could be used in the vector designed for this project.

[0171] Figure 2AThe diagram shown in –2D illustrates SpyCas9 in J774.2 (“J”) and NIH3T3 (“N”) cells, used in conjunction with multiple guide RNAs. Figure 2A and 2B ) and SauCas9 ( Figure 2C and 2D Editing efficiency is assessed using SynthegoICE or TIDE sanger deconvolution software. Figure 2A Knockout efficiency of Il1a using guide RNAs 43-46 and SpyCas9 in J774.2 and NIH3T3. Synthego ICE was used to deconvolve the Sanger sequence trace and determine the knockout efficiency. Figure 2B Knockout efficiency of Il1b using guide RNAs 47-50 and SpyCas9 in J774.2 and NIH3T3; not wanting to be limited by any particular theory, the data for sgRNA8 appear to show failed synthesis. Synthego ICE was used to deconvolve the sanger sequence trace and determine the knockout efficiency. Figure 2C Knockout efficiency of Il1a using guide RNAs 51-53 and saCas9 in J774.2 and NIH3T3. TIDE was used to deconvolve the Sanger sequence traces and determine the editing efficiency. Figure 2D Knockout efficiency of Il1b using guide RNAs 54-56 and Sau Cas9 in J774.2 and NIH3T3. TIDE was used to deconvolve the sanger sequence traces and determine the editing efficiency.

[0172] Example 3. Time-progression experiment to determine the optimal pretreatment time by reducing IL-1β expression through CRISPR gene engineering in a mouse uric acid model.

[0173] Preliminary experiments were conducted in mice before irritating them with uric acid to determine the optimal pretreatment time for the virus. A GFP-labeled AAV5 vector was injected into the knee joints of mice. Viral load was then quantified by PCR, and the site of viral infection was histologically quantified at 3, 5, and 7 days post-infection. The treatment time that produced robust viral expression within the joint was selected as the optimal advance time for injecting the viral vector into mice to experimentally determine the reduction of IL-1b induced by a CRISPR AAV vector engineered to target and silence or reduce IL-1b expression in a mouse uric acid model.

[0174] Experiments to confirm the knockdown and therapeutic effects of CRISPR AAV (AAV-spCas9) on IL-1b expression in a uric acid model.

[0175] Select mice and divide them into three groups:

[0176] Group 1: Mice injected with a CRISPR AAV vector (AAV-spCas9) engineered to target IL-1β and silence or reduce IL-1 protein expression.

[0177] Group 2: Mice injected with a CRISPR AAV vector engineered to have a load that does not affect IL-1 production, namely, "out-of-order" guide RNA / Cas9 (AAV-spCas9), and

[0178] Group 3: Mice injected with saline.

[0179] Then, after the optimal pretreatment time, the mice were irritated with uric acid. Within 24 hours of the uric acid injection, the animals were sacrificed, and cytokine expression in the joint tissues was analyzed (e.g., IL-1 expression was assessed by IHC). Overall histopathology and expression of inflammatory biomarkers in the joint tissues were also evaluated.

[0180] Group 1 mice treated with a CRISPR AAV vector engineered to target IL-1β and silence or reduce IL-1 protein expression showed reduced IL-1 levels and lower levels of inflammatory biomarkers by IHC compared to either of the other two groups.

[0181] Example 4. Time-course study of intra-articular injection of AAV in mice

[0182] A study was conducted to evaluate the time course of AAV injection into the joints of male C57BL / 6 mice.

[0183] Materials and Methods

[0184] Test substance identification and preparation - eGFP AAVPrime TM Purified adeno-associated virus particles: GFP-labeled AAV5 (GeneCopoeia) TM Catalog number AB201, batch number GC08222K1902, 1.18×10 13 (genome copies / mL) and AAV6 (GeneCopoeia) TM Catalog number AB401, batch number GC09242K1905, 5.47×10 12(1 genome copy / mL) was provided by us. AAV particles were transported on dry ice and stored at -80°C immediately upon receipt. The AAV particles were reconstituted in phosphate-buffered saline (PBS without calcium and magnesium: Corning, batch number 11419005) for administration at a dose of 10 μL per knee IA, prior to administration. For further details on the preparation, storage, and handling of the test sample, see the study protocol (Appendix A).

[0185] The testing system identified 8- to 10-week-old male C57BL / 6 mice (N=30) obtained from The Jackson Laboratory (Bar Harbor, ME). At registration on day 0 of the study, the mice weighed approximately 24 to 29 grams (mean 26 g). The animals were identified by clearly marked tags with their group and animal number drawn at the base of their tails. After randomization, all cages were appropriately color-coded with the protocol number, group number, and animal number (Appendix A).

[0186] Environment and Feeding – Upon arrival, the animals were housed in polycarbonate cages with wood shavings bedding and hanging food and water bottles at a rate of 3 to 5 per cage. The mice were housed in shoebox cages with filter tops (static airflow, approximately 70 inches). 2 Floor space) or individually ventilated pancake trough (passive airflow, approximately 70-75 inches) 2 Animal care, including the hygiene of rooms, cages, and equipment, is conducted in accordance with the Guide to the Care and Use of Laboratory Animals (Guide, 2011) and the applicable Bolder BioPATH SOP.

[0187] The animals were acclimatized to the environment for four days before entering the study. During the active phase of the study, a primary veterinarian was present on-site or available upon request. No concurrent medications were provided.

[0188] During acclimatization and research, the animals were housed in a laboratory environment with temperatures ranging from 19°C to 25°C and relative humidity from 30% to 70%. An automatic timer provided 12 hours of light and 12 hours of darkness. The animals were allowed free access to Envigo Teklad 8640 food and fresh municipal tap water.

[0189] Experimental Design – On day 0 of the study, mice were randomly assigned to treatment groups based on body weight. Following randomization, the animals were administered the treatment via intra-articular (IA) injection as shown in Table 4. Animal weight was measured as described in Section 8.5.1. Mice were euthanized at three time points (days 3, 5, and 7) for necropsy and tissue collection, as described in the section titled “Necropsy Samples” below.

[0190] Table 4. Grouping and Treatment Information

[0191]

[0192] Observation, measurement and sample

[0193] Body weight measurement – ​​The mice were weighed on day 0 of the study for randomization and weighed again on days 1, 3, 5, and 7. Body weight measurements can be found in Table 6.

[0194] Autopsy samples - as shown in Table 5, mice were autopsied on days 3, 5 and 7 of the study.

[0195] Table 5. Autopsy Schedule

[0196]

[0197] During necropsy, the mice were bled by cardiac puncture, followed by cervical dislocation. The right and left knees were harvested from all animals. Skin and muscle were removed from the joints, while preserving the joint capsule intact. The joints were flash-frozen individually in 15-mL conical tubes labeled only with the mouse number, collection date, and whether it was the right or left leg. The knee joints were stored frozen at -80°C for transport.

[0198] Animal disposal - Dispose of animal carcasses in accordance with BBP SOPs.

[0199] Sample and raw data storage - Submit samples (right and left knee joints), research data, and reports during or at the end of the study.

[0200] Statement regarding the impact of bias on the quality and integrity of the study - There was no bias against the study protocol.

[0201] Results / Conclusions

[0202] On day 0 of the study, male C57BL / 6 mice received GFP-labeled AAV5 (5 × 10⁻⁶) in their right knee. 9 IA was injected with 10 μL of 5 × 10⁻⁶ particles and AAV6 labeled with GFP was administered to the left knee. 9 IA (10 μL of each particle) was injected. Animals were weighed on days 0, 1, 3, 5, and 7 of the study. Autopsies were performed on days 3 (animals 1-10), 5 (animals 11-20), and 7 (animals 21-30), and the right and left knee joints were collected for transport. The live part of this study was successfully completed, including animal weighing, administration, and biological sample collection. All animals survived to the end of the study.

[0203] References

[0204] The Guide for the Care and Use of Laboratory Animals (8th Edition), National Research Council, National Academy of Sciences, Washington, DC, 2011, is incorporated herein by reference in its entirety for all purposes.

[0205]

[0206]

[0207] plan

[0208] Test System

[0209] Number of animals: 33 (30 + 3 extra)

[0210] Species / Strain or Variety: C57BL / 6

[0211] Supplier: Jackson

[0212] Age / weight at arrival: 8-10 weeks old (~20 grams)

[0213] Sex: Male

[0214] Age / weight range at the start of the study: at least 9 weeks acclimatization at the start of the study: at least 3 days acclimatization after arrival at BBP

[0215] Feeding: 3-5 animals / cage

[0216] Study Calendar

[0217]

[0218] Materials

[0219]

[0220]

[0221] Test Article and Media Information

[0222] Storage conditions for unprepared test items - GFP-labeled AAV5 (Group 1): -80°C; GFP-labeled AAV6 (Group 1): -80°C.

[0223] Media information - GFP-labeled AAV5 (Group 1): PBS (w / o Ca & Mg); GFP-labeled AAV6 (Group 1): PBS (w / o Ca & Mg).

[0224] Test item preparation instructions and calculations - GFP-labeled AAV5 (Group 1): Dilute the stock solution to the appropriate concentration using PBS; GFP-labeled AAV6 (Group 1): Dilute the stock solution to the appropriate concentration using PBS.

[0225] Dosage Forms and Media Storage and Stability - GFP-labeled AAV5 (Group 1): Dilute immediately before injection; GFP-labeled AAV6 (Group 1): Dilute immediately before injection.

[0226] Post-application disposal of test items - GFP-labeled AAV5 (Group 1): Disposable formulation, retained for future research; GFP-labeled AAV6 (Group 1): Disposable formulation, retained for future research.

[0227] In-life Phase Deliverables

[0228]

[0229] Autopsy Information

[0230] Execution Schedule: Group 1, An 1-10: Day 3

[0231] Group 1, An 11-20: Day 5

[0232] Group 1, Day 21-30: Day 7

[0233] Euthanasia method: bleeding through cardiac puncture, followed by cervical dislocation.

[0234] Time point: Irregular

[0235]

[0236] *The tubes are labeled only with the mouse number, collection date, and whether it is the left or right leg. Samples are tested without specifying whether they were injected with AAV-2 or AAV-5. Answers are provided only after PCR is complete.

[0237] Sample Analysis

[0238] Tissue samples – Hind limbs from AAV-injected mice were flash-frozen and transported. Upon arrival, the samples were transferred to a -80°C freezer for storage.

[0239] GFP expression in target tissues – Hind limbs (in pairs) were thawed at room temperature and imaged using an IVIS bioluminescence imaging system (Lumina III; Perkin Elmer). GFP fluorescence was quantified using excitation at 488 nm and emission measurements at 510 nm. A total of four mice were evaluated at each time point (days 3, 5, and 7). Tissues from the remaining six animals at each time point were retained for subsequent confirmation of viral load using real-time PCR.

[0240] The result - as can be seen Figure 3 As observed, high levels of GFP expression were present in the injected knee joint 3 days post-injection. Viral load decreased slightly on day 5, then rose again until day 7. Due to the limited sample size in this pilot study, there were no significant differences in behavior between AAV-5 and AAV-6.

[0241] Discussion – Data from this study support the use of AAV-5 or AAV-6 for intra-articular delivery of CRISPR-Cas9 in the mouse knee joint. Levels of both viral serotypes increased from day 5 to day 7, preserving the possibility that they could increase further if follow-up is extended to 2 weeks, or possibly 3 weeks. Further work is needed to confirm this, but data to date suggest that there should be at least a one-week interval before injection of the vector and stimulation with intra-articular monoiodoacetic acid (MIA) crystals.

[0242] Background and Basic Principles – In this work, a monoiodoacetic acid (MIA)-induced OA model was used for two reasons. First, spontaneous OA is extremely rare in mice, while the MIA-injected OA-induced model has a relatively rapid and predictable onset and provides good clinical relevance to disease phenotypes seen in human OA patients, including intra-articular inflammation, pain, and cartilage degeneration. Second, compared to surgical models such as medial meniscal instability (DMM) and anterior cruciate ligament transectomy (ACLT), the MIA model does not involve surgical incisions in the joint capsule, making it more closely approximating the joint capsule of human patients with OA.

[0243] In rodents, injection of MIA crystals recreates osteoarthritis-like lesions and functional deficits, which can be analyzed and quantified using techniques such as behavioral testing and objective lameness assessment. MIA is an inhibitor of glyceraldehyde-3-phosphatase, which induces changes in cellular glycolysis that ultimately lead to the death of intra-articular cells, including chondrocytes. Chondrocyte death manifests as cartilage degeneration and altered proteoglycan staining. Mice injected with MIA typically exhibit pain-like behavior within 72 hours and show cartilage loss approximately 4 weeks post-injection. Increased IL-1 expression has been demonstrated in rats and mice within 2–3 days post-injection.

[0244] Study Design – Mice were unilaterally injected with either MIA or saline-mediated control (one joint per animal). In each group, half of the animals were pretreated with an AAV-CRISPR-Cas9 vector targeting the mouse IL-1β gene, and the other half were injected with a scrambled AAV-CRISPR-Cas9 control. Animals from both groups withdrew from the study at one of two time points: an early time point of 48 hours to allow assessment of the effect of the therapy on IL-1 levels in the synovial fluid; and a late time point of 4 weeks to allow assessment of the effect of the therapy on histological evidence of cartilage destruction and osteoarthritis.

[0245] method

[0246] Laboratory animals – A total of 80 mice were used in this study. The experimental procedures were reviewed and approved by the local IACUC. Mice were housed in small isolation cages, fed a standard laboratory animal diet, and allowed free access to water.

[0247] MIA Model and Anti-IL1 Therapy - Mice were acclimatized to the environment for 7 days prior to the study. On the first day of the study, mice were anesthetized by inhalation of a mixture of isoflurane and oxygen. Once the surgical anesthesia plane was confirmed, the right hind limb was clamped and the skin was cleaned with a surgical disinfectant. Forty mice (treatment) received an intra-articular injection of an IL-1-targeting AAV-CRISPR-Cas9 vector, while the remaining 40 mice (control) received an intra-articular injection of AAV-CRISPR-Cas9 in a randomized control manner. Seven days later, half of the animals in each group received an intra-articular injection of MIA in the same joint, while the other half received a saline medium. This established four study groups:

[0248] Group 1: Treatment-MIA (20 mice)

[0249] Group 2: Control - MIA (20 mice)

[0250] Group 3: Treatment-Mediator (20 mice)

[0251] Group 4: Control-Mediator (20 mice)

[0252] Forty mice in each group were euthanized 48 hours after MIA irritation in order to record IL-1 levels in the knee joint. The remaining animals were fed for 4 weeks to assess the effects of the therapy on pain behavior (behavioral tests, including the von Frey test), lameness (limb use), joint swelling (caliper measurement), and joint pathology (histopathology).

[0253] Euthanasia and tissue collection – Mice were killed by exsanguination followed by cervical dislocation. The joints were opened and flushed for IL-1 measurement (48-hour group) or fixed in 10% formalin for decalcified histopathological examination (4-week group).

[0254] The above embodiments are provided to offer a complete disclosure and description of how to manufacture and use the compositions, systems, and methods of the present invention to those skilled in the art, and are not intended to limit the scope of the invention as understood by the inventors. Modifications to the above-described embodiments for carrying out the invention will be apparent to those skilled in the art and are intended to fall within the scope of the following claims. All patents and publications mentioned in this specification indicate the level of expertise of those skilled in the art to which this invention pertains.

[0255] All headings and section titles are used for clarity and reference purposes only and should not be construed as limiting in any way. For example, those skilled in the art will recognize that it will be useful to suitably combine the various aspects derived from the different headings and sections in accordance with the spirit and scope of the invention described herein.

[0256] It should be understood that the methods described herein are not limited to the specific methods, protocols, subjects, and sequencing technologies described herein, and therefore can be varied. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the methods and compositions described herein, which will be limited only by the appended claims. Although certain embodiments of this disclosure have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided merely as examples. Numerous changes, variations, and substitutions will now occur to those skilled in the art without departing from this disclosure. It should be understood that various alternatives to the embodiments of this disclosure described herein may be used in the practice of this disclosure. The following claims are intended to define the scope of this disclosure and therefore cover the methods and structures within the scope of these claims and their equivalents.

[0257] For illustrative purposes, several aspects are described with reference to exemplary applications. Unless otherwise specified, any implementation can be combined with any other implementation. It should be understood that the extensive detailing of specific details, relationships, and methods is intended to provide a comprehensive understanding of the features described herein. However, those skilled in the art will readily recognize that the features described herein can be practiced without one or more specific details or using other methods. The features described herein are not limited to the order of the described actions or events, as some actions may occur in a different order and / or simultaneously with other actions or events. Furthermore, not all described actions or events are necessary to implement methods conforming to the features described herein.

[0258] Although certain embodiments have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided merely as examples. The invention is not intended to be limited to the specific examples provided herein. While the invention has been described with reference to the foregoing specification, the description and illustration of embodiments herein are not intended to be construed as limiting. Numerous changes, variations, and substitutions will now occur to those skilled in the art without departing from the invention.

[0259] Furthermore, it should be understood that all aspects of the invention are not limited to the specific descriptions, configurations, or relative proportions set forth herein, which depend on various conditions and variables. It should be understood that various alternatives to the embodiments of the invention described herein may be used in the practice of the invention. Therefore, it is contemplated that the invention should also cover any such alternatives, modifications, variations, or equivalents. The following claims are intended to define the scope of the invention and thus cover the methods and structures within the scope of these claims and their equivalents.

[0260] All publications, patents, and patent applications herein are incorporated herein by reference to the extent that each individual publication, patent, or patent application is specifically and individually indicated to be incorporated herein by reference. In the event of any conflict between the terminology used herein and the terminology in the incorporated references, the terminology used herein shall prevail.

Claims

1. A pharmaceutical composition for treating or preventing joint diseases or conditions, comprising a gene editing system, wherein the gene editing system targets at least one gene locus related to joint function.

2. The pharmaceutical composition of claim 1, wherein the gene editing system targets one or more of IL-1α and / or IL-1β.

3. The pharmaceutical composition of claim 1 or 2, wherein the gene editing system silences or reduces the expression of the at least one joint function-related locus in at least a portion of cells including the joint.

4. The pharmaceutical composition of claim 1, wherein the at least one joint function-related locus is a cytokine and / or growth factor locus.

5. The pharmaceutical composition of claim 4, wherein the cytokine and / or growth factor gene loci are selected from the group consisting of IL-1α, IL-1β, TNF-α, IL-6, IL-8, IL-18, matrix metalloproteinase (MMP), NLRP3, ASC (apoptosis-associated speckle-like protein containing CARD), caspase-1, and combinations thereof.

6. The pharmaceutical composition of claim 1, wherein the gene editing comprises using a programmable nuclease, the programmable nuclease mediating the generation of double-strand or single-strand breaks at at least one joint function-related locus.

7. The pharmaceutical composition according to any one of claims 1 to 6, wherein the gene editing of the at least one joint-related locus is silenced or reduced in the expression of at least a portion of cells including the joint.

8. The pharmaceutical composition according to claim 7, wherein the one or more cytokine and / or growth factor genes are selected from the group consisting of IL-1α, IL-1β, TNF-α, IL-6, IL-8, IL-18, matrix metalloproteinase (MMP), NLRP3, ASC (apoptosis-associated speckle-like protein containing CARD), caspase-1, and combinations thereof.

9. The pharmaceutical composition according to any one of claims 1 to 8, wherein the gene editing enhances the expression of one or more cytokine and / or growth factor genes in at least a portion of cells including joints, said cytokine and / or growth factor genes being selected from the group consisting of IL-1Ra, TIMP-1, TIMP-2, TIMP-3, TIMP-4, and combinations thereof.

10. The pharmaceutical composition according to any one of claims 1 to 9, wherein the gene editing comprises using a programmable nuclease that mediates the generation of double-strand or single-strand breaks at one or more cytokine and / or growth factor genes.

11. The pharmaceutical composition according to any one of claims 1 to 10, wherein the gene editing comprises one or more methods selected from CRISPR, TALE, zinc finger, and combinations thereof.

12. The pharmaceutical composition according to any one of claims 1 to 10, wherein the gene editing comprises CRISPR.

13. The pharmaceutical composition according to claim 12, wherein the CRISPR method is the CRISPR-Cas9 method.

14. The pharmaceutical composition according to any one of claims 1 to 10, wherein the gene editing comprises the TALE method.

15. The pharmaceutical composition according to any one of claims 1 to 10, wherein the gene editing comprises zinc finger method.

16. A method for treating or preventing joint diseases or conditions, the method comprising introducing a gene editing system, wherein the gene editing system targets at least one gene locus associated with joint function.

17. The method of claim 16, wherein the gene editing system targets one or more of IL-1α and / or IL-1β.

18. The method of claim 16 or 17, wherein the gene editing system silences or reduces the expression of the at least one joint function-related locus in at least a portion of cells including the joint.

19. The method of claim 16, wherein the at least one joint function-related locus is a cytokine and / or growth factor locus.

20. The method of claim 19, wherein the cytokine and / or growth factor gene loci are selected from the group consisting of IL-1α, IL-1β, TNF-α, IL-6, IL-8, IL-18, matrix metalloproteinases (MMP), NLRP3, ASC (apoptosis-associated speckle-like protein containing CARD), caspase-1, and combinations thereof.

21. The method according to any one of claims 16 to 20, wherein the gene editing comprises using a programmable nuclease that mediates the generation of double-strand or single-strand breaks at at least one joint function-related locus.

22. The method according to any one of claims 16 to 21, wherein the gene editing of the at least one joint-related locus is silenced or reduced in expression in at least a portion of cells comprising the joint.

23. The method of claim 22, wherein the one or more cytokine and / or growth factor genes are selected from the group consisting of IL-1α, IL-1β, TNF-α, IL-6, IL-8, IL-18, matrix metalloproteinases (MMP), NLRP3, ASC (apoptosis-associated speckle-like protein containing CARD), caspase-1, and combinations thereof.

24. The method of any one of claims 16 or 17, wherein the gene editing enhances the expression of one or more cytokine and / or growth factor genes in at least a portion of cells including joints, said one or more cytokine and / or growth factor genes being selected from the group consisting of IL-1Ra, TIMP-1, TIMP-2, TIMP-3, TIMP-4, and combinations thereof.

25. The method according to any one of claims 16 to 20, wherein the gene editing comprises using a programmable nuclease that mediates the generation of double-strand or single-strand breaks at one or more cytokine and / or growth factor genes.

26. The method according to any one of claims 16 to 25, wherein the gene editing comprises one or more methods selected from CRISPR, TALE, zinc finger, and combinations thereof.

27. The method according to any one of claims 16 to 26, wherein the gene editing comprises CRISPR.

28. The method of claim 27, wherein the CRISPR method is the CRISPR-Cas9 method.

29. The method according to any one of claims 16 to 25, wherein the gene editing comprises the TALE method.

30. The method according to any one of claims 16 to 25, wherein the gene editing comprises zinc finger method.

31. A method for treating lameness in dogs caused by joint disease, the method comprising administering to the dog the composition of any one of claims 1 to 15.

32. The method of claim 31, wherein the composition is injected into the joint.

33. A method for treating lameness in horses caused by joint disease, the method comprising administering to the horse in need the composition of any one of claims 1 to 15.

34. The method of claim 33, wherein the composition is injected into the joint.

35. The method of any one of claims 31 to 34, wherein the joint disease is an inflammatory joint disease.

36. A method of treating a subject suffering from arthritis, the method comprising administering to the subject a therapeutically effective amount of a clustered regularly spaced short palindromic repeat (CRISPR) gene-editing complex comprising CRISPR-associated protein 9 (Cas9) and at least one guide RNA targeting said gene. The gene is selected from the group consisting of IL-1α, IL-1β and combinations thereof, and the at least one guide RNA targeting the gene is an RNA sequence complementary to the DNA sequence selected from the group consisting of SEQ ID NO: 7-SEQ ID NO:

20.

37. The method of claim 36, wherein the arthritis is osteoarthritis.

38. The method of claim 36, wherein the CRISPR gene editing complex comprises a Cas9 protein and a single guide RNA.

39. The method of claim 38, wherein the CRISPR gene editing complex comprises a Cas9 protein complexed with the single guide RNA.

40. The method of claim 36, wherein the CRISPR gene editing complex comprises a Cas9 protein and a nucleic acid encoding at least one guide RNA targeting one or both of IL-1α and IL-1β.

41. The method of claim 36, wherein the Cas9 is administered as a nucleic acid comprising a sequence encoding the Cas9 protein.

42. The method of claim 41, wherein the nucleic acid comprising a sequence encoding the Cas9 protein is administered in a virus.

43. The method of claim 42, wherein the virus is selected from the group consisting of recombinant retroviruses, adenoviruses, adeno-associated viruses (AAVs), and lentiviruses.

44. The method of claim 43, wherein the virus is adeno-associated virus (AAV).

45. The method of claim 42, comprising administering a nucleic acid containing a sequence encoding at least one guide RNA targeting one or both of IL-1α and IL-1β.

46. ​​The method of claim 45, wherein the nucleic acid comprising a sequence encoding the guide RNA is administered in a virus.

47. The method of claim 46, wherein the virus is selected from the group consisting of recombinant retroviruses, adenoviruses, adeno-associated viruses (AAVs), and lentiviruses.

48. The method of claim 47, wherein the virus is adeno-associated virus (AAV).

49. The method of claim 36, wherein the complex is administered as a single nucleic acid comprising a sequence encoding the Cas9 protein and a sequence encoding the at least one guide RNA, preferably via a viral vector, and the Cas9 protein and the at least one guide RNA are expressed from the same nucleic acid.

50. The method of claim 36, wherein the complex is administered in more than one nucleic acid, preferably in more than one viral vector, wherein the first nucleic acid contains a sequence encoding the at least one guide RNA, the second nucleic acid contains a sequence encoding the Cas9 protein, and the at least one guide RNA and the Cas9 protein are expressed by separate nucleic acids.

51. The method of claim 49 or 50, wherein the nucleic acid is a viral vector selected from the group consisting of recombinant retroviral vectors, adenovirus vectors, adeno-associated virus (AAV) vectors, and lentiviral vectors.

52. The method of claim 51, wherein the viral vector is an adeno-associated virus (AAV) vector.

53. The method of claim 36, comprising administering a guide RNA targeting IL-1α.

54. The method of claim 36, comprising administering a guide RNA targeting IL-1β.

55. The method of claim 36, wherein the Cas9 is Streptococcus thermophilus (ST)Cas9 (StCas9), Treponema denticulatum (TD) (TdCas9), Streptococcus pyogenes (SP) (SpCas9), Staphylococcus aureus (SA)Cas9 (SaCas9), or Neisseria meningitidis (NM)Cas9 (NmCas9) or a variant thereof.

56. The method of claim 55, wherein the Cas9 is SpCas9 or a variant thereof.

57. The method of claim 56, wherein the SpCas9 is SpyCas9 or a variant thereof.

58. The method of claim 36, wherein the CRISPR gene-editing complex is applied systemically or locally to the site of arthritis.

59. The method of claim 36, wherein the CRISPR gene-editing complex is applied topically to a treatment site, the treatment being selected from the group consisting of surgery, application of a topical ointment, and combinations thereof.

60. The method of claim 36, wherein the CRISPR gene editing complex is formulated in a composition comprising a biodegradable and / or biocompatible polymer for administration.

61. The method of claim 60, wherein the biodegradable and / or biocompatible polymer is selected from the group consisting of collagen, ethylene-vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoester, polyethylene glycol-coated liposomes, and polylactic acid.

62. The method of claim 36, wherein the subject is a human.

63. The method of claim 36, wherein the subject is a non-human subject selected from a group consisting of apes, baboons, cows, dogs, goats, gorillas, guinea pigs, hamsters, lemurs, mice, orangutans, pigs, rats, horses, and sheep.

64. The method of claim 36, wherein the editing efficiency of the CRISPR gene editing complex is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.

65. A pharmaceutical composition comprising: A therapeutically effective amount of a clustered regularly spaced short palindromic repeat (CRISPR) gene-editing complex, the complex comprising CRISPR-associated protein 9 (Cas9) and at least one guide RNA targeting the gene. The gene is selected from the group consisting of IL-1α, IL-1β and combinations thereof, and the at least one guide RNA targeting the gene is an RNA sequence complementary to the DNA sequence selected from the group consisting of SEQ ID NO: 7 to SEQ ID NO: 20.

Images