A stomach poison insecticidal activity polypeptide and its preparation method and application
The peptide Pc-1, identified and optimized from the mucus of marine ribbon worms, solves the problem of insufficient stomach poison activity of existing peptides during insect feeding, achieving highly efficient pest control and providing an important molecule for the next generation of peptide insecticides.
Patent Information
- Application Number
- CN202511837471.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-08
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2045-12-08
AI Technical Summary
Existing insecticidal peptides are difficult to exert stomach poison activity when pests feed or come into contact with them, which limits their practical application as spray-type biological pesticides. In particular, peptides extracted from predatory natural enemies such as spiders and scorpions that inject venom have poor stability in the insect gut and are difficult to penetrate midgut epithelial cells.
Pc-1, a polypeptide with potent stomach poison activity, was identified from the mucus of marine ribbonworms. Through bioinformatics screening and activity verification, its polynucleotide sequence was optimized to adapt it for plant expression. A recombinant expression vector was constructed and expressed in Pichia pastoris. After purification, it was used for pest control.
Pc-1 exhibits significant stomach poison activity during insect feeding and has a highly effective insecticidal effect on various lepidopteran pests such as the beet armyworm and the cotton bollworm. It overcomes the bottleneck of traditional peptides' inability to penetrate the insect gut and provides the core molecule for a new generation of peptide insecticides.
Smart Images

Figure CN121249682B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological control, specifically to a stomach poison insecticidal active polypeptide, its preparation method, and its application. Background Technology
[0002] Peptides are short-chain substances composed of 2 to 50 amino acids linked by peptide bonds. They are being developed into a new generation of biopesticides, showing great potential in combating plant pathogens, killing pests, and stimulating plant immunity. In the field of biopesticides, insecticidal peptides have attracted much attention due to their unique advantages. For example, the peptide insecticide SPEAR® developed by Vestaron in the United States has its active ingredient derived from the Blue Mountain funnel-web spider (Spider simonii). Hadronyche versuta The venomous peptide ω / κ-HXTX-Hv1a not only maintains its effectiveness in the field for approximately two weeks, but its degradation products are also nutrients such as amino acids, making it environmentally friendly. SOLASTA Bio in the UK has also developed a new generation of peptide insecticides that can precisely target specific tissues of pests, alter their behavior, and effectively control their populations. Compared to traditional chemical pesticides, peptide insecticides have significant advantages such as high target specificity, safety for both the environment and non-target organisms, and easy degradation with no residue in the environment, representing an important direction for the development of green pesticides.
[0003] Despite the promising prospects of insecticidal peptides, their development still faces key challenges, particularly the limitations of their administration routes. Ideally, agricultural insecticidal peptides should possess stomach poison or contact activity to exert their effects through ingestion or contact with pests. However, current research primarily focuses on extracting active peptides from predatory predators such as spiders and scorpions, which possess the ability to inject venom. These peptides are evolutionarily adapted to paralyze prey through injection, thus exhibiting strong injection activity. However, they typically lack stomach poison activity due to poor stability in the insect gut and difficulty in penetrating midgut epithelial cells, resulting in low bioavailability. This significantly limits their practical application as sprayable biopesticides. Therefore, developing new resources to discover peptide molecules with highly efficient stomach poison activity is crucial for breakthroughs in this field.
[0004] In recent years, research has shifted its focus to venomous organisms that prey on or defend themselves by secreting mucus-like venom rather than relying on stingers or chelicerae. Marine ribbon worms (or rostellates) are outstanding examples of this type of resource, subduing their prey by secreting highly viscous venom through their forked proboscis. Studies have shown that polypeptide α1, identified from the epidermal mucus of the ribbon worm *Gymnospermia macrospinosa*, possesses an inhibitory cystine knot (ICK) motif. This polypeptide not only exhibits potent activity against voltage-gated sodium channels in cockroaches, but subsequent studies have also revealed significant stomach poison effects against aphids and cabbage looper larvae.
[0005] Furthermore, on the one hand, there are differences in understanding among those skilled in the art; on the other hand, the inventors studied a large number of documents and patents when making this invention, but due to space limitations, not all details and contents were listed in detail. However, this does not mean that the present invention does not possess the features of these prior art. On the contrary, the present invention already possesses all the features of the prior art, and the applicant reserves the right to add relevant prior art to the background art. Summary of the Invention
[0006] This invention relates to the field of biological control, specifically to a stomach poison insecticidal active polypeptide and its preparation method and application, and more specifically to the stomach poison insecticidal active polypeptide and its polynucleotides, expression cassettes, preparation methods, usage methods, and applications.
[0007] This application successfully identified a novel polypeptide, Pc-1, with potent stomach poison activity against various lepidopteran pests, including the beet armyworm, from nematode omics data through bioinformatics screening and activity verification. This provides a highly promising candidate molecule for the development of next-generation polypeptide insecticides.
[0008] To address the aforementioned technical problems, one objective of this invention is to provide a polynucleotide molecule encoding a stomach poison and insecticidal active polypeptide, wherein the polynucleotide molecule is selected from one of the following nucleic acid molecules:
[0009] A nucleic acid molecule composed of a nucleotide sequence selected from SEQ ID NO: 1;
[0010] A nucleic acid molecule encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2.
[0011] According to a preferred embodiment, the polynucleotide molecule comprises a synthetic nucleotide sequence optimized with plant-preferred codons to suit expression in plants. Embodiments of the invention also provide isolated stomach poison insecticidal active peptides encoded by natural or modified (e.g., mutagenic or manipulated) nucleic acids of the embodiments of the invention. Specifically, the stomach poison insecticidal active peptides of the embodiments of the invention comprise fragments of codon-optimized peptides. In specific embodiments, the peptides of the embodiments exhibit stronger expression activity relative to the insecticidal activity of the natural peptides from which they are derived, thereby enabling their expression in specific plants or microorganisms, or resulting in higher expression levels or stronger toxicity.
[0012] One object of the present invention is to provide an expression cassette containing the polynucleotide molecule described above and a heterologous regulatory sequence operatively linked thereto. The heterologous regulatory sequence may be, for example, the yeast glycerol phosphate kinase (PGK) promoter, the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter, the alcohol dehydrogenase ADH (ADH) promoter, the alcohol oxidase 1 (AOX1) promoter, the galactokinase (GAL1) promoter, the β-galactosidase (LAC4) promoter, the *E. coli* T7 RNA polymerase (T7) promoter, a Lac operon-derived promoter, the maize ubiquitin gene (Ubi) promoter, or the cauliflower mosaic virus (CaMV 35S) promoter.
[0013] Preferably, the expression cassette is the pICZα1-Pc-1 recombinant expression vector.
[0014] One of the objectives of this invention is to provide a gastric toxic insecticidal active polypeptide, which is selected from one of the following polypeptides:
[0015] A polypeptide consisting of the amino acid sequence of SEQ ID NO: 2;
[0016] A polypeptide encoded by a nucleotide sequence selected from SEQ ID NO: 1.
[0017] One object of the present invention is to provide a composition comprising the polypeptides described above. The composition may optionally include additional insecticidal peptides. The composition may also contain Bacillus thuringiensis, Beauveria bassiana, Metarhizium anisopliae, or nucleopolyhedrovirus.
[0018] One of the objectives of this invention is to provide a method for preparing a transgenic plant, wherein the transgenic plant comprises plant cells, and the plant cells contain the expression cassette described above.
[0019] According to a preferred embodiment, the plant is tobacco, chili pepper, or tomato.
[0020] One object of the present invention is to provide a method for controlling pests, the method comprising providing an insecticidally effective amount of a stomach poison insecticidal active polypeptide to pest-infested plants and / or insects, the stomach poison insecticidal active polypeptide being selected from one of the following polypeptides:
[0021] A polypeptide consisting of the amino acid sequence of SEQ ID NO: 2;
[0022] A polypeptide encoded by a nucleotide sequence selected from SEQ ID NO: 1.
[0023] According to a preferred embodiment, the pest is a lepidopteran pest. Preferably, the pest is the beet armyworm, fall armyworm, cotton bollworm, armyworm, oriental armyworm, diamondback moth, cabbage looper, or beet armyworm.
[0024] One of the objectives of this invention is to provide a method for preparing a stomach poison and insecticidal active polypeptide, the method comprising culturing host cells under conditions in which the nucleotide molecules encoding the polypeptide can be expressed, the host cells containing the expression cassette described above.
[0025] The beneficial effects of this invention are:
[0026] Addressing the technical bottleneck of insufficient or nonexistent stomach poison activity in existing technologies for insecticidal peptides derived from the venom of predatory insect predators such as spiders and scorpions, this invention shifts the focus of resource extraction to a novel natural active molecule library: the mucus of the giant Antarctic worm *Nematocera crus-galli*. This invention comprehensively utilizes a series of techniques including bioinformatics analysis, multiple sequence alignment, three-dimensional structure prediction, recombinant expression, and bioactivity verification to, for the first time, extract insecticidal peptides from the mucus of the giant Antarctic worm *Nematocera crus-galli*. Parborlasia corrugatus A novel insecticidal polypeptide, Pc-1, with potent stomach poison activity was successfully identified and characterized in the mucus component of ( ).
[0027] Compared to insecticidal peptides derived from spiders and scorpions, Pc-1 exhibits a significant advantage in stomach poison activity, effectively exerting its insecticidal effect through insect ingestion, thus overcoming the formulation bottleneck of traditional injectable active peptides that are difficult to apply in practical agricultural pest control. Compared to α1, the only known reference peptide from the nematode *Spodoptera litura* with stomach poison activity, Pc-1 demonstrates stronger insecticidal efficacy under the same experimental conditions, indicating a significant improvement in its activity intensity. Furthermore, activity assays show that Pc-1 possesses broad-spectrum and highly effective insecticidal activity against various lepidopteran pests, including the beet armyworm and cotton bollworm, indicating its broad-spectrum application potential and providing an important core molecular entity for the development of a new generation of highly effective, low-residue, and environmentally compatible peptide-based biopeptides. Attached Figure Description
[0028] Figure 1 This is a three-dimensional structural diagram of the amino acid sequence of Pc-1 of the present invention;
[0029] Figure 2 This is a map of the pICZα1-Pc-1 recombinant expression vector of the present invention;
[0030] Figure 3 The images show the SDS-PAGE and immunoblotting patterns of the recombinant expression Pc-1 of the present invention, wherein A is the SDS-PAGE electrophoresis image of the recombinant polypeptide and B is the SDS-PAGE immunoblotting image of the recombinant polypeptide.
[0031] Figure 4 This is a comparison diagram showing the injection activity of Pc-1 of the present invention with three other insecticidal peptides against the fifth instar beet armyworm.
[0032] Figure 5This is a comparison diagram of the stomach poison activity of Pc-1 of the present invention with three other insecticidal peptides against newly hatched larvae of the beet armyworm.
[0033] Figure 6 The figure shows the feeding of newly hatched larvae of the beet armyworm on the chili leaf discs of the present invention under different Pc-1 concentrations. The number in the upper left corner of the figure represents the Pc-1 concentration in μg / μL. Detailed Implementation
[0034] In the description of this invention, terminology is used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Those skilled in the art will recognize that any useful mutations can be added to the sequences of embodiments of the invention, provided that the encoded polypeptide retains its insecticidal activity.
[0035] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials, reagents or instruments used, unless otherwise specified by the manufacturer, are all commercially available reagents and materials; the conditions not specified in the examples are all carried out according to conventional conditions or conditions recommended by the manufacturer. At the same time, the present invention does not limit the source of the raw materials used. Unless otherwise specified, the raw materials used in the present invention are all commercially available products in this technical field.
[0036] Although in specific embodiments of the present invention, to obtain accurate toxicity data, the peptide Pc-1 was mainly injected directly into the larvae of the beet armyworm via micro-injection to verify its stomach poison insecticidal activity, those skilled in the art should understand that the injection activity results fully predict and represent the toxic effects of the peptide on pests through other conventional application routes (e.g., expression in plants followed by ingestion by pests, or direct spraying of the peptide formulation onto the crop surface for pest ingestion). Injection and feeding experiments directly demonstrate that the peptide can exert a highly efficient insecticidal effect after entering the hemolymph and digestive system, which is usually a key prerequisite for achieving stomach poison activity. Therefore, the significant activity exhibited by the peptide Pc-1 in the model clearly supports its great potential in applications as a sprayable biopesticide or in pest control mediated by transgenic plants. Particularly important, compared with known insecticidal peptides such as α1, D1, and T1 in the prior art, Pc-1 exhibits superior insecticidal efficacy in the following experiments, and this significant comparative advantage further highlights its outstanding technological advancement and practical application value.
[0037] (I) Preparation and extraction of polypeptides
[0038] Comparative analysis, structural prediction, and bioactivity assays of reported *Nematocystis* transcriptome data revealed a polypeptide named Pc-1 with the amino acid sequence: GCIKYDKFCTLSKGCCSGNCGWKFHCIASN (SEQ ID NO: 2). This polypeptide exhibits significant stomach poisoning activity. Pc-1 consists of 30 amino acid residues, has a molecular weight of 3273.84 Da, and an isoelectric point of 8.28. The polypeptide contains six cysteine residues, and structural prediction showed that these six cysteine residues are linked to form three disulfide bonds, constituting a typical ICK spatial structure. Figure 1 As shown.
[0039] The Pc-1 amino acid sequence was codon optimized according to the expression preference of Pichia pastoris. The optimized expression Pc-1 sequence is: GGTTGTATTAAGTACGATAAGTTCTGTACTTTGTCTAAAGGTTGTTGTTCTGGTAATTGTGGTTGGAAATTTCATTGTATTGCTTCTAAC (SEQ ID NO: 1).
[0040] The above sequence (SEQ ID NO: 1) was constructed into the Pichia pastoris expression vector pICZαA using seamless cloning technology, resulting in a vector map of the recombinant expression of Pc-1. The vector map is shown below. Figure 2 As shown, the methanol-inducible promoter pAOX1 drives the expression of Pc-1. Pc-1 has a yeast α-factor secretion signal peptide at its N-terminus, ensuring that Pc-1 is expressed in secretory form. Pc-1 also has His expression at its C-terminus, which facilitates subsequent purification of Pc-1.
[0041] Pc-1 recombinant secretory expression involves the following three steps.
[0042] (1) pICZαA-Pc-1 genetic transformation
[0043] To facilitate the integration of the expression vector into the Pichia pastoris genome, the constructed recombinant expression vector pICZαA-Pc-1 was first linearized within the pAOX1 promoter region by digesting the corresponding restriction enzyme sites within the pAOX1 promoter region using restriction endonucleases such as Sac I / PmeI / BstX I. The linearized pICZαA-Pc-1 was then transformed into Pichia pastoris X33 competent cells via electroporation. The transformed Pichia pastoris X33 cells were plated on YPD medium containing bleomycin (concentrations of 100-1000 mg / L are acceptable; higher concentrations result in a higher probability of positive transformants) and cultured at 30°C for 2-4 days.
[0044] (2) Screening of Pc-1 expression positive transformants
[0045] Select 10-20 transformants grown on Zeocin-resistant plates and purify them on YPD plates containing 200 mg / L Zeocin (single colony isolation by streaking). Inoculate the purified transformants into BMGY (Buffered Complex Medium containing glycerol) liquid culture medium and incubate at 30°C and 250 rpm until the OD600 reaches 2-6 (approximately 16-18 hours), at which point the cells are in the logarithmic growth phase. Collect the cells by centrifugation at 1500-3000×g for 5 minutes at room temperature, discard the supernatant, resuspend the cell pellet in BMMY (Buffered Complex Medium containing methanol) liquid medium, and adjust the OD of the bacterial culture. 600 The methanol concentration was adjusted to 1.0 to induce Pc-1 expression. 100% methanol was added every 24 hours to maintain a final methanol concentration of 0.5% in the system for continued induction. Samples were periodically centrifuged, and the supernatant was collected and analyzed by SDS-PAGE electrophoresis to detect Pc-1 expression.
[0046] (3) Pc-1 expression and purification
[0047] After detecting that the positive transformant has successfully expressed Pc-1, fermentation is required to expand the culture and prepare more Pc-1 for subsequent bioactivity assays.
[0048] The fermentation supernatant obtained by centrifugation was used to purify Pc-1 by His-tagged affinity chromatography.
[0049] The purification process was as follows: The Ni-NTA affinity chromatography column was equilibrated with binding buffer (25 mM Tris, 300 mM NaCl, pH 7.0); after adding the supernatant to the affinity chromatography column, non-specific binding proteins were removed with 2-5 column volumes of wash buffer (25 mM Tris, 300 mM NaCl, 30 mM imidazole, pH 7.0); finally, the recombinant peptide Pc-1 was eluted with elution buffer (25 mM Tris, 300 mM NaCl, 200 mM imidazole, pH 7.0), and the eluent was concentrated by ultrafiltration, washed with PBS buffer, and lyophilized for subsequent bioactivity assays. The purified Pc-1 was qualitatively analyzed by SDS-PAGE, and the concentration of purified Pc-1 was determined by BCA protein quantification.
[0050] Figure 3SDS-PAGE electrophoresis and immunoblotting images of recombinant Pc-1 peptides at different concentrations are shown. The molecular weight of Pc-1 itself is 3.2 kDa. Because the N-terminal signal peptide of Pc-1 was not removed during processing, the recombinant Pc-1 expressed is larger than the theoretical molecular weight. The recombinant Pc-1 band detected by SDS-PAGE is around 10 kDa, consistent with the actual size of the recombinant Pc-1 peptide. Figure 3 A).
[0051] Further immunoblotting analysis of the Pc-1 recombinant peptide using an anti-histag antibody confirmed that the target band was indeed the Pc-1 recombinant peptide. Figure 3 B).
[0052] (II) Validation of peptide function
[0053] Using laboratory-raised populations of Spodoptera litura as test insects, the injection activity and stomach poison activity of purified Pc-1 were determined.
[0054] The general steps of the injection activity test are as follows: Select fifth-instar larvae of uniform size that have recently molted as bioassay material; dilute Pc-1 with 0.1×PBS buffer to prepare 7 concentration gradients: 0.25 μg / μL, 0.5 μg / μL, 1 μg / μL, 2 μg / μL, 4 μg / μL, 6 μg / μL, and 8 μg / μL, plus a blank control (CK, 0.1×PBS) for a total of 8 groups; each group consists of 3 replicates for every 10 larvae; inject 5 μL of insecticidal peptide liquid into the beet armyworm larvae from the anterior dorsal region behind the head shell using a microsyringe with a needle outer diameter of 0.26 mm; the control group is injected with 5 μL of 0.1×PBS buffer; after injection, the larvae are returned to their original environment for rearing, and the paralysis and mortality of the larvae are continuously observed. The larval mortality rate is recorded after 48 hours.
[0055] The general procedure for the gastric poisoning activity experiment is as follows: Pc-1 was diluted with 0.1×PBS buffer to prepare seven concentration gradients: 0.5 μg / μL, 1 μg / μL, 2 μg / μL, 4 μg / μL, 6 μg / μL, 8 μg / μL, and 10 μg / μL. A blank control (CK, 0.1×PBS) was added, resulting in a total of eight groups. Healthy pepper leaves were perforated to create leaf discs with a diameter of 15 mm. These leaf discs were then placed in 12-well plates (each well area 4.15 cm²). 2In the experiment, 1 mL of 1% agar was added to the bottom of each well to maintain leaf humidity during larval feeding; 40 μL of each peptide solution was applied to the leaf surface, while the control group was applied with 40 μL of 0.1×PBS; after applying the peptide solution, the leaf surface was allowed to air dry until no water stains remained; 5 newly hatched Spodoptera litura larvae were inoculated into each well; leaf feeding and larval survival were assessed three days later. Leaf feeding was calculated by using area recognition biological software to determine the area of the leaf that was eaten.
[0056] Dc1a (abbreviated as D1) (DC1a, Bende et al. 2014) and Ta1b (abbreviated as T1) (Ta1b-QA, Davis et al. 2025) are insecticidal peptides isolated and identified from spider venom, and α1 is an insecticidal peptide identified from the epidermal mucus of the giant silkworm (Jacobsson, et al. 2018). In this invention, they are also recombinantly expressed using the same technical methods, and their bioactivity is determined.
[0057] Injection experiments showed that the four insecticidal peptides α1, D1, T1, and Pc-1 all exhibited injectable insecticidal activity against 5th instar Spodoptera litura larvae, with the median lethal doses (LD50) for these peptides being 25.92 μg, 8.24 μg, 1.43 μg, and 12.8 μg, respectively. Although the injectable activity of Pc-1 against 5th instar Spodoptera litura was lower than that of D1 and T1, it was stronger than that of α1. Figure 4 ).
[0058] Furthermore, gastric poisoning activity tests were conducted on these four insecticidal peptides.
[0059] After adding purified Pc-1 to the leaves, the mortality rate of Spodoptera litura larvae and the extent of leaf disc feeding were statistically analyzed. The results are as follows: Figure 5 and 6 As shown.
[0060] like Figure 5 As shown, T1, which exhibits the best activity, has no stomach poison effect. Pc-1 shows the strongest stomach poison activity against newly hatched larvae, with a median lethal dose (LC50) of 2.20 μg / μL. This is followed by α1, with an LC50 of 3.97 μg / μL, and D1, with an LC50 of 7.37 μg / μL against newly hatched beet armyworm larvae. Based on... Figure 6 It can be seen that, compared with the control (0), the number of leaf-eating Spodoptera litura larvae gradually decreased as the concentration gradually increased.
[0061] The above results indicate that Pc-1 has stronger stomach poison activity against newly hatched beet armyworm larvae compared to α1 and D1.
[0062] It should be noted that the specific embodiments described above are exemplary, and those skilled in the art can devise various solutions inspired by the disclosure of this invention. These solutions all fall within the scope of this invention and its protection. Those skilled in the art should understand that this specification and its accompanying drawings are illustrative and not intended to limit the scope of the claims. The scope of protection of this invention is defined by the claims and their equivalents.
Claims
1. A method for controlling pests, characterized by, The method comprises providing a stomach poison insecticidal active polypeptide to a pest, the pest being Spodoptera littoralis, the stomach poison insecticidal active polypeptide being a polypeptide consisting of the amino acid sequence of SEQ ID NO:
2. The method comprises providing a stomach poison insecticidal active polypeptide to a pest, the pest being Spodoptera littoralis, the stomach poison insecticidal active polypeptide being a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2.