Molecular markers, primer pairs, reagent kits, their applications, and methods for identifying gynogenetic progeny of crucian carp induced by blunt snout bream.
By developing a kit for molecular markers and primer pairs, and using PCR amplification and gel electrophoresis to identify the gynogenetic offspring of red crucian carp induced by blunt snout bream, the identification problem has been solved, and an efficient and simple identification method has been realized, which is applicable to fish genetic breeding.
Patent Information
- Application Number
- CN202511803303.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-03
- Publication Date
- 2026-03-06
- Estimated Expiration
- 2045-12-03
AI Technical Summary
Existing technologies make it difficult to accurately distinguish between the offspring of red crucian carp undergoing gynogenesis and wild-type red crucian carp, especially during the juvenile stage, leading to economic losses and difficulties in quality control during aquaculture.
A molecular marker, its primer pairs, and a kit were developed to identify the gynogenetic offspring of red crucian carp induced by blunt snout bream using PCR amplification and gel electrophoresis. The 232bp band amplified by PCR was identified using specific primers.
It enables efficient, rapid, and accurate identification of female offspring in red crucian carp, reducing economic losses in aquaculture. It is applicable to the juvenile to adult stages and is simple to use.
Smart Images

Figure CN121249918B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of fish breeding, and particularly relates to a molecular marker, primer pair, reagent kit, and its application and method for identifying gynogenetic offspring. Background Technology
[0002] Gynogenesis technology in fish has extremely important applications in the field of aquatic genetics and breeding. Artificial induction of gynogenesis in fish involves activating the egg with artificially inactivated heterologous sperm, then inhibiting the expulsion of the first polar body or the first cleavage of the fertilized egg, allowing the offspring to develop primarily based on the genetic material of the egg. This method can produce all-female offspring, improving aquaculture efficiency and quality. During gynogenesis, the inactivated sperm used to activate the egg is generally heterologous sperm. Although inactivated heterologous sperm do not participate in heredity, they may influence the traits of offspring through the integration or recombination of chromosomes or DNA fragments, introducing or creating some desirable traits; this is known as the "heterospermia effect."
[0003] Red carp ( Carassius auratus *Carassius redissus* var., a variant of crucian carp, belongs to the family Cyprinidae, subfamily Cyprinoideae, and genus *Carassius*. Due to its strong resistance to adverse conditions, high reproductive capacity, and tender flesh, it has been widely studied and applied in aquaculture and breeding. *Carassius rubescens* (also known as blunt-snout bream) Megalobrama amblycephala The crucian carp (Brachys spp.), belonging to the Cyprinidae family, Culterinae subfamily, and genus *Brachys*, is commonly known as the Wuchang bream or grass bream and is an important economically farmed fish in my country. Gynogenetic crucian carp created by inducing gynogenetic development in crucian carp eggs using inactivated *Brachys spp.* sperm possesses advantages such as rapid growth, strong resistance to adverse conditions, and tender flesh, making it a high-quality germplasm resource that plays a crucial role in fish genetic breeding. However, it is difficult to distinguish gynogenetic crucian carp from wild-type crucian carp based on morphological characteristics, especially in the juvenile stage. Currently, there is no effective method to accurately identify gynogenetic offspring of crucian carp. Therefore, efficiently and accurately identifying gynogenetic offspring of crucian carp is a core problem that needs to be solved. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above, and to provide a molecular marker and its application for identifying gynogenetic offspring of red crucian carp induced by blunt snout bream, primer pairs and their application, reagent kits and their application, and a method for identifying gynogenetic offspring of red crucian carp induced by blunt snout bream, which can accurately distinguish between gynogenetic red crucian carp and wild-type red crucian carp.
[0005] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:
[0006] A molecular marker for identifying gynogenetic offspring of red crucian carp induced by blunt snout bream, the molecular marker being derived from the blunt snout bream genome, the nucleotide sequence of the molecular marker being shown in SEQ ID NO.1.
[0007] As a general technical concept, the present invention also provides a primer pair for identifying gynogenic offspring of crucian carp induced by blunt snout bream, the primer pair comprising a forward primer F and a reverse primer R, the nucleotide sequence of which is as follows:
[0008] Forward primer F: 5'-GGACTGTGACATGGACTGGG-3' (SEQ ID NO.2);
[0009] Reverse primer R: 5'-AGCAAAGGACAATAGATTAAGCGT-3' (SEQ ID NO.3).
[0010] As a general technical concept, the present invention also provides a kit for identifying gynogenic offspring of crucian carp induced by blunt snout bream, comprising the primer pairs described above, and reagents required for PCR.
[0011] Preferably, the above kit also includes one or more of 2×Taq Master Mix and dd H2O.
[0012] As a general technical concept, the present invention also provides the application of the above-mentioned molecular markers, primer pairs, or kits in identifying the gynogenetic offspring of crucian carp induced by blunt snout bream.
[0013] As a general technical concept, the present invention also provides a method for identifying gynogenic offspring of red crucian carp induced by blunt snout bream, comprising the following steps:
[0014] (1) Obtain DNA samples from the offspring of red crucian carp induced by blunt snout bream to be identified;
[0015] (2) Perform PCR amplification on the DNA sample using the primer pairs or the kits described above, and perform gel electrophoresis on the PCR amplification products.
[0016] (3) The source of the DNA sample is confirmed based on the gel electrophoresis results. If a 232bp band appears in the gel electrophoresis results, the DNA sample is derived from the offspring of red crucian carp induced by blunt snout bream gynogenesis.
[0017] The method for determining whether a red crucian carp is a gynogenetic progeny induced by blunt snout bream based on gel electrophoresis results is as follows: blunt snout bream and its gynogenetic progeny induced by blunt snout bream can amplify a 232bp reference primer band, while wild-type red crucian carp cannot amplify the band.
[0018] In the above method, preferably, the PCR amplification reaction system is as follows: the total system is 10 μL, including 5 μL of 2×Rapid Taq Master Mix, 1-2 μL of DNA template, 0.4-1.2 μL each of 10 μM forward primer F and reverse primer R, and dd H2O to make up to 10 μL.
[0019] In the above method, preferably, the PCR amplification program is as follows: pre-denaturation at 93-98℃ for 1-5 min, followed by denaturation at 94℃ for 15-30 sec, annealing at 53-58℃ for 15-30 sec, and extension at 72℃ for 15-30 sec for 30 cycles; then extension at 72℃ for 3-10 min; and storage at 4℃.
[0020] In the above method, preferably, the gel electrophoresis uses an agarose gel with a mass concentration of 1.6-2.5%.
[0021] In the above method, preferably, the DNA sample is derived from the tail fin of the sample to be tested.
[0022] Compared with the prior art, the advantages of the present invention are as follows:
[0023] 1. This invention combines the genomes of *Carassius amurensis*, *Brachys bream*, and resequencing data from wild-type *Carassius amurensis* and gynogenetic offspring of *Carassius amurensis*-induced *Carassius amurensis* for bioinformatics analysis. At the gene level, it provides molecular markers, primer pairs, and a kit for identifying gynogenetic offspring of *Carassius amurensis*-induced *Carassius amurensis*. Specifically, based on resequencing analysis and genome alignment of gynogenetic offspring of *Carassius amurensis*-induced *Carassius amurensis*, this invention screens for paternal gene fragments from *Carassius amurensis* and develops primer pairs with *Carassius amurensis* molecular markers and specificity. This effectively identifies gynogenetic offspring of *Carassius amurensis*-induced *Carassius amurensis*, effectively avoiding the identification difficulties caused by morphological differences. This method is simple, rapid, and highly accurate, and can play an important role in the field of fish genetics and breeding.
[0024] 2. The method of the present invention for identifying gynogenetic offspring of red crucian carp induced by blunt snout bream only requires collecting caudal fins, extracting caudal fin DNA samples, and performing PCR amplification and agarose gel electrophoresis to determine whether the sample to be tested is a gynogenetic offspring of red crucian carp induced by blunt snout bream. This method causes little harm to the fish and is applicable to fish from juvenile to adult. It can also identify gynogenetic offspring during embryonic development, reducing economic losses caused in the later stages of aquaculture. Attached Figure Description
[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0026] Figure 1 The image shows an agarose gel electrophoresis diagram of the example. In the diagram, RCC represents wild-type red crucian carp, GRCC represents the offspring of red crucian carp induced by blunt snout bream, and BSB represents blunt snout bream. Lane M consists of bands of 1500bp, 1000bp, 900bp, 800bp, 700bp, 600bp, 500bp, 400bp, 300bp, 200bp, and 100bp from top to bottom. Detailed Implementation
[0027] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.
[0028] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.
[0029] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.
[0030] Example:
[0031] A molecular marker for identifying gynogenetic offspring of red crucian carp induced by blunt snout bream, the molecular marker being derived from the blunt snout bream genome, and its nucleotide sequence is shown in SEQ ID NO.1. Details are as follows:
[0032] TGATTACATTTCCCTAGGATGTAGAGGACTGTGACATGGACTGGGAAAGTGCCATTTTCCATGAGGAACCATTAACAGCATTTGGAGTTGTGGTTCCAGAACTCCTCCCCCCTCTAAATGAACAAGAAATGA GAAGCCTCCAAGCTGCTGTTGACCCTACAGTGACATCACACTCGAATGGTAGAGACATCTATATTCAGTGCTTTGATATTTTTCACTGACAAATTATGAATACGCTTAATCTATTGTCCTTTGCTTGTTCA.
[0033] The above molecular markers can be obtained by the following methods:
[0034] Download the blunt snout bream genome data (Genome assembly ASM1881202v1) from the NCBI (National Center for Biotechnology Information) website to your local server.
[0035] Open the blunt snout bream genome data and annotation files in the IGV software, and import the .bam file containing gene fragments from the clean data of the resequencing results of the red crucian carp gynogenesis progeny induced by blunt snout bream, which are only from the father and not from the mother.
[0036] DNA fragments shared by blunt snout bream and the gynogenetic offspring of blunt snout bream-induced red crucian carp were screened. From the above fragments, a DNA fragment shared by blunt snout bream and the gynogenetic offspring of blunt snout bream-induced red crucian carp with high sequencing depth was selected. The total length of this fragment is 263 bp, and its nucleotide sequence is shown in SEQ ID NO.1.
[0037] The primer pair used in this embodiment for identifying gynogenetic offspring of red crucian carp induced by blunt snout bream includes a forward primer F and a reverse primer R. This primer pair has high specificity, moderate length, and can stably clone the target fragment. Its nucleotide sequence is as follows:
[0038] Forward primer F: 5'-GGACTGTGACATGGACTGGG-3' (SEQ ID NO.2);
[0039] Reverse primer R: 5'-AGCAAAGGACAATAGATTAAGCGT-3' (SEQ ID NO.3).
[0040] The kit for identifying gynogenic offspring of crucian carp induced by blunt snout bream in this embodiment includes the primer pairs described above, as well as reagents required for PCR, such as one or more of 2×Taq Master Mix and dd H2O.
[0041] The molecular markers, primer pairs, or kits described in this embodiment can be used to identify gynogenetic offspring of red crucian carp induced by blunt snout bream. The specific method includes the following steps:
[0042] (1) Sample acquisition: Caudal fin samples were collected from 6 wild-type red crucian carp, 6 blunt snout bream, and 12 offspring of red crucian carp induced by gynogenesis. The samples were washed with physiological saline, dried with filter paper, and stored at -80℃ for later use.
[0043] (2) DNA extraction: Genomic DNA was extracted from wild-type red crucian carp, the offspring of red crucian carp induced by blunt snout bream, and the caudal fin samples of blunt snout bream using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 kit.
[0044] (3) Primer design: Primer pairs were designed using Primer Premier 5, i.e., the primer pairs were:
[0045] Forward primer F: 5'-GGACTGTGACATGGACTGGG-3', as shown in SEQ ID NO: 2;
[0046] The reverse primer R is 5'-AGCAAAGGACAATAGATTAAGCGT-3', as shown in SEQ ID NO: 3.
[0047] (4) PCR amplification: Using extracted DNA as a template, PCR was performed using primer pairs to obtain PCR products; the PCR system is as follows: 2×Taq Master Mix 5μL, forward primer F 0.5μL, reverse primer R 0.5μL, DNA template 1μL, double-distilled water 3μL, total volume 10μL;
[0048] The PCR amplification program is as follows: pre-denaturation at 94℃ for 5 min, followed by denaturation at 94℃ for 30 sec, annealing at 55℃ for 30 sec, and extension at 72℃ for 30 sec for 30 cycles; then extension at 72℃ for 10 min; and finally cooling to 16℃ to obtain the amplification product.
[0049] (5) Gel electrophoresis detection: PCR amplification products were detected by 2.0% agarose gel electrophoresis. 5 μL of sample was loaded and the electrophoresis results were recorded by a gel imaging system.
[0050] Gel imaging results as follows Figure 1 As shown, no fragment was amplified in 6 wild-type red crucian carp (RCC) samples, while 12 gynogenetic progeny of red crucian carp induced by blunt snout bream (GRCC) and 6 blunt snout bream (BSB) samples all amplified a 232bp band, consistent with the sampling results. This proves that the identification method in this embodiment is reliable and can be used to distinguish between gynogenetic progeny of red crucian carp induced by blunt snout bream and wild-type red crucian carp. Although both blunt snout bream and gynogenetic progeny of red crucian carp induced by blunt snout bream amplified a 232bp band, they can be distinguished by their morphology.
[0051] As can be seen from the above, this invention is based on resequencing analysis and genome alignment of the gynogenetic offspring of red crucian carp induced by blunt snout bream. By screening out the paternal gene fragments from blunt snout bream, primer pairs with molecular markers and specificity of blunt snout bream are developed. This can effectively identify the gynogenetic offspring of red crucian carp induced by blunt snout bream, effectively avoiding the identification difficulties caused by the difficulty in distinguishing them by their appearance. The method of this invention is simple, fast, and highly accurate, and can play an important role in the field of fish genetics and breeding.
Claims
1. A molecular marker for identifying the offspring of red crucian carp induced gynogenesis by Megalobrama amblycephala, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO.
1.
2. A primer pair for identifying the offspring of red crucian carp induced gynogenesis by Megalobrama amblycephala, characterized in that, The primer pair comprises a forward primer F and a reverse primer R, and the nucleotide sequences thereof are as follows: Forward primer F: 5'-GGACTGTGACATGGACTGGG-3'; Reverse primer R: 5'-AGCAAAGGACAATAGATTAAGCGT-3'.
3. A kit for identifying the offspring of red amur female gynogenesis induced by Ctenopharyngodon idellus, characterized in that, The primer pair as claimed in claim 2.
4. The kit of claim 3, wherein Further comprising one or more of 2x Taq Master Mix and dd H2O.
5. Use of the molecular marker as claimed in claim 1 or the primer pair as claimed in claim 2 or the kit as claimed in any one of claims 3-4 in identifying the mandarin fish induced gynogenetic offspring of Acipenser baeri.
6. A method for identifying the offspring of red amur female gynogenesis induced by Ctenopharyngodon idellus, characterized in that, The method comprises the following steps: (1) obtaining a DNA sample of the mandarin fish induced gynogenetic offspring of Acipenser baeri to be identified; (2) performing PCR amplification on the DNA sample by using the primer pair as claimed in claim 2 or the kit as claimed in any one of claims 3-4, and performing gel electrophoresis on the PCR amplification product; (3) confirming the source of the DNA sample according to the result of the gel electrophoresis, and if a 232bp band appears in the result of the gel electrophoresis, the DNA sample is derived from the mandarin fish induced gynogenetic offspring of Acipenser baeri.
7. The method of claim 6, wherein, The reaction system of the PCR amplification is as follows: the total system is 10 μL, which comprises 2x Rapid Taq Master Mix 5 μL, DNA template 1-2 μL, 10 μM of forward primer F and reverse primer R each 0.4-1.2 μL, and dd H2O to make up to 10 μL.
8. The method of claim 6, wherein, The amplification procedure of the PCR amplification is as follows: 93-98℃ pre-denaturation for 1-5 min; then 94℃ denaturation for 15-30 sec, 53-58℃ annealing for 15-30 sec, 72℃ extension for 15-30 sec, amplification for 30 cycles; then 72℃ extension for 3-10 min; 4℃ preservation.
9. The method of claim 6, wherein, The gel electrophoresis adopts agarose gel with a mass concentration of 1.6-2.5%.
Citation Information
Patent Citations
Method for cultivating pseudo male gynogenetic megalobrama amblycephala at high temperature
CN113207762A
Method for efficiently creating sterile synthetic novel polyploidy crucian carp
CN115735858A