Soybean anti-popping pod trait locus qpd08-1 and applications thereof

By using the soybean pod-breaking resistance trait locus qPD08-1 and its CAPS molecular marker and primer combination, the problem of yield reduction caused by soybean pod breaking was solved, achieving efficient screening and molecular breeding, and improving soybean breeding efficiency and yield.

CN121249969BActive Publication Date: 2026-03-17INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511832493.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-08
Publication Date
2026-03-17
Estimated Expiration
2045-12-08

AI Technical Summary

Technical Problem

Existing technologies address the problem of reduced yield caused by soybean pod shattering, especially under dry weather conditions where losses can reach 50% to 100%, affecting both soybean yield and quality.

Method used

This study provides the soybean pod-resistant trait locus qPD08-1 and its applications. Genotype detection is performed using CAPS molecular markers and specific primer combinations (PD08-1CAPS-F, PD08-1CAPS-R, PD08-1CAPS-R1). The HphⅠ restriction enzyme digestion method is used to distinguish between pod-resistant and pod-prone genotypes.

Benefits of technology

This technology enables efficient screening of soybean varieties with pod-breaking genotypes, assists in molecular breeding, shortens the breeding process, improves breeding selection efficiency, reduces seed loss, and enhances soybean yield and quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121249969B_ABST
    Figure CN121249969B_ABST
Patent Text Reader

Abstract

This invention relates to soybean pod-resistant trait loci. qPD08‑1 This invention relates to the soybean pod-bomb resistance gene locus and its applications, belonging to the field of plant molecular biotechnology. qPD08‑1 Located in soybeans Glyma The reference genome of .Wm82.a2.v1, located between 35983663 and 36106921 bp on chromosome 8, has a total physical interval length of 123.258 kb. The molecular marker detection method of this invention can be used for identification of soybean pod-resistant germplasm resources, screening and functional studies of pod-resistant genes, marker-assisted selection breeding for pod-resistant soybeans, and natural resource applications. It features convenient detection, stable amplification products, and high specificity, helping to broaden the sources of superior breeding parents and improve the efficiency of soybean breeding selection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant molecular biology, and more particularly to a soybean pod-bursting resistance trait locus. qPD08-1 And its applications. Background Technology

[0002] Soybeans Glycine max Soybeans are an important economic crop originating in my country and a significant source of plant protein. Currently, my country's soybean production cannot be increased by expanding the planting area. Domestically produced soybeans can only meet food demand, and feed soybeans rely heavily on imports, falling far short of domestic consumption. Therefore, increasing soybean yield per unit area is a crucial means to boost my country's soybean production.

[0003] The trait of resistance to pod bursting in soybeans is considered one of the first traits selected during soybean domestication. The seeds of leguminous plants are contained in pods composed of carpels. At maturity, the process of the carpels splitting open along the seam is called pod bursting or splitting. The trait of pod bursting is closely related to soybean yield. In wild soybeans, pod splitting is a necessary condition for reproduction; however, in cultivated soybeans, pod bursting leads to seed scattering and difficulty in harvesting, becoming one of the important reasons for reduced soybean yield. Reports indicate that some varieties prone to pod bursting can suffer yield losses of 50%–100% when harvested in dry weather; other studies have found that soybean varieties prone to pod bursting and those with moderate pod bursting can suffer losses of up to 175–186 kg / hm² due to late harvesting after maturity. 2 In China, the main cultivated varieties in the Huang-Huai-Hai Plain suffer losses of up to 112.5 kg / hm² due to pod breakage. 2 Harvesting soybeans too early can lead to a decrease in 100-seed weight, oil content, and protein content, while harvesting too late can reduce yield due to pod breakage. In addition, the seeds that fall from the pods can remain dormant in the soil for up to 10 years. Under suitable environmental conditions, once dormancy is broken, they become weeds and affect the growth of the current season's crops. Summary of the Invention

[0004] The purpose of this invention is to provide a soybean pod-resistant trait locus. qPD08-1 And its application, to solve the problem of reduced yield caused by soybean pod shattering in existing technologies.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] This invention provides a soybean pod-resistant trait locus. qPD08-1 Application in the selection of soybean pod-resistant traits, the soybean pod-resistant trait locus qPD08-1 Physical range corresponding to soybeans Glyma The physical interval length of the reference genome .Wm82.a2.v1 between chromosome 8, 35983663 and 36106921 bp, is a total of 123.258 kb.

[0007] The present invention also provides a CAPS molecular marker, wherein the physical location of the CAPS molecular marker is located at the soybean pod-breaking resistance trait locus. qPD08-1 Within the physical zone, soybeans Glyma The reference genome for .Wm82.a2.v1 is located at 35988687 bp on chromosome 8;

[0008] The soybean pod-resistant trait locus qPD08-1 The physical interval corresponds to chromosome 8, between 35983663 and 36106921 bp of the soybean Glyma.Wm82.a2.v1 reference genome, with a total physical interval length of 123.258 kb.

[0009] This invention also provides a soybean pod-resistant trait locus. qPD08-1 Or a dedicated primer combination constructed from CAPS molecular markers, including PD08-1 CAPS-F primers, PD08-1 CAPS-R primers and PD08-1 CAPS-R1 primers;

[0010] The PD08-1 The nucleotide sequence of the CAPS-F primer is shown in SEQ ID NO.33;

[0011] The PD08-1 The nucleotide sequence of the CAPS-R primer is shown in SEQ ID NO.34;

[0012] The PD08-1 The nucleotide sequence of the CAPS-R1 primer is shown in SEQ ID NO.35.

[0013] Preferably, if the band amplified by the special primer combination yields a 217bp band after restriction enzyme digestion, the genotype of the soybean to be tested is defined as the pod-breaking genotype (R); if the bands obtained after restriction enzyme digestion are 118bp and 99bp, the genotype of the soybean to be tested is defined as the pod-breaking genotype (S).

[0014] Preferably, the restriction enzyme is Hph I.

[0015] The present invention also provides a gene detection kit, comprising: PD08-1 CAPS-F primers, PD08-1 CAPS-R primers and PD08-1 CAPS-R1 primers;

[0016] The PD08-1 The nucleotide sequence of the CAPS-F primer is shown in SEQ ID NO.33;

[0017] The PD08-1 The nucleotide sequence of the CAPS-R primer is shown in SEQ ID NO.34;

[0018] The PD08-1 The nucleotide sequence of the CAPS-R1 primer is shown in SEQ ID NO.35.

[0019] This invention also provides the application of the aforementioned CAPS molecular marker, the aforementioned dedicated primer combination, or the aforementioned gene detection kit in the selection of soybean pod-resistant traits.

[0020] The present invention has the following technical effects and advantages:

[0021] The molecular marker detection method provided by this invention can be used for identification of soybean blast-resistant pod germplasm resources, screening and functional research of blast-resistant pod genes, molecular marker-assisted selection breeding of blast-resistant pods and natural resources, etc., and has the characteristics of convenient detection, stable amplification products and high specificity.

[0022] The molecular markers of this invention can efficiently predict the soybean pod-resistant phenotype, which is beneficial for screening soybean varieties with pod-resistant genotypes, assisting in the identification of soybean pod-resistant phenotypes and molecular breeding, further shortening the breeding process, helping to broaden the sources of superior breeding parents, and improving the efficiency of soybean breeding selection. Attached Figure Description

[0023] Figure 1 for qPD08-1 Precise interval positioning;

[0024] Figure 2 Genes for preventing soybean pod shattering GmPD08-1 The results of CDS sequence electrophoresis;

[0025] Figure 3 Genes for preventing soybean pod shattering GmPD08-1 The gene editing results are as follows: A is gene sequencing of homozygous edited lines, B is amino acid prediction of homozygous edited lines, C is identification of pod-breaking traits of homozygous edited lines, and D is analysis of pod-breaking rate of homozygous edited lines.

[0026] Figure 4 Genes for preventing soybean pod shattering GmPD08-1 Gene sequencing analysis results;

[0027] Figure 5 molecular markers PD08-1 CAPS non-denaturing polyacrylamide gel assay results;

[0028] Figure 6 The results of enzyme digestion electrophoresis of the heterozygous segregating population;

[0029] Figure 7 Marking for blast-resistant pods PD08-1Significance analysis of CAPS for identifying natural species resource populations. Detailed Implementation

[0030] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0031] Example 1: Cultivation and Phenotypic Identification of Soybean Pod-Resistant Population

[0032] The experimental site was located in the soybean experimental field of the Heihe Branch of the Heilongjiang Academy of Agricultural Sciences. Soybean parents, recombinant inbred line (RIL) populations, and residual heterozygous line (RHL) populations were randomly arranged into plots. The ridge length was 2m, the ridge spacing was 66.7cm, and the plant spacing was 5cm. Manual sowing was combined with deep fertilization, including the application of 37.5kg / hm² of urea. 2 225 kg / hm² of diammonium phosphate 2 Potassium fertilizer 37.5 kg / hm 2 Unified field management was implemented. Five days after the soybean plants reached full maturity, 30 pod samples were taken from the upper part of the soybean plants and stored in a 4℃ refrigerator, taking care to avoid pod bursting during sampling. Each pod sample was placed in a heat-resistant wide-mouth glass beaker, covered with a fine wire mesh to prevent pods from scattering during bursting, and baked in a 60℃ oven for 13 hours. The number of bursting pods was counted and the bursting rate was calculated.

[0033] The formula for calculating the pod breakage rate is: pod breakage rate = (number of broken pods / total number of pods) × 100%.

[0034] Example 2: Location and Cloning of Soybean Pod-Resistant Genes

[0035] Using the method described in Example 1, a RIL population was constructed with the pod-resistant variety Heihe 43 as the female parent and the easily pod-breaking variety Heihe 18 as the male parent. A high-density genetic map was constructed using SLAF-seq simplified genome sequencing, and three stable QTLs for the pod-breaking trait were located, namely... qPD01, qPD05-1, qPD08-1 Building upon this, a population containing 102 RILs was further constructed using the single-particle transfer method, and then... qPD08-1 Three residual heterozygous individuals were screened from the SSR markers 08-1348 and 08-1427 at both ends of the interval, and 48 exchanger individuals were successfully screened by expanding RHL. Using 13 pairs of interval polymorphic SSR markers for in-depth identification (as shown in Table 1), 17 different types of exchanger individuals were identified. Based on phenotype, the location range of the interval was narrowed from the initial 2.921 Mb to 123.258 kb, located between SSR markers 08-1363 and 08-1371. This interval contains two genes, namely... GmPD08-1 (Glyma.08G273500) and GmPD08-2(Glyma.08G273600), the interval is located in GmPD08- 1 Upstream, GmPD08-2 Downstream, GmPD08-1 For strong candidate genes, such as Figure 1 As shown.

[0036] Table 1. Interval Polymorphism SSR Markers

[0037]

[0038] Using the soybean reference genome Glyma Designed based on .Wm82.a2.v1 for amplifying soybean pod-resistant genes. GmPD08-1 primers GmPD08-1 -CDSF / R, as shown in Table 2; PCR amplification was performed using cDNA from the parental blast-resistant variety Heihe 43 and the easily blast-prone variety Heihe 18 as templates. The amplification system was calculated in 20 µL volumes, including KOD On TM PCR Master Mix 10µL GmPD08-1 -CDSF primers (10 µmol / L) 0.5 µL GmPD08-1 - CDSR primers (10 µmol / L) 0.5 µL, cDNA (50 ng / µL) 2 µL, and the remainder sterile water; the PCR program was set as follows: 98℃ pre-denaturation for 3 min → (95℃ denaturation for 10 s → 55℃ annealing for 5 s → 68℃ extension for 10 s) × 34 cycles → 68℃ extension for 3 min, to obtain the soybean pod-resistant gene. GmPD08-1 The CDS sequence is shown in SEQ ID NO.36; it was detected by 1% agarose gel electrophoresis, and the results are as follows. Figure 2 As shown.

[0039] Table 2. Sequences of each primer

[0040]

[0041] SEQ ID NO.36:

[0042]

[0043] Example 3: Functional verification of soybean pod-resistant gene

[0044] Build includes GmPD08-1 The gene-editing vector containing the target sequences of the gene contains two target sites, gRNA1 and gRNA2. The gene-editing vector was transformed into the soybean cotyledon node-mediated genetic transformation method using Agrobacterium tumefaciens, resulting in the pod-breaking resistant soybean variety Williams 82. Positive transgenic soybean plants were identified at the DNA level. Stable homozygous edited T1 soybean transgenic plants were harvested. The pod-breaking rate of homozygous edited T1 soybean transgenic plants and control mature soybeans was measured according to the method described in Example 1. The results are as follows: Figure 3 As shown;

[0045] The nucleotide sequence of gRNA1 is shown in SEQ ID NO.37.

[0046] SEQ ID NO.37: AGGACAGAGCAATGCCTCGA

[0047] The nucleotide sequence of gRNA2 is shown in SEQ ID NO.38.

[0048] SEQ ID NO.38: CCAGTCACCTGAAAGGGATC

[0049] The results showed that, compared with the control, the homozygous edited T1 soybean transgenic plants had an increased pod-breaking rate, proving that soybeans... GmPD08-1 Genes can effectively improve the soybean's resistance to pod shattering.

[0050] Example 4: Molecular markers of soybean pod-resistant genes PD08-1 Development and Evaluation of CAPS

[0051] Genomic DNA was extracted from the blast-resistant soybean variety Heihe 43 and the blast-prone soybean variety Heihe 18 using the CTAB method. The mass and concentration of each genomic DNA sample were determined by 1% agarose gel electrophoresis and spectrophotometry. The DNA samples were diluted to a concentration of 50 ng / µL and stored at -20℃ for later use. Based on the parental resequencing results, in soybean... GmPD08-1 A SNP variant was found 6760 bp upstream of the ATG start codon (e.g. Figure 4 (As shown), located in the soybean reference genome Glyma The SNP at position 35988687 on chromosome 8 of the .Wm82.a2.v1 gene is T, while the SNP at position C is T for Heihe 43 and C for Heihe 18. This SNP variant site was developed as a CAPS molecular marker, and the target fragment was amplified using nested PCR. PD08-1 CAPS-F / R was used as the primer for the first round of PCR amplification. PD08-1 CAPS-F / R1 was used as the primer for the second round of PCR amplification, and the primer sequences are shown in Table 2. The first round of PCR amplification system was set as follows: 2 µL of genomic DNA, 10 µL of 2×Taq Master Mix, PD08-1 CAPS-F 0.5µL PD08-1 CAPS-R 0.5µL, ddH2O 7µL; the first round of PCR amplification program was: 94℃ pre-denaturation for 3 min → (98℃ denaturation for 15 s → 56℃ annealing for 15 s → 72℃ extension for 45 s) × 25 cycles → 72℃ extension for 5 min, to obtain the first round of PCR product and perform the second round of PCR amplification. The second round of PCR amplification system was set as follows: 0.5µL of the first round of PCR product, 10µL of 2×Taq Master Mix, PD08-1 CAPS-F 0.5µL PD08-1 CAPS-R1 0.5µL, ddH2O 8.5µL; the second round PCR amplification program was: 94℃ pre-denaturation for 3min → (98℃ denaturation for 15s → 56℃ annealing for 15s → 72℃ extension for 15s) × 34 cycles → 72℃ extension for 5min, to obtain the second round amplification products. The second round amplification product of Heihe 43 is shown in SEQ ID NO.39, and the second round amplification product of Heihe 18 is shown in SEQ ID NO.40.

[0052] SEQ ID NO.39:

[0053] CATCTAACTGCTCCAAGTGAAGATTCTCTGCAGCTATTATGCTCAGAATAACTCTGATGGTAGTCATCTTTACAACTGGAGAGAAGATCTCTGTGAAATCAATTCCTTGTTTCTGCTGAAACCCTTTTACCACAAGTCTCGCCTTGTATCTCTTTCACCGTTAGATTCTTCCTTTTAGCCTATAGACCCACCTATTCTGTAACGCTTTCTTTCCTTC

[0054] SEQ ID NO.40:

[0055] CATCTAACTGCTCCAAGTGAAGATTCTCTGCAGCTATTATGCTCAGAATAACTCTGATGGTAGTCATCTTTACAACTGGAGAGAAGATCTCTGTGAAATCAATTCCTTGTTTCTGCTGAAACCCTTTCACCACAAGTCTCGCCTTGTATCTCTTTCACCGTTAGATTCTTCCTTTTAGCCTATAGACCCACCTATTCTGTAACGCTTTCTTTCCTTC

[0056] Each second-round amplification product was subjected to restriction endonuclease. Hph I. After enzyme digestion at 37℃ for 60 min, non-denaturing polyacrylamide gel electrophoresis was performed for detection. The results are as follows: Figure 5 As shown.

[0057] The results showed that easily shattered soybean materials could be... Hph I was identified, and complete enzyme digestion yielded two fragments, 118bp and 99bp.

[0058] Example 5: Anti-blast pod marking PD08-1 CAPS Genotyping in Heterozygous Segregating Populations

[0059] Using the F1 generation of the parental hybrids and the parents Heihe 43 and Heihe 18 as controls, the method described in Example 4 was used to examine 38 individual plants in the residual heterozygous segregating population. The distribution of the pod-bursting phenotype in the segregating plants was determined based on different banding patterns. The results are as follows: Figure 6 As shown in Table 3.

[0060] Table 3. Statistics on the number of phenotypes and genotypes in the heterozygous line segregating population.

[0061]

[0062] The results showed that the second-round PCR products of each individual plant were... Hph After enzyme digestion, the final product of Heihe 43 with the anti-bursting genotype (R) was 217 bp in length, while the final product of Heihe 18 with the bursting genotype (S) had additional fragments of 118 bp and 99 bp in length. The enzyme digestion fragment of the heterozygous genotype (H) was lighter in color than that of Heihe 18.

[0063] In the residual heterozygous segregating population, there were 16 individuals with the pod-resistant genotype (R), all with a band of 217 bp; 8 individuals with the pod-bursting genotype (S), with bands of 217 bp / 118 bp / 99 bp; and 14 individuals with the heterozygous genotype (H), with bands of 217 bp / 118 bp / 99 bp.

[0064] Example 6: Marking of soybean pods resistant to shattering PD08-1 CAPS for Genotyping in Natural Variety Resource Populations

[0065] The genotypes of 69 natural resource varieties were detected using the method described in Example 4. Based on different band patterns, the genotypes of different varieties with resistance to pod bursting were determined. The results are as follows: Figure 7 As shown in Table 4.

[0066] Table 4. Genotypic Statistics of Natural Populations

[0067]

[0068] The results showed that 9 varieties shared the same pod-breaking genotype as Heihe 43; 60 varieties shared the same pod-breaking genotype as Heihe 18. The pod-breaking rate phenotypes of the two groups were compared using a T-test. P =0.0006 is a highly significant difference. Varieties with a pod-breaking rate of <26% are pod-breaking resistant. Six of the nine natural resources with pod-breaking resistant genotypes were found to be pod-breaking resistant, and the detection efficiency for pod-breaking resistant varieties reached 66.7%.

[0069] As can be seen from the above embodiments, the present invention provides a soybean pod-breaking resistance trait locus. qPD08-1 Its applications. The molecular marker detection method of the present invention can be used for identification of soybean blast-resistant pod germplasm resources, screening and functional research of blast-resistant pod genes, molecular marker-assisted selection breeding of blast-resistant pods, and natural resources. It has the characteristics of convenient detection, stable amplification products, and high specificity, which helps to broaden the sources of superior breeding parents and improve the efficiency of soybean breeding selection.

[0070] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A soybean pod shatter resistance trait locus qPD08-1 use in selection of a soybean pod shatter resistance trait, characterized in that, The soybean anti-popping pod trait locus qPD08-1 The physical interval corresponds to the Glyma.Wm82.a2.v1 reference genome of soybean chromosome 8 between 35983663 and 36106921 bp, with a total length of 123.258 kb.

2. A combination of specific primers based on CAPS molecular markers characterized in that, comprising PD08-1 a CAPS-F primer, PD08-1 a CAPS-R primer and PD08-1 a CAPS-R1 primer; The PD08-1 The nucleotide sequence of the CAPS-F primer is shown in SEQ ID NO. 33; The PD08-1 The nucleotide sequence of the CAPS-R primer is shown as SEQ ID NO. 34; The PD08-1 The nucleotide sequence of the CAPS-R1 primer is shown in SEQ ID NO. 35; The physical position of the CAPS molecular marker is located in the soybean anti-burst trait locus qPD08-1 Within the physical interval, 35988687 bp of the soybean Glyma.Wm82.a2.v1 reference genome chromosome 8; The soybean anti-popping pod trait locus qPD08-1 The physical interval corresponds to the Glyma.Wm82.a2.v1 reference genome of soybean chromosome 8 between 35983663 and 36106921 bp, with a total length of 123.258 kb.

3. The dedicated primer combination according to claim 2, characterized in that, The band amplified by the special primer combination is digested by restriction enzyme to obtain 217bp band, then the genotype of the soybean to be tested is defined as R of resistance to pod shattering; and the band is digested by restriction enzyme to obtain 118bp and 99bp bands, then the genotype of the soybean to be tested is defined as S of pod shattering; The restriction enzyme is Hph I.

4. A genetic detection kit, characterized by, The special primer combination constructed based on the CAPS molecular marker in claim 2 or 3.

5. Application of the special primer combination in claim 2 or 3 or the genetic detection kit in claim 4 in selection of soybean resistance to pod shattering.

Citation Information

Patent Citations

  • Soybean anti-shattering main effect QTLqPD08-1 (Quantitative Trait Loci), and positioning method and application thereof

    CN108441575A