Compositions and methods for immunooncology

Abstract

The invention relates to genome editing systems, reagents and methods for immunooncology.

Description

[0001] This application is a divisional application of Chinese application 201680080978.0, filed on December 2, 2016, entitled "Compositions and methods for immuno-oncology".

[0002] Related applications

[0003] This application claims priority to U.S. Provisional Patent Application No. 62 / 263169, filed December 4, 2015; U.S. Provisional Patent Application No. 62 / 316784, filed April 1, 2016; and U.S. Provisional Patent Application No. 62 / 394290, filed September 14, 2016. The full contents of these applications are incorporated herein by reference. background

[0004] CRISPR (clustered regularly spaced short palindromic repeats) have evolved in bacteria as an adaptive immune system to defend against viral attacks. Upon exposure to a virus, short fragments of viral DNA integrate into CRISPR loci within the bacterial genome. RNA is transcribed from a portion of the CRISPR locus containing the viral sequence. This RNA, containing a sequence complementary to the viral genome, mediates the guidance of the Cas9 protein into the viral genome. The Cas9 protein cleaves the viral target, thus silencing it.

[0005] Recently, the CRISPR / Cas system has been modified for genome editing in eukaryotic cells. The introduction of site-specific single-strand breaks (SSBs) or double-strand breaks (DSBs) allows for alteration of target sequences, for example, through non-homologous end joining (NHEJ) or homology-guided repair (HDR). Invention Summary

[0006] The inventions described herein relate to compositions and methods for use in immuno-oncology, such as cells modified at specific target sequences in their genome, including modifications such as by introducing a CRISPR system containing a gRNA molecule guiding said target sequence, and methods for their production and use. For example, this disclosure relates to gRNA molecules, CRISPR systems, cells, and methods that can be used for genome editing of cells (e.g., T cells, such as T cells further engineered to express chimeric antigen receptors) and for treating diseases (such as cancer).

[0007] In a first aspect, the present invention provides a gRNA molecule comprising tracr and crRNA, wherein the crRNA comprises a guide domain that is complementary to a target sequence of an allogeneic T cell target selected from B2M, CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, TRBC2, HLA-A, HLA-B, HLA-C, DCK, CD52, FKBP1A, CIITA, NLRC5, RFXANK, RFX5, RFXAP, or NR3C1. In embodiments of the gRNA molecule:

[0008] 2(a) The allogeneic T cell target is B2M, and the guiding domain includes any one of SEQ ID NO:1 to SEQ ID NO:83 or SEQ ID NO:5492 to SEQ ID NO:5527;

[0009] 2(b) The allogeneic T cell target is TRAC, and the guiding domain includes any one of SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965;

[0010] 2(c) The allogeneic T cell target is TRBC1, and the guiding domain includes any one of SEQ ID NO:5624 to SEQ ID NO:5643 or SEQ ID NO:5966 to SEQ ID NO:6097;

[0011] 2(d) The allogeneic T cell target is TRBC2, and the guiding domain includes any one of SEQ ID NO:5644 to SEQ ID NO:5719 or SEQ ID NO:6098 to SEQ ID NO:6226;

[0012] 2(e) The allogeneic T cell target is CD247, and the guiding domain includes any one of SEQ ID NO:84 to SEQ ID NO:392;

[0013] 2(f) The allogeneic T cell target is CD3D, and the guiding domain includes any one of SEQ ID NO:393 to SEQ ID NO:532 or SEQ ID NO:10780 to SEQ ID NO:10794;

[0014] 2(g) The allogeneic T cell target is CD3E, and the guiding domain includes any one of SEQ ID NO:533 to SEQ ID NO:839 or SEQ ID NO:10677 to SEQ ID NO:10764;

[0015] 2(h) The allogeneic T cell target is CD3G, and the guiding domain includes any one of SEQ ID NO:840 to SEQ ID NO:968 or SEQ ID NO:10765 to SEQ ID NO:10779;

[0016] 2(i) The allogeneic T cell target is HLA-A, and the guiding domain includes any one of SEQ ID NO:969 to SEQ ID NO:1345;

[0017] 2(j) The allogeneic T cell target is HLA-B, and the guiding domain includes any one of SEQ ID NO:1346 to SEQ ID NO:1698;

[0018] 2(k) The allogeneic T cell target is HLA-C, and the guiding domain includes any one of SEQ ID NO:1699 to SEQ ID NO:2068;

[0019] 2(l) The allogeneic T cell target is DCK, and the guiding domain includes any one of SEQ ID NO:5278 to SEQ ID NO:5491;

[0020] 2(m) The target of the allogeneic T cells is CD52, and the guiding domain includes any one of SEQ ID NO:6227 to SEQ ID NO:6324;

[0021] 2(n) The allogeneic T cell target is FKBP1A, and the guiding domain includes any one of SEQ ID NO:6325 to SEQ ID NO:6583 or SEQ ID NO:6662 to SEQ ID NO:6749;

[0022] 2(o) The allogeneic T cell target is NR3C1, and the guiding domain includes any one of SEQ ID NO:2069 to SEQ ID NO:2941;

[0023] 2(p) The allogeneic T cell target is CIITA, and the guiding domain includes any one of SEQ ID NO:6750 to SEQ ID NO:7716 or SEQ ID NO:7717 to SEQ ID NO:7804; or

[0024] 2(q) The allogeneic T cell target is NLRC5, and the guiding domain includes any one of SEQ ID NO:8622 to SEQ ID NO:10089.

[0025] In the implementation of the gRNA molecule, the allogeneic T cell target is TRAC, and the guidance domain comprises SEQ ID NO:5569, SEQ ID NO:5585, SEQ ID NO:5587, SEQ ID NO:5592, SEQ ID NO:5601, SEQ ID NO:5589, SEQ ID NO:5600, SEQ ID NO:5594, SEQ ID NO:5571, SEQ ID NO:5593, SEQ ID NO:5574, SEQ ID NO:5598, SEQ ID NO:5586, SEQ ID NO:5599, SEQ ID NO:5591, SEQ ID NO:5610, SEQ ID NO:5608, SEQ ID NO:5617, SEQ ID NO:5619, or SEQ ID NO:5620. For example, the guidance domain comprises SEQ ID NO:5569, SEQ ID NO:5586, SEQ ID NO:5587, SEQ ID NO:5569, SEQ ID NO:5587, SEQ ID NO:5569, SEQ ID NO:5585, SEQ ID NO:5586, SEQ ID NO:5587, SEQ ID NO:5592, SEQ ID NO:5601, SEQ ID NO:5589, SEQ ID NO:5600, SEQ ID NO:5594, SEQ ID NO:5571, SEQ ID NO:5593, SEQ ID NO:5574, SEQ ID NO:5598, SEQ ID NO:5586, SEQ ID NO:5599, SEQ ID NO:5591, SEQ ID NO:5610, SEQ ID NO:5608, SEQ ID NO:5617, SEQ ID NO:5619, or SEQ ID NO:5620. NO:5592, SEQ ID NO:5599 or SEQ ID NO:5600, for example, the guide structure field contains SEQ ID NO:5569, SEQ ID NO:5587, SEQ ID NO:5592 or SEQ ID NO:5586, for example, the guide structure field contains SEQ ID NO:5569.

[0026] In the implementation of the gRNA molecule, the allogeneic T cell target is TRBC2, and the guiding domain includes SEQ ID NO:5719, SEQ ID NO:5694, SEQ ID NO:5706, SEQ ID NO:5696, SEQ ID NO:5711, SEQ ID NO:5708, SEQ ID NO:5709, SEQ ID NO:5712, SEQ ID NO:5703, SEQ ID NO:5707, SEQ ID NO:5687, SEQ ID NO:5705, SEQ ID NO:5713, SEQ ID NO:5715, or SEQ ID NO:5710.

[0027] In the implementation of the gRNA molecule, the allogeneic T cell target is B2M, and the guiding domain includes SEQ ID NO:5519, SEQ ID NO:5497, SEQ ID NO:5499, SEQ ID NO:5498, SEQ ID NO:5503, SEQ ID NO:5496, SEQ ID NO:5507, SEQ ID NO:5515, SEQ ID NO:5493, SEQ ID NO:5506, SEQ ID NO:5509, SEQ ID NO:5517, SEQ ID NO:5521, SEQ ID NO:5520, SEQ ID NO:5500, SEQ ID NO:5494, SEQ ID NO:5508, SEQ ID NO:5514, or SEQ ID NO:5492, for example, the guiding domain includes SEQ ID NO:5496, SEQ ID NO:5498, or SEQ ID NO:5509.

[0028] In the implementation of the gRNA molecule, the allogeneic T cell target is CIITA, and the guiding domain includes SEQ ID NO:7771, SEQ ID NO:7769, SEQ ID NO:7773, SEQ ID NO:7726, SEQ ID NO:7758, SEQ ID NO:7739, SEQ ID NO:7779, SEQ ID NO:7770, SEQ ID NO:7749, SEQ ID NO:7754, SEQ ID NO:7745, SEQ ID NO:7785, SEQ ID NO:7731, SEQ ID NO:7772, SEQ ID NO:7743, or SEQ ID NO:7750, for example, the guiding domain includes SEQ ID NO:7769, SEQ ID NO:7771, SEQ ID NO:7739, or SEQ ID NO:7785.

[0029] In the implementation of the gRNA molecule, the allogeneic T cell target is CD3E, and the guiding domain includes SEQ ID NO:10729, SEQ ID NO:10719, SEQ ID NO:10764, SEQ ID NO:10789, SEQ ID NO:10701, SEQ ID NO:10700, or SEQ ID NO:10722.

[0030] In the implementation of the gRNA molecule, the allogeneic T cell target is FKBP1A, and the guiding domain includes SEQ ID NO:6693, SEQ ID NO:6705, SEQ ID NO:6694, SEQ ID NO:6708, or SEQ ID NO:6699.

[0031] In a second aspect, the present invention provides a gRNA molecule comprising tracr and crRNA, wherein the crRNA comprises a guidance domain complementary to a target sequence of an inhibitory molecule or a downstream effector that signals via the inhibitory molecule, the inhibitory molecule being selected from CD274, HAVCR2, LAG3, PDCD1, PD-L2, CTLA4, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD113), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFβ or PTPN11.

[0032] In the implementation of gRNA molecules:

[0033] 15(a) The inhibitory molecule is CD274 (PD-L1), and the guiding domain includes any one of SEQ ID NO:2942 to SEQ ID NO:3270;

[0034] 15(b) The inhibitory molecule is HAVCR2(TIM3), and the guiding domain includes any one of SEQ ID NO:3271 to SEQ ID NO:3541;

[0035] 15(c) The inhibitory molecule is LAG3, and the guiding domain includes any one of SEQ ID NO:3542 to SEQ ID NO:4032;

[0036] 15(d) The inhibitory molecule is PDCD1 (PD-1), and the guiding domain includes any one of SEQ ID NO:4033 to SEQ ID NO:4589 or SEQ ID NO:5720 to SEQ ID NO:5815; or

[0037] 15(e) The downstream effector that transmits signals via an inhibitory molecule is PTPN1, and the guiding domain includes any one of SEQ ID NO:4590 to SEQ ID NO:5277.

[0038] In embodiments of the gRNA molecule, the repressive molecule is PDCD1, and the guide domain comprises SEQ ID NO:5743, SEQ ID NO:5798, SEQ ID NO:5748, SEQ ID NO:5722, SEQ ID NO:5800, SEQ ID NO:5735, SEQ ID NO:5724, SEQ ID NO:5731, SEQ ID NO:5725, SEQ ID NO:5775, SEQ ID NO:5766, SEQ ID NO:5727, SEQ ID NO:5744, SEQ ID NO:5751, or SEQ ID NO:5734, for example, the guide domain comprises SEQ ID NO:5775.

[0039] In embodiments of the gRNA molecule, including any of the foregoing aspects and embodiments, the guide domain comprises 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence), 23 (if present in the reference sequence), 24 (if present in the reference sequence), or 25 (if present in the reference sequence) consecutive nucleic acids of any of the listed guide domain sequences. In other embodiments of the gRNA molecule, including any of the foregoing aspects and embodiments, the guide domain consists of 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence), 23 (if present in the reference sequence), 24 (if present in the reference sequence), or 25 (if present in the reference sequence) consecutive nucleic acids of any of the listed guide domain sequences. In any of the embodiments of the gRNA molecule, including the foregoing aspects and embodiments, 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence), 23 (if present in the reference sequence), 24 (if present in the reference sequence), or 25 (if present in the reference sequence) consecutive nucleic acids of any of the listed guide domain sequences are 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence), 23 (if present in the reference sequence), 24 (if present in the reference sequence), or 25 (if present in the reference sequence) consecutive nucleic acids located at the 3' end of the listed guide domain sequences. In other embodiments of the gRNA molecule, including any of the foregoing aspects and embodiments, 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence), 23 (if present in the reference sequence), or 24 (if present in the reference sequence), or 25 (if present in the reference sequence) consecutive nucleic acids of any of the listed guide domain sequences are 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence), 23 (if present in the reference sequence), or 24 (if present in the reference sequence), or 25 (if present in the reference sequence) consecutive nucleic acids located at the 5' end of the listed guide domain sequences. In other embodiments, the gRNA molecule, including in any of the foregoing aspects and embodiments, comprises 17, 18, 19, 20, 21 (if present in the reference sequence), 22 (if present in the reference sequence), 23 (if present in the reference sequence), 24 (if present in the reference sequence), or 25 (if present in the reference sequence) consecutive nucleic acids of any of the listed guide domain sequences, excluding the 5' or 3' nucleic acid of the listed guide domain sequences.

[0040] In embodiments of the gRNA molecule, including in any of the foregoing aspects and embodiments, the guide domain consists of the listed guide domain sequences.

[0041] The following general aspects of a gRNA molecule may be combined, alone or in combination, with any gRNA containing a guidance domain as described herein, such as the guidance domains listed in any of the foregoing aspects and embodiments.

[0042] In embodiments of the gRNA molecule, including in any of the foregoing aspects and embodiments, a portion of crRNA and a portion of tracr hybridize to form a flagpole comprising SEQ ID NO:6584 or SEQ ID NO:6585. In other embodiments, the flagpole further includes a first flagpole extension located at the crRNA portion 3' of the flagpole, wherein the first flagpole extension comprises SEQ ID NO:6586. In other embodiments, the flagpole further includes a second flagpole extension located at the crRNA portion of the flagpole and (if present) the first flagpole extension portion 3', wherein the second flagpole extension comprises SEQ ID NO:6587.

[0043] In embodiments of the gRNA molecule, including in any of the foregoing aspects and embodiments, tracr comprises, for example, the following sequences:

[0044] (a) SEQ ID NO:7820, optionally further comprising 1, 2, 3, 4, 5, 6 or 7 uracil (U) nucleotides at the 3' end;

[0045] (b)SEQ ID NO:6660; or

[0046] (c) SEQ ID NO:6661. In this type of embodiment, the crRNA portion of the flagpole contains SEQ ID NO:6607 or SEQ ID NO:6608.

[0047] In embodiments of the gRNA molecule, including in any of the foregoing aspects and embodiments, tracr comprises SEQ ID NO:6589 or SEQ ID NO:6590, and optionally, if a first flagpole extension is present, a first tracr extension is provided at 5' of SEQ ID NO:6589 or SEQ ID NO:6590, the first tracr extension comprising SEQ ID NO:6591.

[0048] In implementations of gRNA molecules, including in any of the foregoing aspects and implementations, the guiding domain and tracr are located on separate nucleic acid molecules.

[0049] In embodiments of the gRNA molecule, including in any of the foregoing aspects and embodiments, the crRNA comprises (e.g., consists of) a [guide domain] from 5' to 3':

[0050] a)SEQ ID NO:6584;

[0051] b)SEQ ID NO:6585;

[0052] c)SEQ ID NO:6605;

[0053] d)SEQ ID NO:6606;

[0054] e)SEQ ID NO:6607;

[0055] f)SEQ ID NO:6608; or

[0056] g)SEQ ID NO:7806.

[0057] In embodiments of the gRNA molecule, including in any of the foregoing aspects and embodiments, tracr comprises (e.g., consists of) the following from 5' to 3':

[0058] a)SEQ ID NO:6589;

[0059] b)SEQ ID NO:6590;

[0060] c)SEQ ID NO:6609;

[0061] d)SEQ ID NO:6610;

[0062] e)SEQ ID NO:6660;

[0063] f)SEQ ID NO:6661;

[0064] g)SEQ ID NO:7820;

[0065] h)SEQ ID NO:7807;

[0066] i)SEQ ID NO:7808;

[0067] j)SEQ ID NO:7809;

[0068] k) any of a) to j) above, further comprising at least 1, 2, 3, 4, 5, 6 or 7 uracil (U) nucleotides at the 3' end, for example, 1, 2, 3, 4, 5, 6 or 7 uracil (U) nucleotides;

[0069] l) Any of a) to k) above, further comprising at least 1, 2, 3, 4, 5, 6 or 7 adenine (A) nucleotides at the 3' end, for example, 1, 2, 3, 4, 5, 6 or 7 adenine (A) nucleotides; or

[0070] m) any of a) to i) above, further comprising at least 1, 2, 3, 4, 5, 6 or 7 adenine (A) nucleotides at the 5' end (e.g., at the 5' end).

[0071] In a preferred embodiment, the gRNA molecule includes, in any of the foregoing aspects and embodiments, a guidance domain and a tracr disposed on separate nucleic acid molecules, and the nucleic acid molecule containing the guidance domain includes SEQ ID NO:6607, optionally immediately adjacent to the 3' of the guidance domain, and the nucleic acid molecule containing the tracr includes SEQ ID NO:6660 (e.g., constituted therein).

[0072] In other embodiments, including any of the foregoing aspects and embodiments, the gRNA molecule comprises a guide domain and a tracr set on a single nucleic acid molecule, wherein the tracr is set at the 3' of the guide domain. In such embodiments, the gRNA molecule further comprises a loop set at the 3' of the guide domain and the 5' of the tracr, for example, a loop comprising (e.g., composed of) SEQ ID NO:6588.

[0073] In embodiments of the gRNA molecule, including in any of the foregoing aspects and embodiments, the gRNA molecule comprises (e.g., consists of) a [guide domain] from 5' to 3':

[0074] (a)SEQ ID NO:6601;

[0075] (b)SEQ ID NO:6602;

[0076] (c)SEQ ID NO:6603;

[0077] (d)SEQ ID NO:6604;

[0078] (e)SEQ ID NO:7811; or

[0079] (f) Any of (a) to (e) above, further comprising 1, 2, 3, 4, 5, 6 or 7 uracil (U) nucleotides at the 3' end.

[0080] In a preferred embodiment, the gRNA molecule includes, in any of the foregoing aspects and embodiments, a guide domain and a tracer disposed on a single nucleic acid molecule, and wherein the nucleic acid molecule comprises the guide domain and optionally a 3' disposed adjacent to the guide domain, SEQ ID NO:6601, for example, composed thereof.

[0081] In a preferred embodiment, the gRNA molecule includes, in any of the foregoing aspects and embodiments, a guide domain and a tracer disposed on a single nucleic acid molecule, and wherein the nucleic acid molecule comprises the guide domain and optionally a 3' disposed adjacent to the guide domain, SEQ ID NO:7811, for example, composed thereof.

[0082] In one embodiment, the gRNA molecule consists of unmodified RNA nucleotides and nucleic acid bonds. In other embodiments, the gRNA molecule contains one or more modifications, such as those described herein. In embodiments of the gRNA molecule, including in any of the foregoing aspects and embodiments, one or optionally more than one nucleic acid molecule comprises:

[0083] a) Modification of the 3' end of the nucleic acid molecule or molecule with (e.g., three) thiophosphates;

[0084] b) Modification of the 5' end of the nucleic acid molecule or molecule with (e.g., three) thiophosphates;

[0085] c) Modification of the nucleic acid molecule or the 3' end of the molecule (e.g., three) 2'-O-methyl groups;

[0086] d) Modification of the 5' end of the nucleic acid molecule or molecule with (e.g., three) 2'-O-methyl groups;

[0087] e) 2'O-methyl modification at each of the 3'-4', 3'- ...

[0088] f) Any combination thereof.

[0089] In embodiments of the gRNA molecule, including in any of the foregoing aspects and embodiments, when a CRISPR system (e.g., an RNP as described herein, such as an RNP containing a Cas9 molecule as described herein) comprising a gRNA molecule is introduced into a cell, an insertion / deletion is formed at or near a target sequence complementary to the guide domain of the gRNA molecule. In embodiments, the insertion / deletion is a frameshift mutation. In embodiments, the insertion / deletion is... Figure 34A , Figure 34B , Figure 36 , Figure 38 , Figure 41 , Figure 44 , Figure 48 , Figure 49 , Figure 50 or Figure 53 The insertions / deletions listed in any of the graphs.

[0090] In embodiments of the gRNA molecule, including in any of the foregoing aspects and embodiments, when a CRISPR system containing (e.g., an RNP as described herein, or an RNP containing, for example, a Cas9 molecule as described herein) is introduced into a cell population, insertions / deletions are formed at or near a target sequence complementary to the guide domain of the gRNA molecule in at least about 40%, for example, at least about 50%, for example, at least about 60%, for example, at least about 70%, for example, at least about 80%, for example, at least about 90%, for example, at least about 95%, for example, at least about 96%, for example, at least about 97%, for example, at least about 98%, for example, at least about 99% of the cell population. In the implementation, the insertion / deletion as a frameshift mutation is formed at or near a target sequence complementary to the guide domain of the gRNA molecule in at least about 20%, for example, at least about 30%, for example, at least about 35%, for example, at least about 40%, for example, at least about 45%, for example, at least about 50%, for example, at least about 55%, for example, at least about 60%, for example, at least about 65%, for example, at least about 70%, for example, at least about 75%, for example, at least about 80%, for example, at least about 85%, for example, at least about 90%, for example, at least about 95%, for example, at least about 95%, for example, at least about 99% of the cell population. In the implementation, the insertion / deletion is formed in at least about 30%, for example, at least about 40%, for example, at least about 50%, for example, at least about 60%, for example, at least about 70%, for example, at least about 80%, for example, at least about 90%, for example, at least about 90%, for example, at least about 95%, for example, at least about 96%, for example, at least about 97%, for example, at least about 98%, for example, at least about 99% of the cell population. Figure 34A , Figure 34B , Figure 36 , Figure 38 , Figure 41 , Figure 44 , Figure 48 , Figure 49 , Figure 50 or Figure 53 The insertions / deletions listed in any of the figures. In an implementation, the five most frequently detected insertions / deletions in the cell population include three or more, for example, four, or five with... Figure 34A , Figure 34B , Figure 36 , Figure 38 , Figure 41 , Figure 44 , Figure 48 , Figure 49 , Figure 50 or Figure 53 Any gRNA-related insertions / deletions listed in any of the figures. Insertions / deletions or insertion / deletion patterns can be measured and / or quantified by, for example, next-generation sequencing (NGS).

[0091] In embodiments of the gRNA molecule, including any of the foregoing aspects and embodiments, when a CRISPR system (e.g., an RNP as described herein, or an RNP containing, for example, a Cas9 molecule as described herein) comprising a gRNA molecule is introduced into cells (or cell populations) as described above, expression of a gene comprising a target sequence complementary to the guide domain of the gRNA molecule is reduced or eliminated in the cells. In embodiments, expression of the gene is reduced or eliminated in at least about 40%, for example, at least about 50%, for example, at least about 60%, for example, at least about 70%, for example, at least about 80%, for example, at least about 90%, for example, at least about 95%, for example, at least about 96%, for example, at least about 97%, for example, at least about 98%, for example, at least about 99% of the cells in the population. In embodiments, the reduction or elimination of expression is measured by flow cytometry. In other embodiments, for example, in the case of FKBP1A, the reduction or elimination of expression is measured by a functional assay (e.g., as described herein).

[0092] In embodiments of the gRNA molecule, including in any of the foregoing aspects and embodiments, when a CRISPR system containing (e.g., the RNP described herein, or an RNP containing, for example, the Cas9 molecule described herein) is introduced into a cell as described above, no off-target insertions / deletions are formed in the cell, for example, as detectable by (e.g., by) next-generation sequencing and / or nucleotide insertion assays.

[0093] In embodiments of the gRNA molecule, including in any of the foregoing aspects and embodiments, when a CRISPR system containing (e.g., the RNP described herein, for example, an RNP containing, for example, the Cas9 molecule described herein) is introduced into cells (or cell populations) as described above, off-target insertions / deletions are detected in no more than about 5%, for example, no more than about 1%, for example, no more than about 0.1%, for example, no more than about 0.01% of the cell population, for example, as detectable by next-generation sequencing and / or nucleotide insertion assays.

[0094] In any of the foregoing aspects and embodiments that refer to cells, the cell is (or the cell population includes) a mammalian cell, a primate cell, or a human cell, for example, a human cell. In any of the foregoing aspects and embodiments that refer to cells, the cell is (or the cell population includes) an immune effector cell, for example, a T cell or an NK cell, for example, a T cell, such as a CD4+ T cell, a CD8+ T cell, or a combination thereof.

[0095] In any of the foregoing aspects and embodiments relating to cells, the cells (or cell populations) have been or will be engineered to express chimeric antigen receptors (CARs). In the embodiments, the CAR is:

[0096] (a) CD19 CAR; or

[0097] (b) BCMACAR. In the implementation plan:

[0098] (a) The CAR is a CD19 CAR containing an antigen-binding domain, wherein the antigen-binding domain comprises any one of SEQ ID NO:7883 to SEQ ID NO:7898;

[0099] (b) The CAR is a CD19 CAR containing SEQ ID NO:7909 or SEQ ID NO:7920;

[0100] (c) The CAR is a BCMACAR containing an antigen-binding domain, said antigen-binding domain comprising any one of SEQ ID NO:7939 to SEQ ID NO:8112, for example, the antigen-binding domain comprising SEQ ID NO:7949; or

[0101] (d)CAR is any of SEQ ID NO:8549 to SEQ ID NO:8621, for example, BCMACAR containing SEQ ID NO:8559.

[0102] In any of the foregoing aspects and embodiments relating to cells, the cells are allogeneic to the patient to whom the cells are to be administered. In other embodiments, the cells are autologous to the patient to whom the cells are to be administered.

[0103] In another aspect, the present invention provides a composition comprising a first gRNA molecule of any of the foregoing aspects and embodiments, and further comprising a Cas9 molecule. In an embodiment, the Cas9 molecule comprises, for example, any one of SEQ ID NO:6611 or SEQ ID NO:7821 to SEQ ID NO:7831. In an embodiment, the Cas9 molecule is active or inactive *Streptococcus pyogenes* Cas9. In a preferred embodiment, the first gRNA molecule and the Cas9 molecule are present in a ribonucleoprotein complex (RNP).

[0104] In several aspects, the composition may comprise more than one gRNA molecule, for example, more than one gRNA molecule, each of which is complexed with the Cas9 molecule described herein. For example, in embodiments, the composition further comprises a second gRNA molecule; a second gRNA molecule and a third gRNA molecule; or a second gRNA molecule, a third gRNA molecule, and a fourth gRNA molecule, wherein the second gRNA molecule, the third gRNA molecule (if present), and the fourth gRNA molecule (if present) are gRNA molecules as described herein, for example, gRNA molecules of any of the foregoing aspects and embodiments, and wherein each gRNA molecule of the composition is complementary to a different target sequence (i.e., comprises a different guide domain). In embodiments, the first gRNA molecule, the second gRNA molecule, the third gRNA molecule (if present), and the fourth gRNA molecule (if present) are complementary to target sequences within the same gene. In such embodiments, the first, second, third (if present), and fourth gRNA molecules (if present) are complementary to target sequences separated by no more than 20,000, 10,000, 6,000, 5,000, 4,000, 1,000, 500, 4000, 300, 200, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides. In other embodiments, the first, second, third (if present), and fourth gRNA molecules (if present) are complementary to target sequences within different genes or loci (e.g., the different genes described herein).

[0105] In one implementation scheme, the first gRNA molecule is any one of gRNA molecules 2(b), 2(c), 2(d), 2(d), 2(e), 2(f), 2(g), or 2(h); and the second gRNA molecule is any one of gRNA molecules 2(a), 2(i), 2(j), 2(k), or 2(q); and the third gRNA molecule is any one of gRNA molecules 15(a), 15(b), 15(c), 15(d), or 15(e). In another implementation scheme, the first gRNA molecule is any one of gRNA molecules 2(b), 2(c), 2(d), 2(d), 2(e), 2(f), 2(g), or 2(h); and the second gRNA molecule is any one of gRNA molecules 2(l), 2(m), 2(n), or 2(o); and the third gRNA molecule is any one of gRNA molecules 15(a), 15(b), 15(c), 15(d), or 15(e). In other embodiments, the first gRNA molecule is any one of gRNA molecules 2(b), 2(c), 2(d), 2(d), 2(e), 2(f), 2(g), or 2(h); and the second gRNA molecule is any one of gRNA molecules 2(l), 2(m), 2(n), or 2(o). In other embodiments, the first gRNA molecule is any one of gRNA molecules 2(b), 2(c), 2(d), 2(d), 2(e), 2(f), 2(g), or 2(h); and the second gRNA molecule is any one of gRNA molecules 2(a), 2(i), 2(j), or 2(k). In other embodiments, the first gRNA molecule is any one of 2(b), 2(c), 2(d), 2(d), 2(e), 2(f), 2(g), or 2(h); and the second gRNA molecule is any one of 15(a), 15(b), 15(c), 15(d), or 15(e). In other embodiments, the first gRNA molecule is any one of 15(a), 15(b), 15(c), 15(d), or 7(e); and the second gRNA molecule is any one of 15(a), 15(b), 15(c), 15(d), or 15(e). In any of the foregoing embodiments, a third gRNA is present, and the third gRNA molecule is any one of 15(a), 15(b), 15(c), 15(d), or 15(e). In one embodiment, the composition comprises two gRNA molecules, as described above, or any of the gRNA molecules described in the embodiments. In another embodiment, the composition comprises three gRNA molecules, as described above, or any of the gRNA molecules described in the embodiments.In an embodiment, the composition comprises a first gRNA molecule of any of the foregoing aspects and embodiments, and a second gRNA molecule of any of the foregoing gRNA molecule aspects and embodiments; wherein the guiding domain of the first gRNA molecule is a guiding domain of any one of 2(a), 2(i), 2(j), or 2(k); wherein the guiding domain of the second gRNA molecule is a guiding domain of any one of 2(b), 2(c), 2(d), 2(f), 2(g), 2(h), or 2(i).

[0106] In an embodiment, the composition comprises two gRNA molecules, and the guide domain of the first gRNA molecule comprises, for example, SEQ ID NO:5519, SEQ ID NO:5497, SEQ ID NO:5499, SEQ ID NO:5498, SEQ ID NO:5503, SEQ ID NO:5496, SEQ ID NO:5507, SEQ ID NO:5515, SEQ ID NO:5493, SEQ ID NO:5506, SEQ ID NO:5509, SEQ ID NO:5517, SEQ ID NO:5521, SEQ ID NO:5520, SEQ ID NO:5500, SEQ ID NO:5494, SEQ ID NO:5508, SEQ ID NO:5514 or SEQ ID NO:5492; and the guide domain of the second gRNA molecule comprises SEQ ID NO:5569, SEQ ID NO:5585, SEQ ID NO:5587, SEQ ID NO:5514, or SEQ ID NO:5492; for example, SEQ ID NO:5509, SEQ ID NO:5517, SEQ ID NO:5521, SEQ ID NO:5520, SEQ ID NO:5500, SEQ ID NO:5494, SEQ ID NO:5508, SEQ ID NO:5514 or SEQ ID NO:5492; and the second gRNA molecule comprises SEQ ID NO:5569, SEQ ID NO:5585, SEQ ID NO:5587, SEQ ID NO:5514, SEQ ID NO:5520, SEQ ID NO:5500, SEQ ID NO:5515, SEQ ID NO:5508, SEQ ID NO:5514 or SEQ ID NO:5514. NO: 5592, SEQ ID NO: 5601, SEQ ID NO: 5589, SEQ ID NO: 5600, SEQ ID NO: 5594, SEQ ID NO: 5571, SEQ ID NO: 5593, SEQ ID NO: 5574, SEQ ID NO: 5598, SEQ ID NO: 5586, SEQ ID NO: 5599, SEQ ID NO:5591, SEQ ID NO:5610, SEQ ID NO:5608, SEQ ID NO:5617, SEQ ID NO:5619 or SEQ ID NO:5620, for example consisting thereof.

[0107] In an embodiment, the composition comprises two gRNA molecules, and the lead domain of the first gRNA molecule comprises, for example, SEQ ID NO:5496, SEQ ID NO:5498 or SEQ ID NO:5509; and the lead domain of the second gRNA molecule comprises, for example, SEQ ID NO:5569, SEQ ID NO:5586, SEQ ID NO:5587, SEQ ID NO:5592, SEQ ID NO:5599 or SEQ ID NO:5600.

[0108] In an embodiment, the composition comprises two gRNA molecules, wherein the lead domain of the first gRNA molecule comprises, for example, SEQ ID NO:5496, SEQ ID NO:5498 or SEQ ID NO:5509; and the lead domain of the second gRNA molecule comprises, for example, SEQ ID NO:5569.

[0109] In an embodiment, the composition comprises two gRNA molecules, and the lead domain of the first gRNA molecule comprises, for example, SEQ ID NO:5496, SEQ ID NO:5498 or SEQ ID NO:5509; and the lead domain of the second gRNA molecule comprises, for example, SEQ ID NO:10729, SEQ ID NO:10719, SEQ ID NO:10764, SEQ ID NO:10789, SEQ ID NO:10701, SEQ ID NO:10700 or SEQ ID NO:10722.

[0110] In an embodiment, including any of the foregoing aspects and embodiments, the composition further includes a third gRNA molecule as described herein (e.g., any of the foregoing gRNA molecule aspects and embodiments), wherein the guiding domain of the third gRNA molecule is a guiding domain of either 2(n) or 2(q). In the implementation scheme, the guide domain of the third gRNA molecule comprises, for example, SEQ ID NO:7771, SEQ ID NO:7769, SEQ ID NO:7773, SEQ ID NO:7726, SEQ ID NO:7758, SEQ ID NO:7739, SEQ ID NO:7779, SEQ ID NO:7770, SEQ ID NO:7749, SEQ ID NO:7754, SEQ ID NO:7745, SEQ ID NO:7785, SEQ ID NO:7731, SEQ ID NO:7772, SEQ ID NO:7743 or SEQ ID NO:7750; or for example, comprises (e.g., comprises) SEQ ID NO:7769, SEQ ID NO:7771, SEQ ID NO:7739 or SEQ ID NO:7785.

[0111] In embodiments, including any of the foregoing aspects and embodiments, the composition further includes a fourth gRNA molecule as described herein (e.g., in any of the foregoing gRNA molecule aspects and embodiments), wherein the guidance domain of said fourth gRNA molecule is complementary to the target sequence of a target of an NK repressive molecule (e.g., LILRB1). In embodiments, the guidance domain of said fourth gRNA molecule comprises, for example, being composed of:

[0112] a) Any one of SEQ ID NO:10090 to SEQ ID NO:10673;

[0113] b) 17, 18, 19, 20, 21, 22, 23 or 24 consecutive nucleotides, preferably 20 consecutive nucleotides, from any one of SEQ ID NO:10090 to SEQ ID NO:10673.

[0114] c) 5, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides, preferably 20 nucleotides, from any one of SEQ ID NO: 10090 to SEQ ID NO: 10673; or

[0115] d) 3, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides, preferably 20 nucleotides, from any one of SEQ ID NO:10090 to SEQ ID NO:10673.

[0116] In embodiments of the composition (including any of the foregoing aspects and embodiments), the guiding domain of the first gRNA molecule (as described herein), the guiding domain of the second gRNA molecule (as described herein), and (if present), the guiding domain of the third gRNA molecule (as described herein), comprises, for example, a sequence of any of the following:

[0117] a) Combinations A1 to A72 in Table 33;

[0118] b) Combinations B1 to B84 in Table 34;

[0119] c) Combinations C1 to C42 in Table 35;

[0120] d) Combinations D1 to D36 in Table 36;

[0121] e) Combinations E1 to E30 in Table 37; or

[0122] f) Combinations F1 to F60 in Table 38.

[0123] In any of the foregoing aspects and embodiments, each of the said gRNA molecules is in a ribonucleoprotein complex (RNP) having the Cas9 molecule described herein.

[0124] In the implementation scheme, the gRNA molecule or composition is formulated in a culture medium suitable for electroporation.

[0125] In embodiments in which each of the gRNA molecules is located within an RNP having the Cas9 molecule described herein, each of the RNP complexes is at a concentration of less than about 10 μM, for example, less than about 3 μM, for example, less than about 1 μM, for example, less than about 0.5 μM, for example, less than about 0.3 μM, for example, less than about 0.1 μM.

[0126] In embodiments, the composition further comprises, for example, cells described herein, such as cell populations, such as immune effector cells, such as immune effector cells expressing CAR.

[0127] In another aspect, the present invention provides a nucleic acid encoding a gRNA molecule of any of the aforementioned gRNA molecule aspects or embodiments, or a component of (e.g., all) of a composition of any of the aforementioned composition aspects and embodiments. In embodiments, the nucleic acid comprises a promoter effectively linked to the sequence encoding the gRNA molecule. In embodiments, the promoter is a promoter recognized by RNA polymerase II or RNA polymerase III. In other embodiments, the promoter is a U6 promoter or a HI promoter. In embodiments, the nucleic acid also encodes a Cas9 molecule. In embodiments, the nucleic acid comprises a promoter effectively linked to the sequence encoding the Cas9 molecule, such as the EF-1 promoter, the CMV IE gene promoter, the EF-1α promoter, the ubiquitin C promoter, or the phosphoglycerate kinase (PGK) promoter.

[0128] In another aspect, the present invention provides a vector comprising the nucleic acid of any of the foregoing nucleic acid aspects and embodiments. In the embodiments, the vector is selected from lentiviral vectors, adenovirus vectors, adeno-associated virus (AAV) vectors, herpes simplex virus (HSV) vectors, plasmids, microcircles, nanoparticles, and RNA vectors.

[0129] In another aspect, the present invention provides a composition comprising a gRNA molecule of any of the foregoing gRNA molecule aspects and embodiments and a nucleic acid encoding a Cas9 molecule (e.g., as described herein).

[0130] In another aspect, the present invention provides a composition comprising a nucleic acid encoding a gRNA molecule encoding any of the foregoing gRNA molecular aspects and embodiments, and a Cas9 molecule (e.g., as described herein).

[0131] In embodiments of any composition of the present invention, the composition further comprises a template nucleic acid. In embodiments, the template nucleic acid comprises a nucleotide corresponding to a nucleotide of a target sequence of a gRNA molecule. In embodiments, the template nucleic acid comprises a nucleic acid encoding a chimeric antigen receptor (CAR), for example, as described herein. In embodiments, the CAR is (a) a CD19 CAR, for example, as described in WO2012 / 079000 or WO2014 / 153270; or (b) a BCMACAR, for example, as described herein, such as a BCMACAR comprising SEQ ID NO:8559. In embodiments, the template nucleic acid comprises a nucleic acid encoding an NK repressive molecule, for example, as described herein.

[0132] In another aspect, the present invention provides a method for altering a cell, for example, altering its structure, such as its sequence or its target sequence, comprising contacting the cell with: a) a gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments, for example, more than one gRNA molecule, and (e.g., a Cas9 molecule described herein); b) a gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments, for example, more than one gRNA molecule, and a nucleic acid encoding (e.g., a Cas9 molecule described herein); c) a nucleic acid, wherein the nucleic acid encodes any of the aforementioned gRNA molecule aspects and embodiments. The composition comprises: d) a gRNA molecule, for example, more than one gRNA molecule, and (e.g., as described herein) a Cas9 molecule; d) a nucleic acid encoding a gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments, for example, more than one gRNA molecule, and a nucleic acid encoding, for example, a Cas9 molecule as described herein; e) any of the above a) to d) and a template nucleic acid; f) any of the above a) to d) and a nucleic acid comprising a sequence encoding a template nucleic acid; g) a composition of any of the aforementioned composition aspects and embodiments; or h) a vector of any of the aforementioned vector aspects and embodiments. In embodiments, the gRNA molecule or the nucleic acid encoding the gRNA molecule and the Cas9 molecule or the nucleic acid encoding the Cas9 molecule are formulated in a single composition. In other embodiments, the gRNA molecule or the nucleic acid encoding the gRNA molecule and the Cas9 molecule or the nucleic acid encoding the Cas9 molecule are formulated in more than one composition. In embodiments, more than one composition is delivered simultaneously or sequentially, for example, delivered to a cell as described herein. In embodiments, the cell is an animal cell, for example, a mammalian cell, a primate cell, or a human cell. In embodiments, the cells are immune effector cells (e.g., a population of immune effector cells), such as T cells or NK cells, such as CD4+ T cells, CD8+ T cells, or combinations thereof. In embodiments, the cells have been or will be engineered to express (e.g., as described herein) a chimeric antigen receptor (CAR). In embodiments, the cells contain or will contain (e.g., as described herein) a chimeric antigen receptor (CAR). In embodiments, the cells contain or will contain nucleic acids encoding (e.g., as described herein) a chimeric antigen receptor (CAR). In embodiments, the CAR is (a) a CD19 CAR; or (b) a BCMACAR. In embodiments, the CAR is a CD19 CAR containing an antigen-binding domain comprising any one of SEQ ID NO:7883 to SEQ ID NO:7898. In embodiments, the CAR is a CD19 CAR and comprises any one of SEQ ID NO:7908 to SEQ ID NO:7920.In one embodiment, the CAR is a BCMACAR containing an antigen-binding domain, said antigen-binding domain comprising any one of SEQ ID NO:7939 to SEQ ID NO:8112. In another embodiment, the CAR is a BCMACAR and comprises any one of SEQ ID NO:8549 to SEQ ID NO:8621, for example, comprising SEQ ID NO:8559. In another embodiment, the cells are allogeneic relative to the patient to whom the cells are to be administered. In another embodiment, the cells are isolated from a healthy human donor. In yet another embodiment, the cells are autologous relative to the patient to whom the cells are to be administered.

[0133] In another aspect, the present invention provides cells modified by any of the foregoing method aspects and embodiments, for example, cells modified by the methods described herein. In another aspect, the present invention provides cells comprising a first gRNA molecule comprising any of the foregoing gRNA molecule aspects and embodiments, or a composition comprising any of the foregoing composition aspects and embodiments, a nucleic acid comprising any of the foregoing nucleic acid aspects and embodiments, or a vector comprising any of the foregoing vector aspects and embodiments. In embodiments, the gRNA molecule, composition, nucleic acid, or vector is introduced into the cell ex vivo. In other embodiments, the gRNA molecule, composition, nucleic acid, or vector is introduced into the cell in vivo. In embodiments, the cell is an animal cell, such as a mammalian cell, primate cell, or human cell. In embodiments, the cell is an immune effector cell (e.g., a population of immune effector cells), such as T cells or NK cells, such as T cells, such as CD4+ T cells, CD8+ T cells, or combinations thereof. In embodiments, the cell has been or will be engineered to express (e.g., as described herein) a chimeric antigen receptor (CAR). In embodiments, the cell contains or will contain (e.g., as described herein) a chimeric antigen receptor (CAR). In embodiments, the cells contain or will contain nucleic acids encoding (e.g., as described herein) a chimeric antigen receptor (CAR). In embodiments, the CAR is (a) a CD19 CAR; or (b) a BCMACAR. In embodiments, the CAR is a CD19 CAR containing an antigen-binding domain comprising any one of SEQ ID NO:7883 to SEQ ID NO:7898. In embodiments, the CAR is a CD19 CAR and comprises any one of SEQ ID NO:7908 to SEQ ID NO:7920. In embodiments, the CAR is a BCMACAR containing an antigen-binding domain comprising any one of SEQ ID NO:7939 to SEQ ID NO:8112. In embodiments, the CAR is a BCMACAR and includes any one of SEQ ID NO:8549 to SEQ ID NO:8621, for example, SEQ ID NO:8559. In embodiments, the cells are allogeneic relative to the patient to whom the cells are to be administered. In embodiments, the cells are isolated from a healthy human donor. In one embodiment, the cells are autologous to the patient to whom the cells are to be administered. In another embodiment, the cells comprise, have comprised, or will comprise a nucleic acid encoding a second gRNA molecule according to any one of claims 1-60, or a second gRNA molecule encoding any of the aforementioned gRNA molecules and any of the embodiments, wherein the first gRNA molecule and the second gRNA molecule contain different guide domains.In an implementation, the first gRNA molecule includes a guide domain complementary to the target sequence of an allogeneic T cell target (e.g., the guide domains described in Tables 1, 3, 4, or 5), and the second gRNA molecule includes a guide domain complementary to the target sequence of an inhibitory molecule or the target sequence of a downstream effector that signals via an inhibitory molecule (e.g., including the guide domains described in Tables 2 or 6). In the implementation scheme, the inhibitory molecule or downstream effector that signals via the inhibitory molecule is CD274, HAVCR2, LAG3, PDCD1, PD-L2, CTLA4, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD113), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFβ or PTPN11. In one embodiment, the first gRNA molecule includes a guide domain complementary to a target sequence of TRAC, TRBC1, TRBC2, CD247, CD3D, CD3E, or CD3G, and the second gRNA molecule includes a guide domain complementary to a target sequence of NLRC5, for example, including a guide domain comprising any one of SEQ ID NO:8622 to SEQ ID NO:10089 (e.g., composed of). In another embodiment, the first gRNA molecule includes a guide domain complementary to a target sequence of TRAC, TRBC1, TRBC2, CD247, CD3D, CD3E, or CD3G, and the second gRNA molecule includes a guide domain complementary to a target sequence of B2M, HLA-A, HLA-B, or HLA-C. In the embodiments, the cell further comprises, has already comprised, or will comprise a third gRNA molecule, or a nucleic acid encoding a third gRNA molecule, which encodes any of the aforementioned gRNA molecules and any of the embodiments, wherein the first gRNA molecule, the second gRNA molecule, and the third gRNA molecule contain different guidance domains. In the embodiments, the third gRNA molecule contains a guidance domain complementary to the target sequence of CIITA, RFXANK, RFX5, or RFXAP (e.g., CIITA), for example, containing a guidance domain comprising any of SEQ ID NO:7717 to SEQ ID NO:7804 (e.g., composed of thereas), for example, containing a guidance domain comprising any of SEQ ID NO:7769, SEQ ID NO:7771, or SEQ ID NO:7785 (e.g., composed of thereas).In one embodiment, the cell contains three gRNA molecules, and the first gRNA molecule contains a guide domain complementary to the target sequence of TRAC; the second gRNA molecule contains a guide domain complementary to the target sequence of B2M; and the third gRNA molecule contains a guide domain complementary to the target sequence of CIITA. In another embodiment, the cell contains three gRNA molecules, and the first gRNA molecule contains a guide domain complementary to the target sequence of TRAC; the second gRNA molecule contains a guide domain complementary to the target sequence of NLRC5; and the third gRNA molecule contains a guide domain complementary to the target sequence of CIITA. In yet another embodiment, the cell contains two gRNA molecules, and the first gRNA molecule contains a guide domain complementary to the target sequences of TRAC, TRBC1, TRBC2, CD247, CD3D, CD3E, or CD3G, and the second gRNA molecule contains a guide domain complementary to the target sequences of NR3C1, DCK, CD52, or FKBP1A.

[0134] In embodiments where cells contain gRNA molecules (e.g., more than one gRNA molecule described herein):

[0135] (1) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1 to SEQ ID NO:83 and SEQ ID NO:5492 to SEQ ID NO:5527;

[0136] (2) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:969 to SEQ ID NO:1345;

[0137] (3) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1346 to SEQ ID NO:1698;

[0138] (4) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1699 to SEQ ID NO:2068;

[0139] (5) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:2069 to SEQ ID NO:2941;

[0140] (6) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:5278 to SEQ ID NO:5491;

[0141] (7) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:6227 to SEQ ID NO:6324;

[0142] (8) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:6325 to SEQ ID NO:6583;

[0143] (9) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5624 to SEQ ID NO:5643 or SEQ ID NO:5966 to SEQ ID NO:6097, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1 to SEQ ID NO:83 and SEQ ID NO:5492 to SEQ ID NO:5527;

[0144] (10) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5624 to SEQ ID NO:5643 or SEQ ID NO:5966 to SEQ ID NO:6097, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:969 to SEQ ID NO:1345;

[0145] (11) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5624 to SEQ ID NO:5643 or SEQ ID NO:5966 to SEQ ID NO:6097, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1346 to SEQ ID NO:1698;

[0146] (12) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5624 to SEQ ID NO:5643 or SEQ ID NO:5966 to SEQ ID NO:6097, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1699 to SEQ ID NO:2068;

[0147] (13) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5624 to SEQ ID NO:5643 or SEQ ID NO:5966 to SEQ ID NO:6097, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:2069 to SEQ ID NO:2941;

[0148] (14) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5624 to SEQ ID NO:5643 or SEQ ID NO:5966 to SEQ ID NO:6097, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:5278 to SEQ ID NO:5491;

[0149] (15) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5624 to SEQ ID NO:5643 or SEQ ID NO:5966 to SEQ ID NO:6097, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:6227 to SEQ ID NO:6324;

[0150] (16) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5624 to SEQ ID NO:5643 or SEQ ID NO:5966 to SEQ ID NO:6097, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:6325 to SEQ ID NO:6583;

[0151] (17) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5644 to SEQ ID NO:5719 or SEQ ID NO:6098 to SEQ ID NO:6226, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1 to SEQ ID NO:83 and SEQ ID NO:5492 to SEQ ID NO:5527;

[0152] (18) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5644 to SEQ ID NO:5719 or SEQ ID NO:6098 to SEQ ID NO:6226, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:969 to SEQ ID NO:1345;

[0153] (19) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5644 to SEQ ID NO:5719 or SEQ ID NO:6098 to SEQ ID NO:6226, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1346 to SEQ ID NO:1698;

[0154] (20) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5644 to SEQ ID NO:5719 or SEQ ID NO:6098 to SEQ ID NO:6226, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1699 to SEQ ID NO:2068;

[0155] (21) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5644 to SEQ ID NO:5719 or SEQ ID NO:6098 to SEQ ID NO:6226, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:2069 to SEQ ID NO:2941;

[0156] (22) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5644 to SEQ ID NO:5719 or SEQ ID NO:6098 to SEQ ID NO:6226, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:5278 to SEQ ID NO:5491;

[0157] (23) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5644 to SEQ ID NO:5719 or SEQ ID NO:6098 to SEQ ID NO:6226, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:6227 to SEQ ID NO:6324;

[0158] (24) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5644 to SEQ ID NO:5719 or SEQ ID NO:6098 to SEQ ID NO:6226, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:6325 to SEQ ID NO:6583;

[0159] (25) The first gRNA molecule contains a guide domain selected from SEQ ID NO:84 to SEQ ID NO:392, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1 to SEQ ID NO:83 and SEQ ID NO:5492 to SEQ ID NO:5527;

[0160] (26) The first gRNA molecule contains a guide domain selected from SEQ ID NO:84 to SEQ ID NO:392, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:969 to SEQ ID NO:1345;

[0161] (27) The first gRNA molecule contains a guide domain selected from SEQ ID NO:84 to SEQ ID NO:392, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1346 to SEQ ID NO:1698;

[0162] (28) The first gRNA molecule contains a guide domain selected from SEQ ID NO:84 to SEQ ID NO:392, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1699 to SEQ ID NO:2068;

[0163] (29) The first gRNA molecule contains a guide domain selected from SEQ ID NO:84 to SEQ ID NO:392, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:2069 to SEQ ID NO:2941;

[0164] (30) The first gRNA molecule contains a guide domain selected from SEQ ID NO:84 to SEQ ID NO:392, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:5278 to SEQ ID NO:5491;

[0165] (31) The first gRNA molecule contains a guide domain selected from SEQ ID NO:84 to SEQ ID NO:392, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:6227 to SEQ ID NO:6324;

[0166] (32) The first gRNA molecule contains a guide domain selected from SEQ ID NO:84 to SEQ ID NO:392, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:6325 to SEQ ID NO:6583;

[0167] (33) The first gRNA molecule contains a guide domain selected from SEQ ID NO:393 to SEQ ID NO:532, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1 to SEQ ID NO:83 and SEQ ID NO:5492 to SEQ ID NO:5527;

[0168] (34) The first gRNA molecule contains a guide domain selected from SEQ ID NO:393 to SEQ ID NO:532, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:969 to SEQ ID NO:1345;

[0169] (35) The first gRNA molecule contains a guide domain selected from SEQ ID NO:393 to SEQ ID NO:532, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1346 to SEQ ID NO:1698;

[0170] (36) The first gRNA molecule contains a guide domain selected from SEQ ID NO:393 to SEQ ID NO:532, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1699 to SEQ ID NO:2068;

[0171] (37) The first gRNA molecule contains a guide domain selected from SEQ ID NO:393 to SEQ ID NO:532, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:2069 to SEQ ID NO:2941;

[0172] (38) The first gRNA molecule contains a guide domain selected from SEQ ID NO:393 to SEQ ID NO:532, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:5278 to SEQ ID NO:5491;

[0173] (39) The first gRNA molecule contains a guide domain selected from SEQ ID NO:393 to SEQ ID NO:532, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:6227 to SEQ ID NO:6324;

[0174] (40) The first gRNA molecule contains a guide domain selected from SEQ ID NO:393 to SEQ ID NO:532, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:6325 to SEQ ID NO:6583;

[0175] (41) The first gRNA molecule contains a guide domain selected from SEQ ID NO:533 to SEQ ID NO:839, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1 to SEQ ID NO:83 and SEQ ID NO:5492 to SEQ ID NO:5527;

[0176] (42) The first gRNA molecule contains a guide domain selected from SEQ ID NO:533 to SEQ ID NO:839, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:969 to SEQ ID NO:1345;

[0177] (43) The first gRNA molecule contains a guide domain selected from SEQ ID NO:533 to SEQ ID NO:839, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1346 to SEQ ID NO:1698;

[0178] (44) The first gRNA molecule contains a guide domain selected from SEQ ID NO:533 to SEQ ID NO:839, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1699 to SEQ ID NO:2068;

[0179] (45) The first gRNA molecule contains a guide domain selected from SEQ ID NO:533 to SEQ ID NO:839, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:2069 to SEQ ID NO:2941;

[0180] (46) The first gRNA molecule contains a guide domain selected from SEQ ID NO:533 to SEQ ID NO:839, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:5278 to SEQ ID NO:5491;

[0181] (47) The first gRNA molecule contains a guide domain selected from SEQ ID NO:533 to SEQ ID NO:839, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:6227 to SEQ ID NO:6324;

[0182] (48) The first gRNA molecule contains a guide domain selected from SEQ ID NO:533 to SEQ ID NO:839, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:6325 to SEQ ID NO:6583;

[0183] (49) The first gRNA molecule contains a guide domain selected from SEQ ID NO:840 to SEQ ID NO:968, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1 to SEQ ID NO:83 and SEQ ID NO:5492 to SEQ ID NO:5527;

[0184] (50) The first gRNA molecule contains a guide domain selected from SEQ ID NO:840 to SEQ ID NO:968, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:969 to SEQ ID NO:1345;

[0185] (51) The first gRNA molecule contains a guide domain selected from SEQ ID NO:840 to SEQ ID NO:968, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1346 to SEQ ID NO:1698;

[0186] (52) The first gRNA molecule contains a guide domain selected from SEQ ID NO:840 to SEQ ID NO:968, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:1699 to SEQ ID NO:2068;

[0187] (53) The first gRNA molecule contains a guide domain selected from SEQ ID NO:840 to SEQ ID NO:968, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:2069 to SEQ ID NO:2941;

[0188] (54) The first gRNA molecule contains a guide domain selected from SEQ ID NO:840 to SEQ ID NO:968, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:5278 to SEQ ID NO:5491;

[0189] (55) The first gRNA molecule contains a guide domain selected from SEQ ID NO:840 to SEQ ID NO:968, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:6227 to SEQ ID NO:6324; or

[0190] (56) The first gRNA molecule contains a guide domain selected from SEQ ID NO:840 to SEQ ID NO:968, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:6325 to SEQ ID NO:6583.

[0191] In the embodiments, including the foregoing cellular aspects and any of the embodiments, the cell further comprises a third gRNA molecule containing a guide domain complementary to a target sequence of a downstream effector of the signaling of an inhibitory molecule or pathway inhibitory molecule, wherein the downstream effector of the signaling of the inhibitory molecule or pathway inhibitory molecule is CD274, HAVCR2, LAG3, PDCD1, PD-L2, CTLA4, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD113), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC Class II, GAL9, adenosine, and TGFβ or PTPN11, for example, the third gRNA molecule is a guide domain containing any of 15(a) to 15(e).

[0192] In embodiments where cells contain gRNA molecules (e.g., more than one gRNA molecule described herein):

[0193] (1) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:2942 to SEQ ID NO:3270;

[0194] (2) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:3271 to SEQ ID NO:3541;

[0195] (3) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:3542 to SEQ ID NO:4032;

[0196] (4) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:4033 to SEQ ID NO:4589 and SEQ ID NO:5720 to SEQ ID NO:5815;

[0197] (5) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5528 to SEQ ID NO:5623 or SEQ ID NO:5816 to SEQ ID NO:5965, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:4590 to SEQ ID NO:5277;

[0198] (6) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5624 to SEQ ID NO:5643 or SEQ ID NO:5966 to SEQ ID NO:6097, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:2942 to SEQ ID NO:3270;

[0199] (7) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5624 to SEQ ID NO:5643 or SEQ ID NO:5966 to SEQ ID NO:6097, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:3271 to SEQ ID NO:3541;

[0200] (8) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5624 to SEQ ID NO:5643 or SEQ ID NO:5966 to SEQ ID NO:6097, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:3542 to SEQ ID NO:4032;

[0201] (9) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5624 to SEQ ID NO:5643 or SEQ ID NO:5966 to SEQ ID NO:6097, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:4033 to SEQ ID NO:4589 and SEQ ID NO:5720 to SEQ ID NO:5815;

[0202] (10) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5624 to SEQ ID NO:5643 or SEQ ID NO:5966 to SEQ ID NO:6097, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:4590 to SEQ ID NO:5277;

[0203] (11) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5644 to SEQ ID NO:5719 or SEQ ID NO:6098 to SEQ ID NO:6226, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:2942 to SEQ ID NO:3270;

[0204] (12) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5644 to SEQ ID NO:5719 or SEQ ID NO:6098 to SEQ ID NO:6226, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:3271 to SEQ ID NO:3541;

[0205] (13) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5644 to SEQ ID NO:5719 or SEQ ID NO:6098 to SEQ ID NO:6226, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:3542 to SEQ ID NO:4032;

[0206] (14) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5644 to SEQ ID NO:5719 or SEQ ID NO:6098 to SEQ ID NO:6226, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:4033 to SEQ ID NO:4589 and SEQ ID NO:5720 to SEQ ID NO:5815;

[0207] (15) The first gRNA molecule contains a guide domain selected from SEQ ID NO:5644 to SEQ ID NO:5719 or SEQ ID NO:6098 to SEQ ID NO:6226, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:4590 to SEQ ID NO:5277;

[0208] (16) The first gRNA molecule contains a guide domain selected from SEQ ID NO:84 to SEQ ID NO:392, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:2942 to SEQ ID NO:3270;

[0209] (17) The first gRNA molecule contains a guide domain selected from SEQ ID NO:84 to SEQ ID NO:392, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:3271 to SEQ ID NO:3541;

[0210] (18) The first gRNA molecule contains a guide domain selected from SEQ ID NO:84 to SEQ ID NO:392, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:3542 to SEQ ID NO:4032;

[0211] (19) The first gRNA molecule contains a guide domain selected from SEQ ID NO:84 to SEQ ID NO:392, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:4033 to SEQ ID NO:4589 and SEQ ID NO:5720 to SEQ ID NO:5815;

[0212] (20) The first gRNA molecule contains a guide domain selected from SEQ ID NO:84 to SEQ ID NO:392, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:4590 to SEQ ID NO:5277;

[0213] (21) The first gRNA molecule contains a guide domain selected from SEQ ID NO:393 to SEQ ID NO:532, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:2942 to SEQ ID NO:3270;

[0214] (22) The first gRNA molecule contains a guide domain selected from SEQ ID NO:393 to SEQ ID NO:532, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:3271 to SEQ ID NO:3541;

[0215] (23) The first gRNA molecule contains a guide domain selected from SEQ ID NO:393 to SEQ ID NO:532, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:3542 to SEQ ID NO:4032;

[0216] (24) The first gRNA molecule contains a guide domain selected from SEQ ID NO:393 to SEQ ID NO:532, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:4033 to SEQ ID NO:4589 and SEQ ID NO:5720 to SEQ ID NO:5815;

[0217] (25) The first gRNA molecule contains a guide domain selected from SEQ ID NO:393 to SEQ ID NO:532, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:4590 to SEQ ID NO:5277;

[0218] (26) The first gRNA molecule contains a guide domain selected from SEQ ID NO:533 to SEQ ID NO:839, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:2942 to SEQ ID NO:3270;

[0219] (27) The first gRNA molecule contains a guide domain selected from SEQ ID NO:533 to SEQ ID NO:839, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:3271 to SEQ ID NO:3541;

[0220] (28) The first gRNA molecule contains a guide domain selected from SEQ ID NO:533 to SEQ ID NO:839, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:3542 to SEQ ID NO:4032;

[0221] (29) The first gRNA molecule contains a guide domain selected from SEQ ID NO:533 to SEQ ID NO:839, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:4033 to SEQ ID NO:4589 and SEQ ID NO:5720 to SEQ ID NO:5815;

[0222] (30) The first gRNA molecule contains a guide domain selected from SEQ ID NO:533 to SEQ ID NO:839, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:4590 to SEQ ID NO:5277;

[0223] (31) The first gRNA molecule contains a guide domain selected from SEQ ID NO:840 to SEQ ID NO:968, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:2942 to SEQ ID NO:3270;

[0224] (32) The first gRNA molecule contains a guide domain selected from SEQ ID NO:840 to SEQ ID NO:968, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:3271 to SEQ ID NO:3541;

[0225] (33) The first gRNA molecule contains a guide domain selected from SEQ ID NO:840 to SEQ ID NO:968, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:3542 to SEQ ID NO:4032;

[0226] (34) The first gRNA molecule contains a guide domain selected from SEQ ID NO:840 to SEQ ID NO:968, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:4033 to SEQ ID NO:4589 and SEQ ID NO:5720 to SEQ ID NO:5815; or

[0227] (35) The first gRNA molecule contains a guide domain selected from SEQ ID NO:840 to SEQ ID NO:968, and the second guide RNA molecule contains a guide domain selected from SEQ ID NO:4590 to SEQ ID NO:5277.

[0228] In the implementation scheme, the guiding domains of the first gRNA molecule, the second gRNA molecule, and (if present) the guiding domain of the third gRNA molecule contain sequences of any of the following, for example, constituted by:

[0229] g) Combinations A1 to A72 in Table 33;

[0230] h) Combinations B1 to B84 in Table 34;

[0231] i) Combinations C1 to C42 in Table 35;

[0232] j) Combinations D1 to D36 in Table 36;

[0233] k) Combinations E1 to E30 in Table 37; or

[0234] l) Combinations F1 to F60 in Table 38.

[0235] In the implementation scheme, the first gRNA molecule contains a guide domain comprising SEQ ID NO:5569, SEQ ID NO:5592 or SEQ ID NO:5586, and the second gRNA molecule contains a guide domain comprising SEQ ID NO:5775.

[0236] In any of the aforementioned cellular aspects and embodiments, genes containing target sequences complementary to the guide domain of a first gRNA molecule, and optionally genes containing target sequences complementary to the guide domain of a second gRNA molecule and / or genes containing target sequences complementary to the guide domain of a third gRNA molecule have been modified in such a way that the expression of the functional product of genes containing target sequences complementary to the guide domain of a first gRNA molecule, and optionally genes containing target sequences complementary to the guide domain of a second gRNA molecule and / or genes containing target sequences complementary to the guide domain of a third gRNA molecule, has been reduced or eliminated.

[0237] In another aspect, the present invention provides a method for providing anti-tumor immunity in a subject, the method comprising administering to the subject an effective amount of cells as described herein, such as cells of any of the foregoing cell aspects and embodiments.

[0238] In another aspect, the present invention provides a method for treating cancer in a subject, the method comprising administering to the subject an effective amount of cells as described herein, such as cells of any of the foregoing cell aspects and embodiments.

[0239] In another aspect, the present invention provides a method for treating a subject suffering from a disease associated with the expression of a tumor antigen, such as a proliferative disease, precancerous symptom, cancer- or non-cancer-related indication associated with the expression of a tumor antigen, the method comprising administering to the subject an effective amount of cells as described herein, such as cells from any of the foregoing cell aspects and embodiments. In the embodiments, the disease associated with the expression of a tumor antigen is a cancer- or non-cancer-related indication. In the implementation plan, the disease is selected from the following cancers: colon cancer, rectal cancer, renal cell carcinoma, liver cancer, non-small cell lung cancer, small bowel cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, malignant melanoma of the skin or eye, uterine cancer, ovarian cancer, rectal cancer, anal cancer, gastric cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, pediatric solid tumors, bladder cancer, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS) tumors, primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancer, combinations of the above cancers, and metastatic lesions of the above cancers. In the implementation plan, cancer is selected from the following hematologic cancers: chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoblastic leukemia (ALL), B-cell acute lymphoblastic leukemia (B-ALL), T-cell acute lymphoblastic leukemia (T-ALL), chronic myeloid leukemia (CML), acute myeloid leukemia (AML), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic tumor, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, spinal dysplasia and myelodystrophy syndrome, non-Hodgkin lymphoma, Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic tumor, Waldenstrom macroglobulinemia, and preleukemia.

[0240] In any of the embodiments of the foregoing methods, the method further includes administration of a chemotherapeutic agent, such as cyclophosphamide, fludarabine, or a combination of cyclophosphamide and fludarabine. In embodiments of the method, the method includes administration of a lymphocyte scavenger or immunosuppressant, followed by administration of an effective amount of cells as described herein, such as cells from any of the foregoing cell aspects and embodiments.

[0241] In another aspect, the present invention provides a method for preparing cells (e.g., cell populations) for immunotherapy, the method comprising: (a) modulating the cells by reducing or eliminating the expression of components of a T cell receptor (TCR), for example, by introducing gRNA molecules (as described herein) into the cells, for example, more than one gRNA molecule of any one of 2b to 2h, for example, the gRNA molecule according to any one of claims 3, 4, 5, 10, 11 or 12, for example, more than one gRNA molecule; (b) modulating the cells by reducing or eliminating the expression of HLA (e.g., HLA-A, HLA-B and / or HLA-C) or B2M, for example, by introducing gRNA molecules (as described herein) of any one of 2a, 2i, 2j or 2k into the cells, for example, more than one gRNA molecule, for example, the gRNA molecule according to any one of claims 6 or 7, for example, more than one gRNA molecule; and (c) expanding the cells. In an implementation, the method further includes regulating the cells by reducing or eliminating CIITA expression, for example by introducing 2p (as described herein) gRNA molecules into the cells, for example, more than one gRNA molecule, for example, the gRNA molecule according to any one of claims 8 or 9, for example, more than one gRNA molecule, wherein the regulation optionally occurs prior to the step of expanding the cells.

[0242] In another aspect, the present invention provides a method for preparing cells (e.g., cell populations) for immunotherapy, the method comprising: (a) modulating the cells by reducing or eliminating the expression of components of a T cell receptor (TCR), for example, by introducing into the cells a gRNA molecule of any one of 2b to 2h (as described herein), for example, more than one gRNA molecule, for example, a gRNA molecule of any one of claims 3, 4, 5, 10, 11 or 12 (as described herein), for example, more than one gRNA molecule; (b) modulating the cells by reducing or eliminating the expression of a target of an immunosuppressant, for example, by introducing into the cells a gRNA molecule of any one of 2l, 2m, 2n or 2o (as described herein), for example, more than one gRNA molecule, for example, a gRNA molecule of any one of claims 13 (as described herein), for example, more than one gRNA molecule; and (c) expanding the cells.

[0243] In any embodiment of any of the foregoing methods for preparing cells, the method further includes (d) regulating the cells by reducing or eliminating the expression of a first inhibitory molecule or a downstream effector that signals via an inhibitory molecule, for example, by introducing the cells with a gRNA molecule as described herein according to claim 14 or 15, for example, more than one gRNA molecule, wherein the regulation optionally occurs prior to the step of expanding the cells.

[0244] In another aspect, the present invention provides a method for preparing cells (e.g., cell populations) for immunotherapy, the method comprising: (a) modulating the cells by reducing or eliminating the expression of a first inhibitory molecule or a downstream effector that signals via the inhibitory molecule, for example, by introducing the cells with a gRNA molecule according to claim 14 (as described herein), for example, more than one gRNA molecule, for example, a gRNA molecule according to any one of claims 15-17, for example, more than one gRNA molecule; and (c) expanding the cells.

[0245] In any of the embodiments of the foregoing cell preparation methods, the method further includes (e) regulating the cells by reducing or eliminating the expression of a second inhibitory molecule or a downstream effector that signals via an inhibitory molecule, for example, by introducing the cells with a gRNA molecule according to claim 14 or 15, for example, more than one gRNA molecule, wherein the first inhibitory molecule or a downstream effector that signals via an inhibitory molecule is different from the second inhibitory molecule or a downstream effector that signals via an inhibitory molecule.

[0246] In any of the embodiments of the foregoing cell preparation methods, each gRNA molecule is introduced simultaneously or sequentially. In the embodiments, the introduction of each gRNA molecule is sequential and spaced at least 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or 10 days apart.

[0247] In any of the embodiments of the foregoing cell preparation methods, the method further includes introducing a nucleic acid encoding a chimeric antigen receptor (CAR), for example, as described herein, into the cell. In one embodiment, the nucleic acid encoding the CAR is disposed on a template nucleic acid. In another embodiment, the nucleic acid encoding the CAR is disposed on an RNA vector. In yet another embodiment, the nucleic acid encoding the CAR is disposed on a lentiviral vector.

[0248] In any of the embodiments of the foregoing cell preparation methods, the method further includes isolating cells that are TCR-negative. In embodiments, the isolation process produces a cell population in which more than about 75%, for example, more than about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% of the cells are TCR-negative. In embodiments, the step of isolating TCR-negative cells includes contacting the cell population with a composition comprising an antibody that specifically binds to a T-cell receptor (TCR) component, optionally to a solid support or a detectable marker, and isolating cells that do not bind to said antibody. In embodiments, the cells are immune effector cells, such as T cells or NK cells, for example, T cells. In embodiments, the cells are allogeneic relative to the subject to whom they are administered, for example, the cells are isolated from a healthy donor, for example, a donor without symptoms associated with tumor antigen expression. In embodiments, the cells are autologous relative to the subject to whom they are administered. In any of the embodiments of the foregoing cell preparation methods, steps (a) and / or (b) are performed in vitro. In an embodiment, step (c) is performed in vitro. In an embodiment, step (c) is extended for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 days, or for 2-15, 2-14, 2-13, 2-12, 2-11, 2-10, 3-10, 2-9, 3-9, 2-8, 3-8, 2-7, 3-7, 2-6, 3-6, 2-5 or 3-5 days.

[0249] In any embodiment of the foregoing cell preparation methods, the gRNA molecule is the gRNA molecule described herein, and (e.g., used in combination) the lead domain of each gRNA molecule comprises, for example, a sequence of any combination listed in Tables 33, 34, 35, 36, 37, or 38. In embodiments, the lead domain of each gRNA molecule comprises, for example, a sequence of any of the following:

[0250] a) Combinations A1 to A72 in Table 33, for example, combinations A1 to A4, combinations A5 to A8, combinations A37 to A40, or combinations A41 to A44;

[0251] b) Combinations B1 to B84 in Table 34;

[0252] c) Combinations C1 to C42 in Table 35;

[0253] d) Combinations D1 to D36 in Table 36, such as combination D2, combination D4, combination D20 or combination D22;

[0254] e) Combinations E1 to E30 in Table 37, for example, combination E2, combination E4, combination E8, or combination E10; or

[0255] f) Combinations F1 to F60 in Table 38, for example, any one of combinations F1 to F4, combinations F5 to F8, combinations F13 to F16, or combinations F17 to F20.

[0256] In another aspect, the present invention provides a method of treating a subject in need, comprising administering cells (e.g., a cell population) prepared by a method of cell preparation described herein (e.g., any of the foregoing aspects and embodiments of the cell preparation method). In embodiments, particularly in embodiments comprising a gRNA molecule that binds to a target sequence of an immunosuppressant, the method further comprises administering an immunosuppressant, such as rapamycin, a rapamycin analog, or an mTor inhibitor, such as RAD001. In embodiments, the subject suffers from a disease associated with tumor antigen expression, such as proliferative disorders, precancerous conditions, cancerous or non-cancer-related indications associated with tumor antigen expression, wherein the administration treats the disease associated with tumor antigen expression. In embodiments, the disease associated with tumor antigen expression is a cancerous or non-cancer-related indication. In the implementation plan, the disease is selected from the following cancers: colon cancer, rectal cancer, renal cell carcinoma, liver cancer, non-small cell lung cancer, small bowel cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, malignant melanoma of the skin or eye, uterine cancer, ovarian cancer, rectal cancer, anal cancer, gastric cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, pediatric solid tumors, bladder cancer, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS) tumors, primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancer, combinations of the above cancers, and metastatic lesions of the above cancers. In the implementation plan, cancer is selected from the following hematologic cancers: chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoblastic leukemia (ALL), B-cell acute lymphoblastic leukemia (B-ALL), T-cell acute lymphoblastic leukemia (T-ALL), chronic myeloid leukemia (CML), acute myeloid leukemia (AML), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic tumor, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, spinal dysplasia and myelodystrophy syndrome, non-Hodgkin lymphoma, Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic tumor, Waldenstrom macroglobulinemia, and preleukemia.

[0257] In another aspect, the present invention provides a method for treating a patient suffering from a disease, the method comprising:

[0258] (a) Providing cell populations from allogeneic donors;

[0259] (b) Introducing a CRISPR system (e.g., the Streptococcus pyogenes Cas9 CRISPR system) containing a first gRNA molecule (or a nucleic acid encoding the gRNA molecule) into a cell, the first gRNA molecule containing a guide domain complementary to a target sequence selected from genes CD247, CD3D, CD3E, CD3G, TRAC, TRBC1 and TRBC2.

[0260] (c) Optionally, select those cells in which functional TCR expression has been reduced or eliminated;

[0261] (d) Transducing cells with nucleic acids encoding CAR; and

[0262] (e) Administering cells to patients in need, such as those with a disease associated with the expression of an antigen that recognizes CAR. In an embodiment, the first gRNA molecule targeting CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, or TRBC2 is a gRNA molecule of any one of claims 2(b)-2(h), for example, a gRNA molecule of any one of claims 3, 4, 5, 10, 11, or 12.

[0263] In an embodiment, the method of treating a patient with a disease further includes introducing a CRISPR system (e.g., the Streptococcus pyogenes Cas9 CRISPR system) containing a second gRNA molecule (or a nucleic acid encoding said gRNA molecule) into cells, the second gRNA molecule containing a guide domain complementary to a target sequence selected from genes of B2M, HLA-A, HLA-B, or HLA-C. In an embodiment, the second gRNA targeting B2M, HLA-A, HLA-B, or HLA-C is a gRNA molecule of any one of 2(a) or 2(i)-2(k), for example, a gRNA molecule of any one of claims 6 or 7. In an embodiment, the method further includes introducing a CRISPR system (e.g., the Streptococcus pyogenes Cas9 CRISPR system) containing a third gRNA molecule (or a nucleic acid encoding said gRNA molecule) into the cell, said third gRNA molecule containing a guide domain complementary to a target sequence selected from genes CIITA, RFXANK, RFXAP, RFX5, HLA-DM, HLA-DO, HLA-DR, HLA-DQ, and HLA-DP. In an embodiment, the third gRNA molecule is a gRNA molecule of any one of 2(a) or 2(i)-2(k), for example, a gRNA molecule of any one of claims 6 or 7.

[0264] In other embodiments, the method of treating a patient with a disease further includes introducing a CRISPR system (e.g., the Streptococcus pyogenes Cas9 CRISPR system) containing a second gRNA molecule (or a nucleic acid encoding said gRNA molecule) into cells, the second gRNA molecule containing a guide domain complementary to a target sequence selected from a gene of DCK, CD52, FKBP1A, or NR3C1. In embodiments, the second gRNA molecule targeting DCK, CD52, FKBP1A, or NR3C1 is any one of 2(l)-2(o), for example, the second gRNA molecule of claim 13. In embodiments where the second gRNA targets DCK, the method further includes administering a nucleoside analog-based drug to the patient, for example, cytarabine or gemcitabine. In embodiments where the second gRNA targets CD52, the method further includes administering an anti-CD52 antibody or an antigen-binding fragment thereof to the patient, for example, an anti-CD52 antibody or an antigen-binding fragment thereof is alenzusab. In an embodiment where the second gRNA targets FKBP1A, the method further includes administering FK506, cyclosporine, rapamycin, or a rapamycin analogue, or an mTor inhibitor such as RAD001 to the patient. In an embodiment where the second gRNA targets NR3C1, the method further includes administering a corticosteroid to the patient, for example, dexamethasone.

[0265] In any embodiment of the foregoing method for treating a patient with a disease, the gRNA molecule is the gRNA molecule described herein, and (e.g., used in combination) the lead domain of each gRNA molecule comprises, for example, a sequence of any combination listed in Tables 33, 34, 35, 36, 37, or 38. In embodiments, the lead domain of each gRNA molecule comprises, for example, a sequence of any of the following:

[0266] a) Combinations A1 to A72 in Table 33, for example, combinations A1 to A4, combinations A5 to A8, combinations A37 to A40, or combinations A41 to A44;

[0267] b) Combinations B1 to B84 in Table 34;

[0268] c) Combinations C1 to C42 in Table 35;

[0269] d) Combinations D1 to D36 in Table 36, such as combination D2, combination D4, combination D20 or combination D22;

[0270] e) Combinations E1 to E30 in Table 37, for example, combination E2, combination E4, combination E8, or combination E10; or

[0271] f) Combinations F1 to F60 in Table 38, for example, any one of combinations F1 to F4, combinations F5 to F8, combinations F13 to F16, or combinations F17 to F20.

[0272] In any of the embodiments of the aforementioned methods for treating a patient with a disease, the method further includes introducing a CRISPR system (e.g., the Streptococcus pyogenes Cas9 CRISPR system) containing a fourth gRNA molecule (or a nucleic acid encoding said gRNA molecule) into cells, said fourth gRNA molecule containing a guide domain complementary to a target sequence selected from the following genes: CD274, HAVCR2, LAG3, PDCD1, PD-L2, CTLA4, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD113), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC Class II, GAL9, adenosine and TGFβ or PTPN11, for example, a fourth gRNA molecule targeting CD274, HAVCR2, LAG3, PDCD1 or PTPN11, for example, a gRNA molecule of any one of 15(a)-(e), for example, a gRNA molecule of any one of claims 16-17.

[0273] In another aspect, the present invention provides a method for treating a patient suffering from a disease, the method comprising:

[0274] (a) Provide (as described herein) cell populations, such as immune effector cells;

[0275] (b) Introducing a CRISPR system (e.g., the Streptococcus pyogenes Cas9 CRISPR system) containing a first gRNA molecule (or a nucleic acid encoding the gRNA molecule) into a cell population, the first gRNA molecule containing a guide domain complementary to a target sequence selected from genes CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, and TRBC2.

[0276] (c) Introducing a CRISPR system (e.g., the Streptococcus pyogenes Cas9 CRISPR system) containing a second gRNA molecule (or a nucleic acid encoding the gRNA molecule) into a cell population, wherein the second gRNA molecule contains a guide domain complementary to a target sequence selected from genes of B2M, HLA-A, HLA-B and HLA-C.

[0277] (d) Optionally, select those cells in which the expression of functional TCR, functional B2M, or both functional TCR and B2M has been reduced or eliminated;

[0278] (d) Introducing nucleic acids encoding CAR into the cell population; and

[0279] (e) Administering the cell population to patients in need, such as those with a disease associated with the expression of the antigen recognized by the CAR. In embodiments of the method, the method further includes (f) introducing the cell population into a CRISPR system (e.g., the Streptococcus pyogenes Cas9 CRISPR system) containing a third gRNA molecule (or a nucleic acid encoding said gRNA molecule), said third gRNA molecule containing a guide domain complementary to a target sequence selected from genes of CIITA, RFXANK, RFX5, and RFXAP. In an embodiment, the first gRNA molecule comprises a guide domain complementary to a target sequence selected from, for example, genes such as TRAC, TRBC1, and TRBC2 (e.g., TRAC) described herein, for example, comprising (e.g., composed of) a sequence selected from SEQ ID NO:5569, SEQ ID NO:5585, SEQ ID NO:5592, SEQ ID NO:5601, SEQ ID NO:5589, SEQ ID NO:5600, SEQ ID NO:5594, SEQ ID NO:5571, SEQ ID NO:5593, SEQ ID NO:5574, SEQ ID NO:5598, SEQ ID NO:5586, SEQ ID NO:5599, SEQ ID NO:5591, SEQ ID NO:5610, SEQ ID NO:5608, SEQ ID NO:5617, SEQ ID NO:5619, and SEQ ID NO:5620, for example, selected from SEQ ID NO:5569, SEQ ID NO:5592, ...93, SEQ ID NO:5594, SEQ ID NO:5598, SEQ ID NO:5586, SEQ ID NO:5599, SEQ ID NO:5591, SEQ ID NO:5610, SEQ ID NO:5608, SEQ ID NO:5617, SEQ ID NO:5619, and SEQ ID NO:5 SEQ ID NO:5587, SEQ ID NO:5599, SEQ ID NO:5600, and SEQ ID NO:5586, for example, guide domains selected from SEQ ID NO:5569, SEQ ID NO:5586, and SEQ ID NO:5592. In other embodiments, the first gRNA molecule includes a guide domain complementary to a target sequence selected from, for example, CD3E, CD3G, and CD3D genes described herein.In an embodiment, the second gRNA molecule includes a guide domain complementary to a target sequence selected from, for example, the B2M gene described herein, for example, including (e.g., composed of) a guide domain selected from SEQ ID NO:5519, SEQ ID NO:5497, SEQ ID NO:5499, SEQ ID NO:5498, SEQ ID NO:5503, SEQ ID NO:5496, SEQ ID NO:5507, SEQ ID NO:5515, SEQ ID NO:5493, SEQ ID NO:5506, SEQ ID NO:5509, SEQ ID NO:5517, SEQ ID NO:5521, SEQ ID NO:5520, SEQ ID NO:5500, SEQ ID NO:5494, SEQ ID NO:5508, SEQ ID NO:5514 and SEQ ID NO:5492, for example, selected from SEQ ID NO:5496, SEQ ID NO:5498 and SEQ ID NO:5509. In an embodiment, the third gRNA molecule includes a guide domain complementary to a target sequence selected from, for example, the CIITA gene described herein, for example, including (e.g., composed of) a guide domain selected from SEQ ID NO:7771, SEQ ID NO:7769, SEQ ID NO:7773, SEQ ID NO:7726, SEQ ID NO:7758, SEQ ID NO:7739, SEQ ID NO:7779, SEQ ID NO:7770, SEQ ID NO:7749, SEQ ID NO:7754, SEQ ID NO:7745, SEQ ID NO:7785, SEQ ID NO:7731, SEQ ID NO:7772, SEQ ID NO:7743, or SEQ ID NO:7750, for example, selected from SEQ ID NO:7769, SEQ ID NO:7771, SEQ ID NO:7739, or SEQ ID NO:7785. In a preferred embodiment, (e.g., used in combination) the lead domain of each gRNA molecule comprises, for example, any combination of sequences listed in Tables 33, 34, or 38. In another embodiment, the lead domain of each gRNA molecule comprises, for example, a sequence of:

[0280] a) Combinations A1 to A72 in Table 33, for example, combinations A1 to A4, combinations A5 to A8, combinations A37 to A40, or combinations A41 to A44;

[0281] b) Combinations B1 to B84 in Table 34; or

[0282] c) Combinations F1 to F60 of Table 38, for example, any one of combinations F1 to F4, combinations F5 to F8, combinations F13 to F16, or combinations F17 to F20.

[0283] In embodiments of a method for treating a patient with a disease, the method further includes introducing a nucleic acid molecule encoding (e.g., as described herein) an NK repressive molecule into the cells, such as a nucleic acid molecule encoding an HLA-G:B2M fusion, or, for example, a nucleic acid molecule encoding SEQ ID NO: 10674. In embodiments of a method for treating a patient with a disease, the cells (or cell populations) are immune effector cells (or immune effector cell populations), such as T cells (or a population of T cells). In embodiments, the cells (or cell populations) are allogeneic relative to the patient, for example, isolated from a healthy human donor. In other embodiments, the cells (or cell populations) are autologous relative to the patient. In embodiments, the CAR is (e.g., as described herein) a CD19 CAR, such as a CD19 CAR containing an antigen-binding domain comprising any one of SEQ ID NO: 7883 to SEQ ID NO: 7898. In other embodiments, the CAR is, for example, a BCMACAR containing an antigen recognition domain comprising any one of SEQ ID NO:7939 to SEQ ID NO:8112 or SEQ ID NO:8155 to SEQ ID NO:8166, for example, containing an antigen recognition domain comprising SEQ ID NO:7949, for example, or comprising any one of SEQ ID NO:8549 to SEQ ID NO:8621, for example, containing SEQ ID NO:8559, for example, or comprising any one of SEQ ID NO:8559.

[0284] In another aspect, the present invention provides modified cells that, relative to unmodified cells of the same type, have reduced or eliminated expression of the following: a) T cell receptor components; b) B2M; and / or c) CIITA. In embodiments, the T cell receptor component is a TCRα chain or a TCRβ chain, for example, a TCRα chain. In other embodiments, the TCR component is CD3δ, CD3ε, or CD3γ, for example, CD3ε. In embodiments, the modified cells (or cell populations) have reduced or eliminated expression of the T cell receptor components B2M and CIITA.

[0285] In another aspect, the present invention provides modified cells that, relative to unmodified cells of the same type, contain, or are near, an insertion or deletion of a base pair (e.g., more than one base pair) at or near: a) a gene encoding a T-cell receptor component; b) B2M; and / or c) CIITA. In embodiments, each of said insertions or deletions is an insertion / deletion. In embodiments, each of said insertions or deletions is a frameshift mutation. In embodiments, the modified cells (or cell populations) contain, or are near, an insertion or deletion of a base pair (e.g., more than one base pair) at or near the genes encoding T-cell receptor components, B2M, and CIITA.

[0286] In another aspect, the present invention provides a cell population comprising modified cells of any of the foregoing cell (e.g., modified cells) aspects and embodiments, wherein in at least about 30% of the cells, at least one of the insertions or deletions is a frameshift mutation, for example, as measured by NGS.

[0287] In another aspect, the present invention provides cells comprising (e.g., a cell population comprising one cell (e.g., more than one cell), said cells comprising):

[0288] (a) For example, a nucleic acid sequence encoding, for example, the CAR described herein;

[0289] (b) Optionally, a nucleic acid sequence encoding, for example, an NK repressor molecule as described herein, such as a nucleic acid encoding an HLA-G or HLA-G:B2M fusion as described herein;

[0290] (c) Insertion / deletion at or near the sequence of a gene encoding a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3E, CD3D, or CD3G, such as TRAC) or its regulatory element, for example, insertion / deletion at or near the target sequence of a gRNA containing a guide domain for a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3E, CD3D, or CD3G, such as TRAC), for example, containing the guide domains listed in Tables 1, 4, 5, 6e, 6f, or 6g;

[0291] (d) Insertion / deletion at or near the sequence of a gene encoding B2M or its regulatory element, for example, insertion / deletion at or near the target sequence of a gRNA containing a guide domain for B2M, for example, a guide domain listed in Table 1 or Table 3.

[0292] (e) Optionally, an insertion / deletion at or near the sequence encoding CIITA in a gene or its regulatory element, for example, an insertion / deletion at or near the target sequence of a gRNA containing a guide domain for CIITA, for example, a guide domain listed in Table 1 or Table 6c; and

[0293] (f) Optionally, an insertion / deletion at or near the sequence encoding LILRB1 or its regulatory element, for example, an insertion / deletion at or near the target sequence of a gRNA containing a guide domain for LILRB1, for example, containing the guide domains listed in Table 6d.

[0294] The cells (or cell populations containing said cells) express CAR and, optionally, NK repressive molecules, and exhibit reduced or eliminated expression and / or function of one or more of the following: i) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC), ii) B2M, iii) CIITA, and / or iv) LILRB1. In embodiments, the guide domain sequences of the gRNA molecules targeting the TCR, B2M, and CIITA components (as described herein) include, for example, the guide domains listed in any combination of Tables 33, 34, or 38, and are composed of, for example, those listed therein.

[0295] a) Combinations A1 to A72 in Table 33, for example, combinations A1 to A4, combinations A5 to A8, combinations A37 to A40, or combinations A41 to A44;

[0296] b) Combinations B1 to B84 in Table 34; or

[0297] c) Combinations F1 to F60 of Table 38, for example, any one of combinations F1 to F4, combinations F5 to F8, combinations F13 to F16, or combinations F17 to F20.

[0298] In another aspect, the present invention provides cells comprising (e.g., a cell population comprising one cell (e.g., more than one cell), said cells comprising):

[0299] (a) Nucleic acid sequences encoding, for example, the CAR described herein;

[0300] (b) Optionally, a nucleic acid sequence encoding (e.g., as described herein) an NK repressive molecule, such as a nucleic acid encoding HLA-G as described herein;

[0301] (c) Insertion / deletion at or near the sequence of a gene encoding a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC) or its regulatory element, for example, insertion / deletion at or near the target sequence of a gRNA containing a guide domain for a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC), for example, containing the guide domains listed in Tables 1, 4, 5, 6e, 6f, or 6g;

[0302] (d) Insertion / deletion at or near the sequence of the gene encoding NLRC5 or its regulatory element, for example, insertion / deletion at or near the target sequence of a gRNA containing a guide domain for NLRC5, for example, containing the guide domains listed in Table 1.

[0303] (e) Optionally, an insertion / deletion at or near the sequence encoding CIITA in a gene or its regulatory element, for example, an insertion / deletion at or near the target sequence of a gRNA containing a guide domain for CIITA, for example, a guide domain listed in Table 1 or Table 6c; and

[0304] (f) Optionally, an insertion / deletion at or near the sequence encoding LILRB1 or its regulatory element, for example, an insertion / deletion at or near the target sequence of a gRNA containing a guide domain for LILRB1, for example, containing the guide domains listed in Table 6d.

[0305] The cells (or cell populations containing one or more of the cells) express CAR and, optionally, NK inhibitory molecules, and exhibit reduced or eliminated expression and / or function of one or more of the following: i) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC), ii) B2M, iii) NLRC5, and / or iv) LILRB1.

[0306] In another aspect, the present invention provides cells comprising (e.g., a cell population comprising one cell (e.g., more than one cell), said cells comprising):

[0307] (a) Nucleic acid sequences encoding, for example, the CAR described herein;

[0308] (b) Insertion / deletion at or near the sequence of a gene encoding a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g., TRAC) or its regulatory element, for example, insertion / deletion at or near the target sequence of a gRNA containing a guide domain targeting a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g., TRAC), for example, containing guide domains listed in Tables 1, 4, 5, 6e, 6f, or 6g; and

[0309] (c) Insertion / deletion at or near the sequence of the gene encoding FKBP1A or its regulatory element, for example, insertion / deletion at or near the target sequence of a gRNA containing a guide domain for FKBP1A, for example, a guide domain listed in Table 1 or Table 6b.

[0310] The cell (or a cell population containing one cell (e.g., more than one cell) contains) expresses a CAR and exhibits reduced or eliminated expression and / or function of one or more of the following: i) a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC) and / or ii) FKBP12. In an embodiment, the guide domain sequence of the gRNA molecule (as described herein) targeting the TCR component and the FKBP1A component includes, for example, the guide domains listed in any combination of those listed in Tables 35, 36, or 37, for example, constitutes thereof.

[0311] a) Combinations C1 to C42 in Table 35;

[0312] b) Combinations D1 to D36 in Table 36, for example, combination D2, combination D4, combination D20, or combination D22; or

[0313] c) Combinations E1 to E30 in Table 37, such as combination E2, combination E4, combination E8 or combination E10.

[0314] In another aspect, the present invention provides cells comprising (e.g., a cell population comprising one cell (e.g., more than one cell), said cells comprising):

[0315] (a) Nucleic acid sequences encoding, for example, the CAR described herein;

[0316] (b) A nucleic acid sequence encoding (e.g., as described herein) a mTor resistant to rapamycin, for example, a nucleic acid sequence encoding an mTor containing an S2035 mutation (e.g., an S2035I mutation); and;

[0317] (c) Insertion / deletion at or near the sequence of a gene encoding a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC) or its regulatory element, for example, insertion / deletion at or near the target sequence of a gRNA containing a guide domain for a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC), for example, containing the guide domains listed in Tables 1, 4, 5, 6e, 6f, or 6g;

[0318] The cells (or cell populations containing said cells, for example, more than one said cell) express CAR and mTor resistant to rapamycin, and show reduced or eliminated expression and / or function of TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC).

[0319] In embodiments where insertions / deletions are included at or near the genes encoding the TCR component, B2M, and CIITA, the guide domains of the gRNA molecules targeting the TCR component, the B2M, and the CIITA respectively comprise a) the guide domain sequences of the gRNA molecules listed in any combination of A1 to A72 in Table 33; b) the guide domain sequences of the gRNA molecules listed in any combination of F1 to F60 in Table 38; or c) the guide domain sequences of each gRNA molecule listed in any combination of B1 to B84 in Table 34, for example, constituted therewith.

[0320] In embodiments where an insertion / deletion is included at or near the gene encoding the TCR component and FKBP1A, the guide domain of the gRNA molecule targeting the TCR component and the guide domain of the gRNA molecule targeting FKBP1A respectively comprise a) the guide domain sequence of the gRNA molecule listed in any combination of C1 to C42 in Table 35; b) the guide domain sequence of the gRNA molecule listed in any combination of D1 to D36 in Table 36; or c) the guide domain sequence of the gRNA molecule listed in any combination of E1 to E30 in Table 37, for example, constituted therewith.

[0321] In any of the cellular aspects and embodiments described above, each of the insertions / deletions is generated in the cell by introducing a gRNA molecule, for example, more than one gRNA molecule (e.g., a CRISPR system containing the gRNA molecules (e.g., each of the more than one gRNA molecule), for example, more than one CRISPR system), each containing a guide domain complementary to the target sequence at or near each of the insertions / deletions.

[0322] In another aspect, the present invention provides a cell population wherein at least about 30%, for example, at least about 50%, for example, at least about 75%, for example, at least about 90% of the cells in the population are cells of any of the foregoing cell aspects or embodiments. In an embodiment, in at least about 30% of the cells (e.g., in at least about 40%, for example, in at least about 50%, for example, in at least about 60%, for example, in at least about 70%, for example, in at least about 80%, for example, in at least about 90%, for example, in at least about 95%, for example, in at least about 99% of the cells), each of the insertions / deletions is a frameshift mutation. In an embodiment, including in any of the foregoing cell aspects and embodiments, the present invention provides cells (or cell populations) containing Figure 34A , Figure 34B or Figure 49 The insertions / deletions are listed in the table. In embodiments, including in any of the foregoing cellular aspects and embodiments, the present invention provides cells (or cell populations) that contain... Figure 36 or Figure 48 The insertions / deletions are listed in the table. In embodiments, including in any of the foregoing cellular aspects and embodiments, the present invention provides cells (or cell populations) that contain... Figure 38 , Figure 41 , Figure 44 or Figure 50 The insertions / deletions are listed in the table. In embodiments, including in any of the foregoing cellular aspects and embodiments, the present invention provides cells (or cell populations) that contain... Figure 53 The insertions / deletions are listed below.

[0323] In another aspect, the present invention provides a cell population comprising cells of any of the foregoing cellular aspects and embodiments. In an embodiment, at least about 20% of the cells in the cell population are cells of any of the foregoing cellular aspects and embodiments. In an embodiment, at least about 50% of the cells in the cell population are cells of any of the foregoing cellular aspects and embodiments. In an embodiment, less than about 5%, for example, less than about 1%, for example, less than about 0.01% of the cells in the cell population contain off-target insertions / deletions. In an embodiment, the cells of the cell population are engineered to express a chimeric antigen receptor (CAR). In an embodiment, the CAR is (e.g., as described herein) a CD19 CAR, for example, a CD19 CAR comprising an antigen-binding domain comprising any one of SEQ ID NO:7883 to SEQ ID NO:7898, or comprising a sequence comprising SEQ ID NO:7909 or SEQ ID NO:7920. In other embodiments, the CAR is, for example, a BCMACAR containing an antigen recognition domain comprising any one of SEQ ID NO:7939 to SEQ ID NO:8112 or SEQ ID NO:8155 to SEQ ID NO:8166, for example, containing an antigen recognition domain comprising SEQ ID NO:7949, for example, or comprising any one of SEQ ID NO:8549 to SEQ ID NO:8621, for example, containing SEQ ID NO:8559, for example, or comprising any one of SEQ ID NO:8559. In embodiments, the cell is an animal cell, for example, a mammalian cell, a primate cell, or a human cell, for example, a human cell. In embodiments, the cell is an immune effector cell (e.g., a population of immune effector cells), for example, T cells or NK cells, for example, T cells, for example, CD4+ T cells, CD8+ T cells, or combinations thereof. In embodiments, the cell is allogeneic relative to the patient to whom the cell is to be administered, for example, the cell is isolated from a healthy human subject. In other embodiments, the cell is autologous relative to the patient to whom the cell is to be administered.

[0324] In another aspect, the present invention provides a method for treating a disease (e.g., cancer) in a patient in need, the method comprising administering cells of any of the foregoing cellular aspects and embodiments. In embodiments, particularly in which the expression or function of a target of an immunosuppressant has been reduced or eliminated, the method further comprises administering an immunosuppressant, such as RAD001.

[0325] In another aspect, the present invention provides gRNA molecules as described herein (e.g., in any of the foregoing gRNA molecules and embodiments), compositions as described herein (e.g., in any of the foregoing compositions and embodiments), nucleic acids as described herein (e.g., in any of the foregoing nucleic acids and embodiments), vectors as described herein (e.g., in any of the foregoing vectors and embodiments), or cells (or cell populations) as described herein (e.g., in any of the foregoing cells (e.g., modified cells) or cell populations and embodiments) for use as pharmaceuticals.

[0326] In another aspect, the present invention provides the use of gRNA molecules as described herein (e.g., in any of the foregoing gRNA molecules and embodiments), compositions as described herein (e.g., in any of the foregoing compositions and embodiments), nucleic acids as described herein (e.g., in any of the foregoing nucleic acids and embodiments), vectors as described herein (e.g., in any of the foregoing vectors and embodiments), or cells (or cell populations) as described herein (e.g., in any of the foregoing cells (e.g., modified cells) or cell populations and embodiments) in the manufacture of pharmaceuticals.

[0327] In another aspect, the present invention provides gRNA molecules as described herein (e.g., in any of the foregoing gRNA molecules and embodiments), compositions as described herein (e.g., in any of the foregoing compositions and embodiments), nucleic acids as described herein (e.g., in any of the foregoing nucleic acids and embodiments), vectors as described herein (e.g., in any of the foregoing vectors and embodiments), or cells (or cell populations) as described herein (e.g., in any of the foregoing cells (e.g., modified cells) or cell populations and embodiments) for the treatment of diseases.

[0328] In another aspect, the present invention provides gRNA molecules as described herein (e.g., in any of the foregoing gRNA molecules and embodiments), compositions as described herein (e.g., in any of the foregoing compositions and embodiments), nucleic acids as described herein (e.g., in any of the foregoing nucleic acids and embodiments), vectors as described herein (e.g., in any of the foregoing vectors and embodiments), or cells (or cell populations) as described herein (e.g., in any of the foregoing cells (e.g., modified cells) or cell populations and embodiments), wherein the disease is a disease associated with tumor antigen expression, such as proliferative diseases associated with tumor antigen expression, precancerous symptoms, cancer and non-cancer related indications.

[0329] In another aspect, the present invention provides gRNA molecules as described herein (e.g., in any of the foregoing gRNA molecule aspects and embodiments), compositions as described herein (e.g., in any of the foregoing compositions and embodiments), nucleic acids as described herein (e.g., in any of the foregoing nucleic acid aspects and embodiments), vectors as described herein (e.g., in any of the foregoing vector aspects and embodiments), or cells (or cell populations) as described herein (e.g., in any of the foregoing cell (e.g., modified cells) or cell populations and embodiments) for the treatment of cancer, wherein the cancer is a hematologic cancer selected from: chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoblastic leukemia (ALL), B-cell... Acute lymphoblastic leukemia (B-ALL), T-cell acute lymphoblastic leukemia (T-ALL), chronic myeloid leukemia (CML), acute myeloid leukemia (AML), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell tumor, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, spinal dysplasia and myelodystrophy syndrome, non-Hodgkin lymphoma, Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell tumor, Waldenstrom macroglobulinemia, and preleukemia.

[0330] In another aspect, the present invention provides gRNA molecules as described herein (e.g., in any of the foregoing gRNA molecule aspects and embodiments), compositions as described herein (e.g., in any of the foregoing compositions and embodiments), nucleic acids as described herein (e.g., in any of the foregoing nucleic acid aspects and embodiments), vectors as described herein (e.g., in any of the foregoing vector aspects and embodiments), or cells (or cell populations) as described herein (e.g., in any of the foregoing cell (e.g., modified cells) or cell population aspects and embodiments) for the treatment of cancer, for example, wherein the cancer is selected from mesothelioma, adenocarcinoma, glioblastoma, colon cancer, rectal cancer, renal cell carcinoma, liver cancer, non-small cell lung cancer, and small bowel cancer. Esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, malignant melanoma of the skin or eye, uterine cancer, ovarian cancer, rectal cancer, anal cancer, stomach cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, endocrine system cancers, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, childhood solid tumors, bladder cancer, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS) tumors, primary CNS lymphoma, tumor angiogenesis, spinal cord tumors, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers, combinations of the above cancers, and metastatic lesions of the above cancers.

[0331] In addition to the specific features of the invention described above, the following general features of gRNA molecules, Cas9 molecules, and cells are conceived to apply to any aspect and embodiment of the invention described herein, including those aspects and embodiments described above.

[0332] In any aspect and embodiment disclosed herein, a gRNA molecule (e.g., a gRNA molecule, or a combination of gRNA molecules, including the guide domain described herein) may include one or more of the following features:

[0333] In some embodiments, the gRNA molecule (e.g., a single gRNA molecule, or a combination of gRNA molecules including the guide domain described herein) is a dgRNA molecule, wherein the guide domain and tracr are disposed on separate nucleic acid molecules. In embodiments, the crRNA contains [guide domain] from 5' to 3':

[0334] a)SEQ ID NO:6584;

[0335] b)SEQ ID NO:6585;

[0336] c)SEQ ID NO:6605;

[0337] d)SEQ ID NO:6606;

[0338] e)SEQ ID NO:6607;

[0339] f)SEQ ID NO:6608; or

[0340] g) SEQ ID NO:7806. In a preferred embodiment, the crRNA comprises a [guide domain]-[SEQ ID NO:6607] from 5' to 3'. In an embodiment, tracr comprises more than 15, for example, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 70 or more, or 80 or more nucleotides of the Streptococcus pyogenes tracr sequence (GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC). In an embodiment, tracr additionally comprises one or more, for example, 1, 2, 3, 4, 5, 6, or 7, for example, preferably 4 or 7 U nucleotides at the 3' end. In a preferred dgRNA embodiment, tracr comprises SEQ ID NO:7820. In embodiments, tracr additionally includes one or more, for example, 1, 2, 3, 4, 5, 6, or 7, for example, 4 or 7 U nucleotides at its 3' end. In a preferred dgRNA embodiment, tracr comprises, for example, SEQ ID NO: 6660. In a preferred dgRNA embodiment, crRNA comprises, for example, a [guide domain]-SEQ ID NO: 6607, and tracr comprises, for example, SEQ ID NO: 7820, and for example, comprises, for example, SEQ ID NO: 6660.

[0341] In other embodiments, the gRNA molecule (e.g., one or more gRNA molecules, including the guidance domain described herein, such as a gRNA molecule or a combination of gRNA molecules) is an sgRNA molecule, wherein the guidance domain and tracr are disposed on a single nucleic acid molecule. In embodiments, the sgRNA molecule comprises, for example, the following: [guidance domain] -

[0342] (a)SEQ ID NO:6601;

[0343] (b)SEQ ID NO:6602;

[0344] (c)SEQ ID NO:6603;

[0345] (d)SEQ ID NO:6604; or

[0346] (e) Any of (a) to (d) above, further comprising 1, 2, 3, 4, 5, 6, or 7 uracil (U) nucleotides at the 3' end. In a preferred embodiment, the sgRNA molecule comprises a [guide domain] - SEQ ID NO: 6601. In a preferred embodiment, the sgRNA molecule comprises, for example, a [guide domain] - SEQ ID NO: 7811.

[0347] In embodiments, including any of the foregoing aspects and embodiments, one or more nucleic acid molecules of the gRNA molecule described herein, for example, all nucleic acid molecules of the gRNA molecule described herein, do not contain any alterations to nucleotides or internucleotide bonds. In other embodiments, including any of the foregoing aspects and embodiments, one or more nucleic acid molecules of the gRNA molecule described herein contain one or more modifications to, for example, the nucleotides or internucleotide bonds described herein. In embodiments, the modification includes a 2'O-methyl modification. In embodiments, the modification includes a phosphate thioate modification. In embodiments, the modification includes a 2'O-methyl modification at each of 1, 2, 3 or more (e.g., 3) 3' nucleotides of the nucleic acid of the gRNA molecule. In embodiments, the modification includes a 2'O-methyl modification at each of the fourth, third, and second-to-last 3' nucleotides of the nucleic acid of the gRNA molecule. In embodiments, the modification includes a 2'O-methyl alteration at each of 1, 2, 3 or more (e.g., 3) 5' nucleotides of the nucleic acid of the gRNA molecule. In embodiments, the modification includes 2'O-methyl modifications at the 4th, 3rd, and 2nd to 5th nucleotides of the gRNA molecule, respectively, and 2'O-methyl modifications at 1, 2, 3, or more (e.g., 3) 5' nucleotides of the gRNA molecule. In embodiments, the modification includes one or more, for example, 1, 2, 3, or more, e.g., 3 phosphate-thioester bonds at the 3' end of the gRNA molecule. In embodiments, the modification includes one or more, for example, 1, 2, 3, or more, e.g., 3 phosphate-thioester bonds at the 5' end of the gRNA molecule. In embodiments, the modification includes one or more, for example, 1, 2, 3, or more, e.g., 3 phosphate-thioester bonds at the 3' end and 5' end of the gRNA molecule. In embodiments involving dgRNA molecules, molecules containing tracr and molecules containing crRNA are modified as described herein. In other embodiments involving dgRNA molecules, molecules containing tracr are unmodified and molecules containing crRNA are modified as described herein. In other embodiments involving dgRNA molecules, the molecule containing crRNA is unmodified and the molecule containing tracr is modified as described herein.

[0348] In embodiments of the present invention comprising more than one type of gRNA molecule, each gRNA molecule may independently be, for example, a dgRNA molecule or an sgRNA molecule as described herein. In embodiments, all gRNA molecules in the combinations described herein are dgRNA molecules. In embodiments, all gRNA molecules in the combinations described herein are sgRNA molecules. In embodiments, one or more gRNA molecules in the combinations described herein are dgRNA molecules, and one or more other gRNA molecules in the combinations described herein are sgRNA molecules.

[0349] In embodiments, the gRNA molecules of the present invention are gRNA molecules that generate insertion / deletion at or near the target sequence of the gRNA when introduced into the cells described herein. In embodiments, the gRNA molecules of the present invention generate insertion / deletion gRNA molecules in at least about 70%, for example, at least about 80%, for example, at least about 90%, for example, at least about 95%, for example, at least about 96%, for example, at least about 97%, for example, at least about 98%, for example, at least about 99% or more of the cell population (e.g., the cells described herein) in which the gRNA molecules are introduced. In embodiments, the insertion / deletion frequency is measured by, for example, NGS as described herein. In embodiments, the insertion / deletion or multiple insertions / deletions are or include frameshift mutations. In embodiments, the gRNA molecules of the present invention are generated in at least about 30%, for example, at least about 40%, for example, at least about 50%, for example, at least about 60%, for example, at least about 70%, for example, at least about 75%, for example, at least about 80%, for example, at least about 85%, for example, at least about 90%, for example, at least about 95% or more of the cells in which the gRNA molecules are introduced, for example, as described herein. In embodiments, the frameshift mutation frequency is measured by, for example, NGS as described herein. In embodiments, the insertion / deletion, insertion / deletion frequency, frameshift mutation, and / or frameshift mutation frequency are measured in cells (or populations or cells) after the gRNA molecules are introduced as RNPs having the Cas9 molecules described herein. In embodiments, the insertion / deletion, insertion / deletion frequency, frameshift mutation, and / or frameshift mutation frequency are measured in cells (or populations or cells) after the gRNA molecules are introduced by electroporation.

[0350] In embodiments, the gRNA molecules of the present invention, when introduced into cells or cell populations as described herein, produce insertion / deletion gRNA molecules at off-target sites at a frequency at or near the target sequence of the gRNA that is at least 50-fold, for example, at least 100-fold, for example, at least 1000-fold lower. In a preferred embodiment, when introduced into cells or cell populations as described herein, the gRNA does not produce detectable insertions / deletions at any off-target sites. In embodiments, off-target insertion / deletion analysis is measured by, for example, targeted off-target sequencing of predicted off-target binding sites as described herein. In embodiments, off-target insertion / deletion analysis is measured by, for example, nucleotide insertion analysis as described herein. In embodiments, off-target analysis is measured in cells (or populations or cells) after the gRNA molecules are introduced as RNPs having the Cas9 molecule as described herein. In embodiments, off-target analysis is measured in cells (or populations or cells) after the gRNA molecules are introduced via electroporation.

[0351] In one embodiment, RNPs or combinations of RNPs are delivered to cells via a single electroporation step. In another embodiment, the cells of the present invention undergo only a single electroporation step.

[0352] In aspects and embodiments of the invention that include combinations of gRNA molecules, each gRNA molecule in the combination may independently contain any of the foregoing features.

[0353] In any aspect and implementation disclosed herein, the Cas9 molecule may include one or more of the following features:

[0354] In several aspects, the Cas9 molecule is *Streptococcus pyogenes* Cas9, for example, modified or unmodified *Streptococcus pyogenes* Cas9 molecules as described herein. In embodiments, the Cas9 molecule comprises SEQ ID NO: 6611. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7821, for example, constitutes thereof. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7822, for example, constitutes thereof. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7823, for example, constitutes thereof. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7824, for example, constitutes thereof. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7825, for example, constitutes thereof. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7826, for example, constitutes thereof. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7827, for example, constitutes thereof. In other embodiments, the Cas9 molecule comprises SEQ ID NO: 7828, for example, constitutes thereof. In other embodiments, the Cas9 molecule comprises, for example, SEQ ID NO:7829. In other embodiments, the Cas9 molecule comprises, for example, SEQ ID NO:7830. In other embodiments, the Cas9 molecule comprises, for example, SEQ ID NO:7831. Preferred Cas9 molecules are those comprising, for example, SEQ ID NO:7821, SEQ ID NO:7822, SEQ ID NO:7825, and SEQ ID NO:7828.

[0355] In aspects and embodiments comprising one or more RNP complexes (e.g., one or more RNP complexes including the Cas9 molecule described herein), each of the RNP complexes is at a concentration of less than about 10 μM, for example, less than about 3 μM, for example, less than about 1 μM, for example, less than about 0.5 μM, for example, less than about 0.3 μM, for example, less than about 0.1 μM. In embodiments, the concentration is the concentration of RNP complexes in the composition comprising, for example, cells (e.g., cell populations) to be introduced with RNPs via electroporation, for example, as described herein. In embodiments, the matrix of the composition is adapted for electroporation.

[0356] In aspects and embodiments of the invention that include combinations of gRNA molecules (e.g., combinations of RNPs containing different gRNA molecules), each Cas9 molecule in the combination may independently contain any of the foregoing features.

[0357] In any aspect and implementation disclosed herein, a cell (e.g., a cell population) may include one or more of the following characteristics:

[0358] In several aspects, cells (e.g., cell populations) comprise one or more cells having reduced or eliminated expression of T-cell receptor (TCR) components. In one embodiment, reduced or eliminated T-cell receptor (TCR) component expression includes reduced or eliminated TRAC expression. In one embodiment, reduced or eliminated T-cell receptor (TCR) component expression includes reduced or eliminated TRBC1 expression. In one embodiment, reduced or eliminated T-cell receptor (TCR) component expression includes reduced or eliminated TRBC2 expression. In one embodiment, reduced or eliminated T-cell receptor (TCR) component expression includes reduced or eliminated CD3G expression. In one embodiment, reduced or eliminated T-cell receptor (TCR) component expression includes reduced or eliminated CD3D expression. In one embodiment, reduced or eliminated T-cell receptor (TCR) component expression includes reduced or eliminated CD3E expression. In one embodiment, the reduced or eliminated expression of the TCR component is a result of introducing one or more, for example, one or both, of the present invention, such as a gRNA molecule targeting the TCR component, into the cells. In one embodiment, the cells contain insertions / deletions, such as frameshift mutations, as described herein, at or near the target sequence of the guide domain of the gRNA molecule targeting the TCR component. In another embodiment, the cell population comprises at least about 50%, for example, at least about 60%, for example, at least about 70%, for example, at least about 80%, for example, at least about 90% or more of cells exhibiting reduced or eliminated expression of the TCR component (as described herein). In yet another embodiment, the reduced or eliminated TCR component expression is measured, for example, by flow cytometry as described herein.

[0359] In several respects, a cell population (e.g., a cell population containing alternatively or additionally reduced or eliminated expression of TCR components) comprises one or more cells with reduced or eliminated expression of β-2 microglobulin (B2M). In an embodiment, the reduced or eliminated expression of said B2M is a result of introducing one or more, for example, one or both, gRNA molecules targeting B2M as described herein into said cells. In an embodiment, the cells contain insertions / deletions, for example, frameshift mutations, as described herein, at or near the target sequence of the guide domain of the gRNA molecule targeting said B2M. In an embodiment, the cell population comprises at least about 50%, for example, at least about 60%, for example, at least about 70%, for example, at least about 80%, for example, at least about 90% or more of cells showing reduced or eliminated B2M expression (as described herein). In an embodiment, said reduced or eliminated B2M expression is measured by, for example, flow cytometry as described herein.

[0360] In several respects, a cell population (e.g., a cell population) containing alternatively or additionally reduced or eliminated expression of TCR and / or B2M components comprises one or more cells with reduced or eliminated CIITA expression. In an embodiment, the reduced or eliminated expression of CIITA is a result of introducing one or more, for example, one or both, gRNA molecules targeting CIITA into the cells. In an embodiment, the cells contain insertions / deletions, for example, frameshift mutations, as described herein, at or near the target sequence of the guide domain of the gRNA molecule targeting CIITA. In an embodiment, the cell population comprises at least about 50%, for example, at least about 60%, for example, at least about 70%, for example, at least about 80%, for example, at least about 90% or more cells showing reduced or eliminated CIITA expression (as described herein). In an embodiment, the reduced or eliminated B2M expression is measured, for example, by flow cytometry as described herein.

[0361] In several aspects, a cell population (e.g., a cell population containing alternatively or additionally reduced or eliminated expression of a TCR component) comprises one or more cells expressing a target (e.g., FKBP1A) of an immunosuppressant. In an embodiment, the reduced or eliminated expression of FKBP1A is a result of introducing one or more, for example, one or both, gRNA molecules targeting FKBP1A as described herein into the cells. In an embodiment, the cells contain insertions / deletions, for example, frameshift mutations, as described herein, at or near the target sequence of the guide domain of the gRNA molecule targeting FKBP1A. In an embodiment, the cell population comprises at least about 50%, for example, at least about 60%, for example, at least about 70%, for example, at least about 80%, for example, at least about 90% or more cells exhibiting reduced or eliminated FKBP1A expression (as described herein). In an embodiment, the reduced or eliminated FKBP1A expression is measured, for example, by flow cytometry as described herein.

[0362] In some aspects, it is necessary for cells to exhibit reduced or eliminated expression of more than one gene. In one aspect, cells exhibit reduced or eliminated expression of TCR components (e.g., TRAC, TRBC1, TRBC2, CD3E, CD3G, and / or CD3D), reduced or eliminated B2M expression, and reduced or eliminated CIITA expression. In one embodiment, reduced or eliminated expression is generated by introducing a combination of gRNA molecules into the cells, wherein the gRNA molecule combination contains a guide domain sequence listed in any of combinations A1 to A72. In another embodiment, reduced or eliminated expression is generated by introducing a combination of gRNA molecules into the cells, wherein the gRNA molecule combination contains a guide domain sequence listed in any of combinations B1 to B84. In yet another embodiment, the cells contain an insertion / deletion, e.g., a frameshift mutation, at or near the target sequence of the guide domain of each gRNA molecule listed in Tables 33, 34, or 38 (e.g., gRNA molecules in any of combinations A1 to A72, B1 to B84, or F1 to F60).

[0363] In some aspects, it is necessary for cells to exhibit reduced or eliminated expression of more than one gene. In one aspect, cells exhibit reduced or eliminated expression of TCR components (e.g., TRAC, TRBC1, TRBC2, CD3E, CD3G, and / or CD3D) and reduced or eliminated expression of targets of immunosuppressants (e.g., FKBP1A). In one embodiment, reduced or eliminated expression is achieved by introducing a combination of gRNA molecules into the cells, wherein the gRNA molecule combination contains a guide domain sequence listed in any one of combinations C1 to C42. In another embodiment, reduced or eliminated expression is achieved by introducing a combination of gRNA molecules into the cells, wherein the gRNA molecule combination contains a guide domain sequence listed in any one of combinations D1 to D36. In an embodiment, the cell contains an insertion / deletion, such as a frameshift mutation, at or near the target sequence of the guide domain of each gRNA molecule listed in Tables 35, 36, or 37 (e.g., gRNA molecules in any combination of C1 to C42, D1 to D36, or E1 to E30).

[0364] In a preferred embodiment where the intention is to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and B2M) (including embodiments where the expression or function of additional targets (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from SEQ ID NO:7833, SEQ ID NO:7834, SEQ ID NO:7835, dgRNA comprising SEQ ID NO:7836 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7837 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7836 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7837 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting B2M is selected from SEQ ID NO:7853, SEQ ID NO:7854, SEQ ID NO:7835, SEQ ID NO:7836, SEQ ID NO:7835, SEQ ID NO:7836, SEQ ID NO:7837, SEQ ID NO:7838 ... dgRNAs comprising SEQ ID NO:7855, SEQ ID NO:7856 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7857 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7856 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7857 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0365] In a preferred embodiment where the intention is to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and B2M) (including embodiments where the expression or function of additional targets (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from SEQ ID NO:7833, SEQ ID NO:7834, SEQ ID NO:7835, dgRNA comprising SEQ ID NO:7836 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7837 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7836 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7837 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting B2M is selected from SEQ ID NO:7858, SEQ ID NO:7859, SEQ ID NO:7833, SEQ ID NO:7834, SEQ ID NO:7835, SEQ ID NO:7835, SEQ ID NO:7836, SEQ ID NO:7837, SEQ ID NO:7838, SEQ ID NO:7839 ... dgRNAs comprising SEQ ID NO:7860, SEQ ID NO:7861 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7862 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7861 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7862 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0366] In a preferred embodiment where the intention is to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and B2M) (including embodiments where the expression or function of additional targets (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from SEQ ID NO:7838, SEQ ID NO:7839, SEQ ID NO:7840, dgRNA comprising SEQ ID NO:7841 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7842 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7841 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7842 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting B2M is selected from SEQ ID NO:7853, SEQ ID NO:7854, SEQ ID NO:7855, SEQ ID NO:7856, SEQ ID NO:7838, SEQ ID NO:7840, SEQ ID NO:7840, SEQ ID NO:7841, SEQ ID NO:7842, SEQ ID NO:7843, SEQ ID NO:7854, SEQ ID NO:7845 ... dgRNAs comprising SEQ ID NO:7855, SEQ ID NO:7856 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7857 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7856 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7857 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0367] In a preferred embodiment where the intention is to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and B2M) (including embodiments where the expression or function of additional targets (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from SEQ ID NO:7838, SEQ ID NO:7839, SEQ ID NO:7840, dgRNA comprising SEQ ID NO:7841 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7842 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7841 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7842 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting B2M is selected from SEQ ID NO:7858, SEQ ID NO:7859, SEQ ID NO:7840, SEQ ID NO:7840, SEQ ID NO:7841, SEQ ID NO:7842, SEQ ID NO:7843 ... dgRNAs comprising SEQ ID NO:7860, SEQ ID NO:7861 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7862 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7861 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7862 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0368] In a preferred embodiment intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and B2M) (including embodiments where the expression or function of additional targets (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from SEQ ID NO:7843, SEQ ID NO:7844, SEQ ID NO:7845, dgRNA comprising SEQ ID NO:7846 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7847 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7846 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7847 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting B2M is selected from SEQ ID NO:7853, SEQ ID NO:7854, SEQ ID NO:7845, SEQ ID NO:7846, SEQ ID NO:7845, SEQ ID NO:7846, SEQ ID NO:7847, SEQ ID NO:7848, SEQ ID NO:7845, SEQ ID NO:7846, SEQ ID NO:7847, SEQ ID NO:7848, SEQ ID NO:7845, SEQ ID NO:7846, SEQ ID NO:7847, SEQ ID NO:7848, SEQ ID NO:7848, SEQ ID NO:7849 ... dgRNAs comprising SEQ ID NO:7855, SEQ ID NO:7856 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7857 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7856 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7857 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0369] In a preferred embodiment intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and B2M) (including embodiments where the expression or function of additional targets (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from SEQ ID NO:7843, SEQ ID NO:7844, SEQ ID NO:7845, dgRNA comprising SEQ ID NO:7846 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7847 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7846 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7847 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting B2M is selected from SEQ ID NO:7858, SEQ ID NO:7859, SEQ ID NO:7843, SEQ ID NO:7844, SEQ ID NO:7845, SEQ ID NO:7846, SEQ ID NO:7845, SEQ ID NO:7846, SEQ ID NO:7847, SEQ ID NO:7848, SEQ ID NO:7849, SEQ ID NO:7846, SEQ ID NO:7847, SEQ ID NO:7848, SEQ ID NO:7849, SEQ ID NO:7848, SEQ ID NO:7849, SEQ ID NO:7848, SEQ ID NO:7849, SEQ ID NO:7849, SEQ ID NO:7849, SEQ ID NO:7849, SEQ ID NO:7849, SEQ ID NO:7849, SEQ ID NO:7849, SEQ dgRNAs comprising SEQ ID NO:7860, SEQ ID NO:7861 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7862 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7861 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7862 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0370] In a preferred embodiment intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and B2M) (including embodiments where the expression or function of additional targets (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from SEQ ID NO:7848, SEQ ID NO:7849, SEQ ID NO:7850, dgRNA comprising SEQ ID NO:7851 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7852 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7851 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7852 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting B2M is selected from SEQ ID NO:7853, SEQ ID NO:7854, SEQ ID NO:785 ... dgRNAs comprising SEQ ID NO:7855, SEQ ID NO:7856 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7857 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7856 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7857 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0371] In a preferred embodiment intended to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and B2M) (including embodiments where the expression or function of additional targets (e.g., more than one additional target, e.g., CIITA) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from SEQ ID NO:7848, SEQ ID NO:7849, SEQ ID NO:7850, dgRNA comprising SEQ ID NO:7851 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7852 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7851 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7852 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting B2M is selected from SEQ ID NO:7858, SEQ ID NO:7859, SEQ ID NO:7848, SEQ ID NO:7859, SEQ ID NO:7848, SEQ ID NO:7850, SEQ ID NO:7849, SEQ ID NO:7850, SEQ ID NO:7850, SEQ ID NO:7851 ... dgRNAs comprising SEQ ID NO:7860, SEQ ID NO:7861 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7862 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7861 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7862 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0372] In a preferred embodiment where the intention is to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from SEQ ID NO:7833, SEQ ID NO:7834, SEQ ID NO:7835, dgRNA comprising SEQ ID NO:7836 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7837 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7836 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7837 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting FKBP1A is selected from SEQ ID NO:7863, SEQ ID NO:7864, SEQ ID NO:7835, SEQ ID NO:7836, SEQ ID NO:7835, SEQ ID NO:7836, SEQ ID NO:7837, SEQ ID NO:7838 ... dgRNAs comprising SEQ ID NO:7865, SEQ ID NO:7866 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7867 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7866 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7867 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0373] In a preferred embodiment where the intention is to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from SEQ ID NO:7833, SEQ ID NO:7834, SEQ ID NO:7835, dgRNA comprising SEQ ID NO:7836 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7837 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7836 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7837 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting FKBP1A is selected from SEQ ID NO:7868, SEQ ID NO:7869, SEQ ID NO:7834, SEQ ID NO:7835, SEQ ID NO:7836, SEQ ID NO:7835, SEQ ID NO:7836, SEQ ID NO:7837, SEQ ID NO:7838, SEQ ID NO:7839 ... dgRNAs comprising SEQ ID NO:7870, SEQ ID NO:7871 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7872 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7871 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7872 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0374] In a preferred embodiment where the intention is to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from SEQ ID NO:7838, SEQ ID NO:7839, SEQ ID NO:7840, dgRNA comprising SEQ ID NO:7841 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7842 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7841 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7842 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting FKBP1A is selected from SEQ ID NO:7863, SEQ ID NO:7864, SEQ ID NO:7865, SEQ ID NO:786 ... dgRNAs comprising SEQ ID NO:7865, SEQ ID NO:7866 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7867 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7866 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7867 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0375] In a preferred embodiment where the intention is to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRAC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRAC is selected from SEQ ID NO:7838, SEQ ID NO:7839, SEQ ID NO:7840, dgRNA comprising SEQ ID NO:7841 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7842 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7841 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7842 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting FKBP1A is selected from SEQ ID NO:7868, SEQ ID NO:7869, SEQ ID NO:7840, SEQ ID NO:7841, SEQ ID NO:7842, SEQ ID NO:7843, SEQ ID NO:7843, SEQ ID NO:7840, SEQ ID NO:7843 ... dgRNAs comprising SEQ ID NO:7870, SEQ ID NO:7871 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7872 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7871 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7872 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0376] In a preferred embodiment where the intention is to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from SEQ ID NO:7843, SEQ ID NO:7844, SEQ ID NO:7845, dgRNA comprising SEQ ID NO:7846 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7847 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7846 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7847 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting FKBP1A is selected from SEQ ID NO:7863, SEQ ID NO:7864, SEQ ID NO:7845, SEQ ID NO:7846, SEQ ID NO:7846, SEQ ID NO:7847, SEQ ID NO:7848, SEQ ID NO:7849 ... dgRNAs comprising SEQ ID NO:7865, SEQ ID NO:7866 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7867 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7866 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7867 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0377] In a preferred embodiment where the intention is to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from SEQ ID NO:7843, SEQ ID NO:7844, SEQ ID NO:7845, dgRNA comprising SEQ ID NO:7846 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7847 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7846 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7847 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting FKBP1A is selected from SEQ ID NO:7868, SEQ ID NO:7869, SEQ ID NO:7843, SEQ ID NO:7844, SEQ ID NO:7845, ...SEQ ID NO:7846, SEQ ID NO:7844, SEQ ID NO:7845, SEQ ID NO:7846, SEQ ID NO:7844, SEQ ID NO:7845, SEQ ID NO:7846, dgRNAs comprising SEQ ID NO:7870, SEQ ID NO:7871 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7872 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7871 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7872 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0378] In a preferred embodiment where the intention is to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from SEQ ID NO:7848, SEQ ID NO:7849, SEQ ID NO:7850, dgRNA comprising SEQ ID NO:7851 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7852 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7851 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7852 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting FKBP1A is selected from SEQ ID NO:7863, SEQ ID NO:7864, SEQ ID NO:7865, SEQ ID NO:7866, SEQ ID NO:7848, SEQ ID NO:7850, ...0, SEQ ID NO:7851 and SEQ ID NO:10798 (e.g., composed thereof), and the dgRNA molecule targeting FKBP1A is selected dgRNAs comprising SEQ ID NO:7865, SEQ ID NO:7866 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7867 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7866 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7867 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0379] In a preferred embodiment where the intention is to reduce or eliminate the expression of two components of the T cell receptor (e.g., TRBC and FKBP1A) (including embodiments where the expression or function of additional targets (e.g., more than one additional target) is also reduced or eliminated), the gRNA molecule targeting TRBC is selected from SEQ ID NO:7848, SEQ ID NO:7849, SEQ ID NO:7850, dgRNA comprising SEQ ID NO:7851 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7852 and SEQ ID NO:6660 (e.g., composed thereof), dgRNA comprising SEQ ID NO:7851 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNA comprising SEQ ID NO:7852 and SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting FKBP1A is selected from SEQ ID NO:7868, SEQ ID NO:7869, SEQ ID NO:7848, SEQ ID NO:7849, SEQ ID NO:7850, SEQ ID NO:7851, SEQ ID NO:7850, SEQ ID NO:7851, SEQ ID NO:7850, SEQ ID NO:7850, SEQ ID NO:7851, SEQ ID NO:7852, SEQ ID NO:7852, SEQ ID NO:7852, SEQ ID NO:10798 (e.g., composed thereof), and the gRNA molecule targeting FKBP1A is selected from SEQ ID NO:7868, SEQ ID NO:7869, SEQ ID NO:7850, SEQ ID NO:7851, SEQ ID NO:7852, SEQ ID NO:7852, SEQ ID NO:7852, SEQ ID NO:7852, dgRNAs comprising SEQ ID NO:7870, SEQ ID NO:7871 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7872 and SEQ ID NO:6660 (e.g., composed thereof), dgRNAs comprising SEQ ID NO:7871 and SEQ ID NO:10798 (e.g., composed thereof), and dgRNAs comprising SEQ ID NO:7872 and SEQ ID NO:10798 (e.g., composed thereof). As described herein, in any combined embodiment, each of the said gRNA molecules is provided as an RNP having a Cas9 molecule (e.g., the Cas9 molecule described herein).

[0380] In one aspect, the cell exhibits reduced or eliminated expression of only one TCR component (though it may exhibit reduced or eliminated expression of one or more other targets that are not TCR components). In an embodiment, the cell contains insertions / deletions at or near target sequences within a single gene (or its regulatory element) that is a TCR component (though the cell may contain insertions / deletions at or near target sequences within one or more additional genes (or their regulatory elements) that are not TCR components). Therefore, in an embodiment, the cell does not contain insertions / deletions within more than one gene that is a TCR component. In an embodiment, the cell does not contain insertions / deletions within TRAC and within genes encoding a second TCR component (e.g., TRBC1 or TRBC2).

[0381] In one aspect, the cell does not exhibit reduced or eliminated expression of genes containing target sequences of repressive molecules or downstream effectors that signal via repressive molecules (though it may exhibit reduced or eliminated expression of one or more other genes). In an embodiment, the cell does not contain insertions / deletions at or near target sequences in genes (or regulatory elements thereof) containing repressive molecules or downstream effectors that signal via repressive molecules (though it may contain insertions / deletions in one or more other genes (or regulatory elements thereof). In an embodiment, the cell does not contain insertions / deletions within PDCD1 or its regulatory elements.

[0382] In many respects, the cell is an animal cell, such as a mammalian cell, a primate cell, or a human cell, such as a human cell. In many respects, the cell is an immune effector cell (e.g., a cell population containing one or more immune effector cells), such as a T cell or NK cell, such as a CD4+ T cell, a CD8+ T cell, or a combination thereof.

[0383] In several respects, the cells are autologous to the patient to whom the cells are to be administered. In other respects, the cells are allogeneic to the patient to whom the cells are to be administered. In one embodiment, the cells are allogeneic to the patient to whom the cells are to be administered and are induced pluripotent stem cells or cells derived therefrom. In another embodiment, the cells are allogeneic to the patient to whom the cells are to be administered and are immune effector cells, such as T cells, isolated from a healthy human donor.

[0384] In several aspects, for example, cells (or cell populations) such as those described herein are regulated and / or altered in vitro by the methods described herein, such as cells expressing CAR as described herein. In several aspects, for example, cells (or cell populations) such as those described herein are regulated and / or altered in vitro by the methods described herein, such as cells expressing CAR as described herein. In several aspects, the CRISPR system of the present invention, gRNA molecules (including those in an RNP complex having a Cas9 molecule as described herein), and / or compositions (e.g., compositions containing more than one gRNA molecule of the present invention) are introduced in vitro into cells such as those described herein, such as cells expressing CAR as described herein. In other aspects, the CRISPR system of the present invention, gRNA molecules (including those in an RNP complex having a Cas9 molecule as described herein), and / or compositions (e.g., compositions containing more than one gRNA molecule of the present invention) are introduced in vivo into cells such as those described herein, such as cells expressing CAR as described herein.

[0385] In several respects, as described herein, cells have been, are, or will be engineered to express chimeric antigen receptors (CARs) (e.g., cells contain, or will contain, a nucleic acid sequence encoding a CAR). In embodiments, such as those described herein, the CAR recognizes antigens selected from: CD19; CD123; CD22; CD30; CD171; CS-1 (also known as CD2 subclass 1, CRACC, SLAMF7, CD319, and 19A24); C-type lectin-like molecule-1 (CLL-1 or CLECL1); CD33; epidermal growth factor receptor variant III (EGFRvIII); ganglioside G2 (GD2); ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); TNF receptor family member B cell maturation (BCMA); Tn antigen ((Tn (Ag) or (GalNAcα-Ser / Thr)); prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms-like tyrosine kinase 3 (FLT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin-13 receptor subunit α-2 (IL-13Ra2 or CD213A2); mesothelin; interleukin-11 receptor α (IL-11Ra); prostate stem cell antigen (PSCA); protease serine 21 (testis or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antigen; CD24; platelet-derived growth factor receptor β (PDGFR-β); stage-specific embryonic antigen-4 (SSEA-4); CD2 0; Folic acid receptor α; Receptor tyrosine-protein kinase ERBB2 (Her2 / neu); Cell surface-associated mucin 1 (MUC1); Epidermal growth factor receptor (EGFR); Neural cell adhesion molecule (NCAM); Prostase; Prostatic acid phosphatase (PAP); Mutant elongation factor 2 (ELF2M); Hepatic glycoside B2; Fibroblast activation protein α (FAP); Insulin-like growth factor 1 receptor (IGF-I receptor); Carbonic anhydrase IX (CAIX); Proteasome (proteasome, macroprotein factor) subunit B9 (LMP2); Glycoprotein 100 (gp100); Oncogene fusion protein (bcr-abl) composed of breakpoint cluster region (BCR) and Abelson murine leukemia virus oncogene homolog 1 (Abl); Tyrosinase; Hepatic glycoside A receptor 2 (EphA2); Fucosyl GM1; Sialyl Lewis adhesion molecule (sLe);Ganglioside GM3 (aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); transglutaminase 5 (TGS5); high molecular weight melanoma-associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD2); folate receptor β; tumor endothelial marker 1 (TEM1 / CD248); tumor endothelial marker 7-associated (TEM7R); tight junction protein 6 (CLDN6); thyroid-stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5 member D (GPRC5D); chromosome X reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific 1 (PLAC1); globoH The hexose moiety of glycoceramide (GloboH); breast differentiation antigen (NY-BR-1); urothelial differentiation-specific glycoprotein (uroplakin) 2 (UPK2); hepatitis A virus cell receptor 1 (HAVCR1); adrenaline receptor β3 (ADRB3); pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex locus K9 (LY6K); olfactory receptor 51E2 (OR51E2); TCRγ variable read frame protein (TARP); Wilm tumor protein (WT1); Cancer / testis antigen 1 (NY-ESO-1); Cancer / testis antigen 2 (LAGE-1a); Melanoma-associated antigen 1 (MAGE-A1); ETS translocase gene 6 located on chromosome 12p (ETV6-AML); Sperminin 17 (SPA17); X antigen family member 1A (XAGE1); Angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); Fos-associated antigen 1; tumor protein p53 (p53); p53 mutant; prostate-specific protein (prostein); survival; telomerase; prostate cancer tumor antigen-1 (PCTA-1 or galactolectin 8), T-cell recognized melanoma antigen-1 (MelanA or MART1); rat sarcoma (Ras) mutant; human telomerase reverse transcriptase (hTERT) ); sarcoma translocation breakpoint; melanoma apoptosis inhibitor protein (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-acetylglucosamine transferase V (NA17); paired box protein Pax-3 (PAX3); androgen receptor; cyclin B1; v-myc avian myelopathy virus oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (RhoC); tyrosinase-associated protein 2 (TRP-2);Cytochrome P450 1B1 (CYP1B1); CCCTC-binding factor (zinc finger protein)-like (BORIS or Brother of the Regulator of Imprinted Sites), Squamous cell carcinoma antigen 3 (SART3) recognized by T cells; Paired box protein Pax-5 (PAX5); Pro-acromial protein-binding protein sp32 (OY-TES1); Lymphocyte-specific protein tyrosine kinase (LCK); A kinase anchoring protein 4 (AKAP-4); Synovial sarcoma X breakpoint 2 (SSX2); Receptor for advanced glycosylation end products (RAGE-1); Renal ruminoid 1 (RU1); Renal ruminoid 2 (RU2); Legumain; Human papillomavirus E6 (HPV E6); Human papillomavirus E7 (HPV E7); Intestinal carboxylesterase; Mutant heat shock protein 70-2 (mut hsp70-2); CD79a; CD79b; CD72; leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); Fc fragment of IgA receptor (FCAR or CD89); leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); mucin-like hormone receptor-like 2 containing an EGF-like module (EMR2); lymphocyte antigen 75 (LY75); phosphatidyl proteoglycan-3 (GPC3); Fc receptor-like 5 (FCRL5); and immunoglobulin λ-like polypeptide 1 (IGLL1).

[0386] In one embodiment, the CAR includes, for example, an antigen recognition domain that binds to CD19 as described herein. In another embodiment, the CAR includes an anti-CD19 binding domain comprising, for example, SEQ ID NO:7895. In yet another embodiment, the CAR includes an anti-CD19 binding domain comprising, for example, SEQ ID NO:7884.

[0387] In one embodiment, the CAR includes, for example, an antigen recognition domain that binds to BCMA as described herein. In another embodiment, the CAR includes an anti-BCMA binding domain comprising, for example, SEQ ID NO:7949.

[0388] In one embodiment, the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. In another embodiment, the transmembrane domain comprises the sequence of SEQ ID NO:6644. In another embodiment, the intracellular signaling domain comprises a primary signaling domain and / or a co-stimulatory signaling domain. In another embodiment, the primary signaling domain comprises, for example, the sequence of SEQ ID NO:6648 or SEQ ID NO:6650. In another embodiment, the co-stimulatory signaling domain comprises, for example, the sequence of SEQ ID NO:6646 or SEQ ID NO:6636, for example, comprising, for example, the sequence of SEQ ID NO:6646. In other embodiments, the co-stimulatory signaling domain comprises a sequence of an intracellular signaling domain derived from CD28.

[0389] In one embodiment, the CAR is a CD19 CAR and comprises, for example, the sequence of SEQ ID NO:7920. In another embodiment, the CAR is a CD19 CAR and comprises, for example, the sequence of SEQ ID NO:7909. In yet another embodiment, the cell described herein comprises a nucleic acid sequence encoding the CD19 CAR described herein, for example, a CD19 CAR comprising the sequence of SEQ ID NO:7920 or SEQ ID NO:7909.

[0390] In one embodiment, the CAR is BCMACAR and comprises, for example, the sequence of SEQ ID NO:8559. In another embodiment, for example, the cell described herein comprises a nucleic acid sequence encoding the BCMACAR described herein, for example, the BCMACAR comprising SEQ ID NO:8559. In yet another embodiment, the nucleic acid sequence encoding the BCMACAR comprises, for example, SEQ ID NO:8574.

[0391] In several aspects, for example, the cells of the present invention described herein (e.g., the population cells of the present invention) also contain a nucleic acid sequence encoding an NK repressive molecule. Such cells are preferred when they exhibit reduced or eliminated expression of one or more major histocompatibility class I (MHC I) molecules (e.g., by reducing or eliminating B2M expression, for example, by the methods described herein) and / or reduced or eliminated expression of one or more major histocompatibility class II (MHC II) molecules (e.g., by reducing or eliminating CIITA expression, for example, by the methods described herein). In embodiments, the NK repressive molecule is an HLA-G molecule, for example, an HLA-G molecule that does not require B2M, such as HLA-G2, HLA-G3, HLA-G4. In other embodiments, the NK repressive molecule is an HLA-G:B2M fusion molecule. An exemplary HLA-G:B2M fusion molecule is SEQ ID NO:10674. An exemplary nucleic acid sequence encoding said HLA-G:B2M fusion is SEQ ID NO:10675.

[0392] In the implementation, cells (e.g., cell populations) exhibit reduced or eliminated expression of targets of NK inhibitory molecules, such as reduced or eliminated expression of LILRB1.

[0393] In embodiments, CAR-expressing cells of the present invention (e.g., cells in which the expression or function of one or more proteins has been reduced or eliminated, for example, by the methods described herein) maintain the ability to proliferate in response to stimuli, such as by allowing the CAR to bind to its target antigen. In embodiments, proliferation occurs in vitro. In embodiments, proliferation occurs in vivo. In embodiments, proliferation occurs both in vitro and in vivo. In embodiments, the proliferation level is substantially the same as that observed in the same cell type (e.g., the same type of CAR-expressing cells), but said cell type has not yet had the expression or function of one or more proteins reduced or eliminated, for example, by the methods described herein. In embodiments, the proliferation level is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or greater of the proliferation level observed in the same cell type (e.g., the same type of CAR-expressing cells), but said cell type has not yet had the expression or function of one or more proteins reduced or eliminated, for example, by the methods described herein.

[0394] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although similar or equivalent methods and materials may be used to practice or test the invention as described herein, suitable methods and materials are described hereafter. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. Furthermore, the materials, methods, and examples described are illustrative only and are not intended to be limiting. Titles, subtitles, or numbers or letter-numbered elements, such as (a), (b), (i), etc., are shown only for ease of reading. The use of titles, numbers, or letter-numbered elements in this document does not require that steps or elements be performed in alphabetical order and that such steps or elements are necessarily independent of each other. Other features, objects, and advantages of the invention will be apparent from this description and the accompanying drawings and from the claims. Attached Figure Description

[0395] Figure 1 Cas9 editing of the B2M locus. Editing fractions in HEK-293Cas9GFP, detected by NGS, 24 hours after delivery of crRNA targeting the B2M locus and trRNA via liposome transfection. Each point represents a different crRNA, while the trRNA remained constant. Genomic coordinates are shown at the location on chromosome 15 (n=3).

[0396] Figure 2 Histograms of TCR expression after editing with gRNA molecules containing a guide domain targeting TCR-α, as listed in Table 1, are shown. The percentage of mCherry+TCR-Cells in Jurkat cells after 7 days using three different concentrations of lentivirus is also displayed.

[0397] Figure 3 : Shows the percentage of TCR-positive primary T cells at 6 and 12 days after introduction of lentivirus encoding the indicated gRNA and Cas9 / mCherry. Data shows the percentage of mCherry+TCR-edited cells.

[0398] Figure 4 : PD1-primary T cells in mCherry+ gated populations (3 days after restimulation and 8 days after activation) in cells transfected with lentivirus encoding the indicated gRNA and Cas9 / mCherry (with CD3 / CD28 beads).

[0399] Figure 5A and Figure 5B : Histogram showing TCR expression using TRAC-8gRNA on day 7 of culture ( Figure 5A ) and histogram of PD-1 expression using PD1-6 gRNA on day 8 of culture ( Figure 5B).

[0400] Figure 6 Expression profiles of primary T cells engineered to express CD19 CAR and treated with RNPs containing gRNA targeting TCRα. Before enrichment, cell populations of CAR+ / - and TCR+ / - were shown after 11 days of culture. After enrichment, TCR-T cells >98% were observed after isolation using a CD3 bead negative selection step.

[0401] Figure 7 This section shows the cytotoxic activity of CD19 CAR-transduced T cells against target-positive (Nalm6-luc) and target-negative (K562-luc) cell lines. "T1" and "T8" refer to gRNAs TRAC-1 and TRAC-8, respectively. The results show Cas9 / gRNA introduced via lentivirus or RNP, and T cell populations that were unsorted and TCR-sorted ("sorted").

[0402] Figure 8 The B2M gene was excised using a CRISPR system containing two gRNA molecules. In each experiment, as shown, cells were exposed to a gRNA molecule with a guide domain of CR00442 and a second gRNA molecule. The predicted excision product size is shown.

[0403] Figure 9 : Results of gRNA exposure to the B2M gene: Expected excision product less than 100. * indicates expected excision product observed (green arrow); ? = Expected excision product could not be resolved from the assay. Yellow arrow indicates wild-type fragment.

[0404] Figure 10 The results of gRNA exposure to the B2M gene indicate an expected excision product of ~4000 base pairs. A red * indicates the expected excision product (green box); a purple * indicates editing efficiency less than 10%. An orange box shows the wild-type fragment.

[0405] Figure 11 The results of gRNA exposure to the B2M gene indicate an expected excision product of ~6000 base pairs. A red * indicates the expected excision product (green box); a purple * indicates editing efficiency less than 10%. An orange box shows the wild-type fragment.

[0406] Figure 12 The mean (n≥3) editing effect of CRISPR systems with dgRNA targeting TRAC as shown was observed in HEK cells (stable Cas9 expression) or primary human CD3+ T cells (delivered dgRNA:Cas9RNP via electroporation). The percentage of cells showing TCR loss, as determined by flow cytometry using anti-TCRa / b antibody, was also shown.

[0407] Figure 13 The average (n≥3) editing effect of a CRISPR system with dgRNAs targeting the coding regions of TRBC1 and TRBC2 in HEK cells (stable Cas9 expression) as shown. The percentage of cells showing TCR loss, as measured by flow cytometry using anti-TCRa / b antibody, is also shown.

[0408] Figure 14 The mean (n≥3) editing effect of the CRISPR system targeting B2M dgRNA in HEK cells (stable Cas9 expression) and CD34+ primary hematopoietic stem cells as shown, and the percentage of B2M loss in primary CD3+ T cells as measured by flow cytometry. NGS assays were performed 24 hours after the CRISPR system was introduced into the cells shown; flow cytometry analysis was performed 3–5 days after the CRISPR system was introduced into CD3+ T cells.

[0409] Figure 15 Editing activity of the CRISPR system in primary human CD3+ T cells derived from three different donors, as measured by TCR loss (flow cytometry). For each gRNA, left bar = donor #1; middle bar = donor #2; right bar = donor #3.

[0410] Figure 16 The average (n≥3) editing effect of CRISPR systems with dgRNA targeting PDCD1 as shown, as measured by NGS in HEK cells (stable Cas9 expression) and by PD-1 loss in primary human CD3+ cells (RNP electroporation) (flow cytometry using anti-PD-1 antibody).

[0411] Figure 17A Flow cytometry expression of TCR and / or B2M after electroporation targeting the gRNA of TRAC and / or B2M at the indicated ratio.

[0412] Figure 17B : Cells that are negative for both B2M and TCR at the indicated gRNA ratio.

[0413] Figure 17C : such as the editing effect of B2M or TCR as measured by flow cytometry.

[0414] Figure 17D Cell viability 24 hours after electroporation.

[0415] Figure 18The percentage of PD-1 loss in primary CD3+ T cells measured by NGS (yellow bars) or by flow cytometry (using an anti-PD-1 antibody) when using dgRNA containing a guide domain targeting PDCD1 (guide domain of the CRxxxx sequence shown). NGS sequencing was performed 24 hours after RNP delivery; flow cytometry was performed on day 5 after RNP delivery.

[0416] Figure 19 The percentage of editing (n>=3) in primary CD3+ T cells measured by PD-1 loss as measured by flow cytometry (using anti-PD-1 antibody) when using dgRNAs containing a guide domain targeting PDCD1 (guide domain of the CRxxxx sequence shown). Systems with guide domains targeting some targets showed PD-1 loss >50%, with consistent results among multiple donors. gRNAs containing guide domains of CR00852, CR00828, CR00870, CR00848, CR00855, and CR00838 showed editing greater than 50% among at least two donors.

[0417] Figure 20 The percentage of editing (n>=3) in primary CD3+ T cells measured by flow cytometry when using dgRNAs containing a guide domain targeting B2M (the guide domain of the CRxxxx sequence shown). The editing percentage was measured as a percentage of B2M loss, as indicated by flow cytometry, when using dgRNAs from three different donors (donor #1, leftmost bar; donor #4, middle bar; donor #5, rightmost bar). Systems with guide domains targeting some target sequences showed B2M loss >40%, with consistent results across multiple donors. gRNAs containing guide domains of CR00442, CR00444, and CR00455 showed editing greater than 40% between at least two donors.

[0418] Figure 21 When using dgRNAs containing a guide domain targeting FKBP1A as shown, the percentage of edits in HEK293 cells stably expressing Cas9, as measured by NGS (N=3) (each unlabeled bar uses the guide domain of CRxxxx with an odd number falling between the labeled values. For example, data for dgRNAs containing the guide domain of CR002073 are reported at bars falling between labeled CR002072 and CR002074).

[0419] Figure 22When using dgRNA containing a guide domain targeting FKBP1A as shown, the percentage of editing (N=3) and frameshift editing (FS) in HEK293 cells stably expressing Cas9 were measured by NGS.

[0420] Figure 23 When using dgRNA containing a guide domain targeting FKBP1A as shown, the percentage of editing (N=3) and frameshift editing (FS) in HEK293 cells stably expressing Cas9 were measured by NGS.

[0421] Figure 24 When using RNPs containing dgRNAs with the guide domain targeting FKBP1A as shown, the percentage of editing (N=3) and frameshift editing (FS editing) in CD3+ T cells as measured by NGS.

[0422] Figure 25 CD3+ T cells that are B2M-, TCR- (as measured by anti-CD3 Ab) or B2M- / TCR- (double-negative) after sequential electroporation of RNPs containing target gRNAs or simultaneous electroporation of RNPs containing target gRNAs, as measured by FACS (on day 4 after the first electroporation).

[0423] Figure 26 Following single electroporation, sequential electroporation, or simultaneous (“Simult”) electroporation of RNPs containing target gRNAs (B2M and TRAC), CD3+ T cells were identified as B2M-, TCR- (as measured by anti-CD3Ab), or B2M- / TCR- (double-negative) as measured by NGS (48 hours after the first electroporation).

[0424] Figure 27 Schematic diagram of the preparation of gene-edited TCR- / B2M-BCMACAR transduced T cells.

[0425] Figure 28: Surface expression of TCR (using anti-CD3-PercpCy5.5) and B2M (using anti-B2M-APC) five days after (RNP) electroporation. T cells transduced with RNP containing gRNA targeting B2M are labeled “B2M”; T cells transduced with RNP containing gRNA targeting TRAC are labeled “TCR”. T cells transduced with BCMACAR are shown as “CAR”. Untransduced cells are indicated as “UTD”. Cells electroporated with Cas9 but without guide RNA are shown as “no guide”. The lower half of the figure shows CD4 staining using anti-CD4-V450 to verify that the loss of CD3 staining is attributable to TCR loss and not to T cell loss.

[0426] Figure 29 : Surface expression of TCR and B2M in total T cells from each population compared to CAR+ T cells. “CAR” indicates CAR transduction; “without guide” indicates Cas9 electroporation without gRNA; “B2M” indicates RNP electroporation with B2M-specific gRNA; “TCR” indicates RNP electroporation with TRAC-specific gRNA.

[0427] Figure 30 CAR expression levels in cells electroporated with RNPs containing B2M (“B2M”) and TRAC (“TCR”) specific gRNAs or electroporated with Cas9 but without grNA (“guideless”).

[0428] Figure 31 Evaluation of T cell proliferation in response to tumor cell lines expressing high levels of BCMA (KMS11), low levels of BCMA (RPMI8226), or BCMA- (Nalm6). T cells were subjected to electroporation with Cas9 but without grNA (“guideless”) or electroporation with RNPs containing gRNAs targeting B2M and TRAC (“B2M+TCR”); and / or transduced with a lentiviral vector encoding BCMACAR (“BCMACAR”) or not transduced (“UTD”), as indicated.

[0429] Figure 32 CAR+CD4+ and / or CD8+ T cell proliferation in response to tumor cell lines expressing high levels of BCMA (KMS11), low levels of BCMA (RPMI8226), or BCMA- (Nalm6). Cells were subjected to electroporation with Cas9 but without grNA (“guideless”) or with RNPs containing gRNAs targeting B2M and TRAC (“B2M+ TCR”); and / or transduced with a lentiviral vector encoding BCMACAR (“BCMACAR”) or not transduced (“UTD”), as shown.

[0430] Figure 33A and 33B: Evaluation of the effect of TRAC-targeting gRNAs on TCR expression on the cell surface. 33A shows that CD3 staining loss was observed in RNPs containing guide CR000961(961), CR000978(978), CR000984(984), CR000992(992), CR000985(985), and CR000960 (gRNA1) and CR000979 (gRNA8). 33B shows that CD3 staining loss was observed in RNPs containing guide CR000991(991), CR000992(992), CR000993(993), and CR000978(978). 991 and 992 almost overlapped.

[0431] Figure 33C The image shows the genome editing effect of the TRAC locus, generated by RNP electroporation of primary human T cells containing the indicated gRNA targeting the TRAC locus. The frequency of insertions or deletions is indicated (insertion / deletion %), and the percentage of these edits resulting in frameshifts of coding sequences is shown (frameshift %).

[0432] Figure 34A and Figure 34B : Detailed display of the top 5 most frequently observed sequence changes for each TRAC-targeting gRNA used to edit primary human T cells. Figure 34A and Figure 34B These are results from two independently conducted electroporation experiments. Wild-type (wt) unmodified bases are shown in uppercase letters. Deletions relative to the wt sequence are shown with a "-", and insertions relative to the wt sequence are shown with a lowercase letter. Data for each experiment are the average of products from three replicate PCR experiments. Figures 34A to 34B SEQ ID NO:10845-10899 are disclosed in the order of their appearance.

[0433] Figure 35 This study evaluates the effect of B2M-targeting gRNAs on B2M expression on the cell surface. The wizard number indicates the CR00xxx identifier of the guiding domain.

[0434] Figure 36Genome editing at the B2M locus was achieved using RNP electroporated human primary T cells containing the indicated gRNA targeting the B2M locus. The top inset indicates the frequency of insertions or deletions (insertion / deletion %) and shows the percentage of these edits resulting in frameshifts in the coding sequence (frameshift edit %). The bottom inset details the top 10 most frequently observed sequence changes for each B2M-targeting gRNA used to edit primary human T cells. Wild-type (wt) unmodified bases are shown in uppercase. Deletions relative to the wt sequence are indicated by "-"; insertions relative to the wt sequence are indicated by "lowercase". Data are averages from triplet PCR products. Figure 36 SEQ ID NO:10900-10919 are disclosed in the order of their appearance.

[0435] Figure 37 : As measured by flow cytometry using an anti-HLA-DR reagent, the editing of primary human T cells by RNPs containing the indicated dgRNA (identified by the CRxxxxx identifier representing the guide domain) at the indicated concentration on day 3 (day 5 of cell culture) after electroporation.

[0436] Figure 38 The figure shows the genome editing effect of the CIITA locus, generated by RNP electroporation of primary human T cells containing the indicated gRNA targeting the CIITA locus. The frequency of insertions or deletions (insertion / deletion %) is indicated, and the percentage of these edits resulting in frameshifts in coding sequences is shown (frameshift edit %). The bottom inset shows the top 5 most frequently observed sequence changes in detail. Wild-type (wt) unmodified bases are shown in uppercase letters. Deletions relative to the wt sequence are shown with a "-"; insertions relative to the wt sequence are shown with a "lowercase letter". Data are averages from triplet PCR products. Figure 38 SEQ ID NO:10920-10939 are disclosed in the order of their appearance.

[0437] Figure 39 : Editing % on day 3 after electroporation of primary human T cells using an anti-HLA-DR reagent, as measured by flow cytometry. This is achieved by RNPs containing the indicated dgRNA (identified by the guide domain CR00xxxx) targeting CIITA at the indicated concentration. Editing % represents HLA-DR expression at the cell surface in electroporated cells treated with CIITA, relative to expression in cells electroporated without guide RNA.

[0438] Figure 40The image shows the genome editing effect of the CIITA locus, generated by RNP electroporation of primary human T cells containing the indicated gRNA targeting the CIITA locus. The frequency of insertions or deletions is indicated (insertion / deletion %), and the percentage of these edits resulting in frameshifts of coding sequences is shown (frameshift %).

[0439] Figure 41 : The top 5 most frequently observed sequence variations (insertions / deletions) for each CIITA-targeting gRNA used to edit primary human T cells. Data are the averages from triplet PCR products. Wild-type (wt) unmodified bases are shown in uppercase letters. Deletions relative to the wt sequence are shown with “-”; insertions relative to the wt sequence are shown with “lowercase”. Figure 41 SEQ ID NO:10940-10974 are disclosed in the order of their appearance.

[0440] Figure 42 : Editing % on day 3 after electroporation of primary human T cells using an anti-HLA-DR reagent, as measured by flow cytometry. This is achieved by RNPs containing the indicated dgRNA (identified by the guide domain CR00xxxx) targeting CIITA at the indicated concentration. Editing % represents HLA-DR expression at the cell surface in electroporated cells treated with CIITA, relative to expression in cells electroporated without guide RNA.

[0441] Figure 43 The image shows the genome editing effect of the CIITA locus, generated by RNP electroporation of primary human T cells containing the indicated gRNA targeting the CIITA locus. The frequency of insertions or deletions is indicated (insertion / deletion %), and the percentage of these edits resulting in frameshifts of coding sequences is shown (frameshift %).

[0442] Figure 44 The top 5 most frequently observed sequence changes for each CIITA-targeting gRNA used to edit primary human T cells. Data are the average of products from three replicate PCRs. Wild-type (wt) unmodified bases are shown in uppercase letters. Deletions relative to wt are indicated by "-"; insertions relative to wt are indicated by "lowercase letters". Figure 44 SEQ ID NO:10975-11014 are disclosed in the order of their appearance.

[0443] Figure 45 : A schematic protocol for preparing primary human T cells (triple-edited cells) edited at the B2M, TRAC, and CIITA loci.

[0444] Figure 46The editing of TRAC, B2M, and CIITA was evaluated by examining the cell surface expression of CD3ε, B2M, and HLA-DR using flow cytometry. Cell surface expression was examined using single-target RNPs (B2M 442, TRAC 961, or CIITA 991) or three RNPs simultaneously (triple 1, triple 2, triple 3, and triple 4). Figure 45 (See details below) Electroporation of cells. Cells not electroporated are shown as "No EP". Cells electroporated with Cas9 but without guide RNA are shown as "No Guide".

[0445] Figure 47 The genome editing effects at the B2M, TRAC, and CIITA loci were generated by simultaneous electroporation of human primary T cells using three RNPs containing gRNAs targeting the B2M, TRAC, and CIITA loci. The frequency of insertions or deletions (insertion / deletion %) is indicated in parentheses, and the percentage of these edits resulting in frameshifts of coding sequences is shown.

[0446] Figure 48 Using different concentrations, such as Figure 45 The diagram illustrates the top 10 most frequently observed sequence changes at the B2M locus in primary human T cells for each RNP, in the context of simultaneous editing of three loci (triple editing). Wild-type (wt) unmodified bases are shown in uppercase letters. Deletions relative to the wt sequence are indicated by "-"; insertions relative to the wt sequence are indicated by "lowercase letters". Data are the average of products from three replicate PCRs. Figure 48 SEQ ID NO:11015-11054 are disclosed in the order of their appearance.

[0447] Figure 49 Using different concentrations, such as Figure 45 The diagram illustrates the top 10 most frequently observed sequence changes at the TRAC locus in primary human T cells for each RNP, in the context of simultaneous editing of three loci (triple editing). Wild-type (wt) unmodified bases are shown in uppercase letters. Deletions relative to the wt sequence are indicated by "-"; insertions relative to the wt sequence are indicated by "lowercase letters". Data are the averages from three replicate PCR products. Figure 49 SEQ ID NO:11055-11094 are disclosed in the order of their appearance.

[0448] Figure 50 Using different concentrations, such as Figure 45The diagram illustrates the top 10 most frequently observed sequence changes at the CIITA locus in primary human T cells for each RNP, in the context of simultaneous editing of three loci (triple editing). Wild-type (wt) unmodified bases are shown in uppercase letters. Deletions relative to the wt sequence are indicated by "-"; insertions relative to the wt sequence are indicated by "lowercase letters". Data are averages from three replicate PCR products. Figure 50 SEQ ID NO:11095-11134 are disclosed in the order of their appearance.

[0449] Figure 51 The editing efficiency of guide RNAs was evaluated based on their patterns. Guide RNAs for TRAC (CR000961; upper half-figure) or B2M (CR00442; lower half-figure) were synthesized with or without the chemical modifications shown (PS or OMePS) according to single or double guide RNA patterns. RNPs were electroporated into human primary T cells at the concentrations shown. The editing efficiency of the TRAC editing process was evaluated by analyzing the cell surface staining of CD3ε using flow cytometry (upper part), and the editing efficiency of the B2M editing process was evaluated by analyzing the cell surface staining of B2M protein (lower part).

[0450] Figure 52 Genome editing at the FKBP1A locus, generated by RNP electroporation of primary human T cells containing the indicated gRNA targeting FKBP1A. The frequency of insertions or deletions (insertion / deletion %) is indicated, and the percentage of these edits resulting in frameshifts of coding sequences is shown.

[0451] Figure 53 This section shows the top 5 most frequently observed sequence changes for each FKBP1A-targeting gRNA used to edit primary human T cells. Wild-type (wt) unmodified bases are shown in uppercase letters. Deletions relative to the wt sequence are indicated by "-"; insertions relative to the wt sequence are indicated by "lowercase letters". Data are the average of products from three replicate PCRs. Figure 53 SEQ ID NO:11135-11159 are disclosed in the order of their appearance.

[0452] Figure 54The following were used as negative controls: RNPs containing gRNA or: 442 (irrelevant guide CR00442 targeting B2M); Cas9 (Cas9 alone without trRNA or crRNA); trRNA (tracer RNA, but without crRNA or Cas9 protein); Cas9+trRNA (Cas9 and tracer RNA, but without crRNA); EP (electroplated cells only); and T cells edited without EP (cells only, without electroporation), wherein the gRNA contained a guide domain targeting FKBP1A (CR002086, CR002097, CR002122; shown as 2086, 2097, and 2112, respectively). After electroporation, cells were treated with 2.5 nM RAD001 (top half-panel) or untreated (bottom half-panel), and the effect on mTOR pathway inhibition was evaluated by flow cytometry analysis of S6 phosphorylation (pS6). The Y-axis represents forward scattering (FSC), and the X-axis represents pS6 levels. pS6-positive staining was determined by gating to levels higher than those seen in controls stained with the same antibody (not shown) (shown in the gating traces). The quantification of S6 phosphorylation from flow cytometry data is shown in the curves in the lower half of the plot.

[0453] Figure 55A and Figure 55B Edited CART cells respond to antigen-exposed cytokine production. CART cells were gene-edited using guides CR000961 targeting the TRAC locus and / or CR002097 and CR002086 targeting the FKBP1A locus (as shown via CR961, CR2097, and CR2086, respectively). CART cells prepared via RNP electroporation without guide RNA served as a negative control. CART cells expressing CART-CD19, CART-BCMA-10, or untransduced (UTD) cells (as shown) were mixed with indicated cancer cells (KMS11 (BCMA-positive), Nalm6 (CD19-positive), or RPMI8226 (BCMA-positive)) at an effector / target ratio of 1:1 or 1:2.5 (as shown). Cell culture supernatants were collected, and interferon-γ (Fig. A) or IL-2 (Fig. B) was measured.

[0454] Figure 56The killing effect of edited CART cells on antigen-positive cancer cell lines. CART cells were gene-edited using guides CR000961 targeting the TRAC locus and / or guides CR002097 and CR002086 targeting the FKBP1A locus (as shown via CR961, CR2097, and CR2086, respectively). CART cells prepared via RNP electroporation without guide RNA served as a negative control. CART cells expressing CART-CD19, CART-BCMA-10, or untransduced (UTD) cells (as shown) were mixed with cancer cells stably expressing luciferase reporter molecules (KMS11 (BCMA-positive), Nalm6 (CD19-positive), or RPMI8226 (BCMA-positive)) at a 1:1 effector / target ratio. Luciferase signaling was measured, and cell killing was assessed as a measure of loss of luciferase activity.

[0455] Figure 57 Edited CART cells proliferated in response to antigen exposure. CART cells were gene-edited using guides CR000961 targeting the TRAC locus and / or guides CR002097 and CR002086 targeting the FKBP1A locus (as shown via 961, 2097, and 2086, respectively). CART cells prepared via RNP electroporation without guide RNA served as a negative control. CART cells expressing CART-CD19 (labeled CD19 CAR), CART-BCMA-10 (labeled BCMA10 CAR), or untransduced (UTD) cells (as shown) were mixed with the indicated cancer cell lines (KMS11 (BCMA positive), Nalm6 (CD19 positive), or RPMI8226 (BCMA positive)) at a 1:1 effector / target ratio. Proliferation was measured by counting the total number of CAR+ CD4+ and CD8+ cells relative to a fixed number of counting beads.

[0456] Figure 58: Sensitivity of gene-edited (TRAC and / or FKBP1A) CAR cells relative to RAD001. CAR cells expressing BCMA10 CAR (A), CD19 CAR (B), or no CAR (C; UTD) were prepared. Gene editing was performed on CAR cells or UTD cells using guide CR000961 targeting the TRAC locus and / or guides CR002097 and CR002086 targeting the FKBP1A locus (as shown via 961, 2097, and 2086, respectively). CAR cells prepared via RNP electroporation without guide RNA served as a negative control. After RNP electroporation, cells were treated with 2.5 nM RAD001 (top half-panel, shown as +RAD001) or untreated (bottom half-panel, shown as -RAD001), and the effect on mTOR pathway inhibition was evaluated by flow cytometry analysis of S6 phosphorylation (pS6). The Y-axis represents side-scattered fluorescence (SSC), and the X-axis represents the level of phosphorylated S6 protein (pS6). pS6 positivity was determined by gating to fluorescence levels higher than those seen in controls stained with the same antibody (not shown), as shown in the lower right quadrant of the FACS plot. The percentage of cells containing phosphorylated S6 is shown in a histogram (upper half-plot) and in a graph (lower half-plot).

[0457] Figure 59 Expression of the HLA-G / B2M fusion protein in SupT1 cells, as detected by HLA-G flow cytometry. The light gray histogram represents the background fluorescence of the PE channel in untransduced cells. The dark gray histogram represents the fluorescence of the PE channel in HLA-G / B2M transduced cells.

[0458] Figure 60 The editing efficiency of different Cas9 variants at the B2M locus targeted in CD34+ hematopoietic stem cells, as evaluated by NGS and flow cytometry. NLS = SV40 NLS; His6 (SEQ ID NO:10795) or His8 (SEQ ID NO:10796) refers to 6 or 8 histidine residues, respectively; TEV = tobacco etch virus cleavage site; Cas9 = wild-type Streptococcus pyogenes Cas9– mutant or variant as shown).

[0459] Figure 61 Editing efficiency of different Cas9 variants and a range of concentrations at the B2M locus targeted in primary human T cells, as measured by flow cytometry.

[0460] Figure 62Editing efficiency of two different Cas9 variants at various concentrations in primary human T cells when using two different gRNAs targeting B2M (left inset) or TRAC (right inset). Editing efficiency (editing %) was measured by flow cytometry by measuring the loss of cell surface expression of B2M (left inset) or TCR (right inset).

[0461] Figure 63 Off-target activity of TRAC and B2M guides was assessed in HEK-293 cells overexpressing Cas9 using a dsDNA oligomer-insertion method. Detected intermediate target sites (triangles) and potential off-target sites (circles) are shown; the y-axis represents detection frequency. All gRNAs were tested in dgRNA pattern, with the guide domain indicated by the CRxxxxx identification code. Each gRNA was modified such that the 5' and 3' internucleotide bonds were phosphate thioester bonds (“PS”).

[0462] Figure 64 The off-target activity of guide RNA molecules targeting CIITA, FKBP1A, PDCD1, TRAC, and TRBC2 was assessed using a dsDNA oligomer-insertion method in HEK-293 cells overexpressing Cas9. Detected intermediate target sites (triangles) and potential off-target sites (circles) are shown; the y-axis represents the detection frequency. All gRNAs were tested in dgRNA pattern, with guide domains indicated by CRxxxxx identification codes.

[0463] Figure 65 : 72 hours after the introduction of a CRISPR system targeting CD3δ (containing dgRNA with the indicated guide domain), the percentage of editing in primary human CD3+ T cells as measured by loss of CD3 surface expression (e.g., by flow cytometry). % per CD3-negative cell is the mean of three independent experiments (SD = standard deviation).

[0464] Figure 66 : 72 hours after the introduction of a CRISPR system targeting CD3γ (containing dgRNA with the indicated guide domain), the percentage of editing in primary human CD3+ T cells as measured by loss of CD3 surface expression (e.g., by flow cytometry). The mean percentage for each CD3-negative cell is the average of three independent experiments (SD = standard deviation).

[0465] definition

[0466] The terms “CRISPR system,” “Cas system,” or “CRISPR / Cas system” refer to a group of molecules comprising an RNA-directed nuclease or other effector molecule and a gRNA molecule, which are both necessary and sufficient to guide and enable the RNA-directed nuclease or other effector molecule to modify nucleic acids at a target sequence. In one embodiment, a CRISPR system comprises gRNA and a Cas protein, such as the Cas9 protein. Such systems comprising Cas9 or modified Cas9 molecules are referred to herein as “Cas9 systems” or “CRISPR / Cas9 systems.” In one example, the gRNA molecule and the Cas molecule may complex to form a ribonucleoprotein (RNP) complex.

[0467] The terms “guide RNA,” “guide RNA molecule,” “gRNA molecule,” or “gRNA” are used interchangeably and refer to a group of nucleic acid molecules that facilitate the specific guidance of a guide RNA-directed nuclease or other effector molecule (generally complexed with a gRNA molecule) to a target sequence. In some embodiments, the guidance is achieved by a portion of the gRNA hybridizing with DNA (e.g., via a gRNA guidance domain) and by a portion of the gRNA molecule binding to an RNA-directed nuclease or other effector molecule (e.g., at least via gRNAtracr). In some embodiments, the gRNA molecule consists of a single, continuous polynucleotide molecule, referred herein as a “single guide RNA” or “sgRNA,” etc. In other embodiments, the gRNA molecule consists of multiple (usually two) polynucleotide molecules that are capable of associating (generally via hybridization), referred herein as a “dual guide RNA” or “dgRNA,” etc. The gRNA molecule is described in more detail below, but it generally contains a guidance domain and a tracr. In some embodiments, the guidance domain and tracr are located on a single polynucleotide. In other embodiments, the guidance domain and tracr are located on separate polynucleotides.

[0468] When the term "guide domain" is used in connection with gRNA, the term refers to a portion of the gRNA molecule that recognizes a target sequence (e.g., a target sequence inside a cell's nucleic acid, such as a gene), or is complementary to it.

[0469] When the term “crRNA” is used in connection with gRNA, the term refers to a portion of the gRNA molecule that contains a guide domain and a region that interacts with tracr to form a flagpole region.

[0470] The term "target sequence" refers to a nucleic acid sequence complementary to, for example, a gRNA-guided domain that is completely complementary to it. In one embodiment, the target sequence is located on genomic DNA. In one embodiment, the target sequence is adjacent (on the same strand of the DNA or its complementary strand) to a protospacer neighbor motif (PAM) sequence recognized by a protein with nuclease or other effector activity, such as the PAM sequence recognized by Cas9. In one embodiment, the target sequence is a target sequence of an allogeneic T cell target. In one embodiment, the target sequence is a target sequence of an inhibitory molecule. In one embodiment, the target sequence is a target sequence of a downstream effector of an inhibitory molecule.

[0471] As used in this article in relation to gRNA molecules, the term "flagpole" refers to a portion of the gRNA in which crRNA and tracr bind or hybridize with each other.

[0472] As used herein in relation to gRNA molecules, the term "tracr" refers to a portion of the gRNA that binds to a nuclease or other effector molecule. In one embodiment, tracr contains a nucleic acid sequence that specifically binds to Cas9. In another embodiment, tracr contains a nucleic acid sequence that forms part of the flagpole.

[0473] The term "Cas9" or "Cas9 molecule" refers to the enzyme from the bacterial type II CRISPR / Cas system responsible for cutting DNA. Cas9 also includes wild-type proteins as well as their functional and non-functional mutants.

[0474] When used in relation to nucleic acids, the term "complementary" refers to the pairing of bases A with T or U and G with C. The term complementarity refers to complete complementarity, meaning that nucleic acid molecules with A-T or U pairing and G-C pairing are formed throughout the entire reference sequence, as well as molecules with at least 80%, 85%, 90%, 95%, or 99% complementarity.

[0475] When used in the context of homology-guided repair or homologous recombination, "template nucleic acid" refers to a nucleic acid at a modification site where a donor sequence is inserted using the CRISPR system to repair (insert) a gene at the cleavage site. In one aspect, the template nucleic acid comprises a nucleic acid sequence encoding a chimeric antigen receptor (CAR), as described herein. In another aspect, the template nucleic acid comprises a vector containing a nucleic acid sequence encoding a chimeric antigen receptor (CAR), as described herein.

[0476] As used herein, the term “insertion / deletion” refers to a nucleic acid containing one or more nucleotide insertions, one or more nucleotide deletions, or a combination of nucleotide insertions and deletions relative to a reference nucleic acid, which is generated upon exposure to a composition containing a gRNA molecule (e.g., a CRISPR system). Insertions / deletions can be identified by nucleic acid sequencing, such as by NGS, after exposure to a composition containing a gRNA molecule. Regarding insertion / deletion sites, an insertion / deletion is said to be “at or near the reference site” if it contains at least one insertion or deletion or partially or completely overlaps with the reference site (e.g., an insertion or deletion containing at least one insertion or deletion overlapping or within the range of 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide at a site complementary to the guide domain of the gRNA molecule ...

[0477] As used herein, the term "insertion / deletion pattern" refers to a set of insertions / deletions that arise upon exposure to a composition containing a gRNA molecule. In one embodiment, the insertion / deletion pattern consists of the first three insertions / deletions by frequency of occurrence. In one embodiment, the insertion / deletion pattern consists of the first five insertions / deletions by frequency of occurrence. In one embodiment, the insertion / deletion pattern consists of insertions / deletions present at a frequency greater than about 5% relative to the total number of sequencing reads. In one embodiment, the insertion / deletion pattern consists of insertions / deletions present at a frequency greater than about 10% relative to the total number of insertion / deletion sequencing reads (i.e., those not composed of an unmodified reference nucleic acid sequence). In one embodiment, the insertion / deletion pattern comprises any three of the first five most frequently observed insertions / deletions. Insertion / deletion patterns can be determined, for example, by cellular sequencing of a cell population exposed to the gRNA molecule.

[0478] As used herein, the term "off-target insertion / deletion" refers to an insertion / deletion at or near a site outside the target sequence of the guide domain of a gRNA molecule. Such sites may contain, for example, 1, 2, 3, 4, 5, or more mismatched nucleotides relative to the sequence of the gRNA's guide domain. In exemplary embodiments, such sites are detected using computer-predicted directed sequencing of off-target sites or by insertion methods known in the art.

[0479] The term "inhibitory molecule" refers to molecules, and genes encoding said molecules and their associated regulatory elements, such as promoters, that, when activated, cause or promote inhibition of cell survival, activation, proliferation, and / or function. In embodiments, the inhibitory molecule is a molecule expressed on immune effector cells (e.g., on T cells). Non-limiting examples of inhibitory molecules are PD-1, PD-L1, PD-L2, CTLA4, TIM3, LAG3, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFβ. It should be understood that when used in connection with target sequences or gRNA molecules, the term repressive molecule refers to the gene (and its associated regulatory elements) encoding the repressive molecule protein. In one embodiment, the gene encoding the repressive molecule is CD274. In one embodiment, the gene encoding the repressive molecule is HAVCR2. In one embodiment, the gene encoding the repressive molecule is LAG3. In one embodiment, the gene encoding the repressive molecule is PDCD1.

[0480] The term "downstream effector that undergoes signal transduction via an inhibitory molecule" refers to a molecule that mediates the inhibitory effect of an inhibitory molecule; and the gene encoding said molecule and its associated regulatory elements, such as a promoter. It should be understood that when used in connection with a target sequence or gRNA molecule, the term "downstream effector that undergoes signal transduction via an inhibitory molecule" refers to a gene (and its associated regulatory elements) encoding a downstream effector protein that undergoes signal transduction via an inhibitory molecule. In one embodiment, the gene encoding a downstream effector that undergoes signal transduction via an inhibitory molecule is PTPN11.

[0481] The terms “allogeneic T-cell target” and “allogeneic T-cell target” are used interchangeably herein and refer to proteins that mediate or promote host anti-graft responses, graft-versus-host responses, or act as immunosuppressants; and genes encoding said molecules and their associated regulatory elements, such as promoters. It should be understood that when used in connection with target sequences or gRNA molecules, the term “allogeneic T-cell target” refers to genes (and their associated regulatory elements) encoding allogeneic T-cell target proteins. Without being bound by theory, for example, inhibition or elimination of one or more allogeneic T-cell targets can, for example, improve the efficacy, survival, function, and / or viability of allogeneic cells (e.g., allogeneic T cells) by reducing or eliminating adverse immunogenicity (such as host anti-graft responses or graft-versus-host responses).

[0482] In a non-limiting example, the protein mediating or promoting graft-versus-host response or host-versus-graft response is one or more components of a T-cell receptor. In one embodiment, a component of the T-cell receptor is a T-cell receptor α, for example, a constant domain of TCRα. In one embodiment, a component of the T-cell receptor is a T-cell receptor β chain, for example, constant domain 1 or constant domain 2 of TCRβ. In one embodiment, a component of the T-cell receptor is a T-cell receptor δ chain. In one embodiment, a component of the T-cell receptor is a T-cell receptor ε chain. In one embodiment, a component of the T-cell receptor is a T-cell receptor ζ chain. In one embodiment, a component of the T-cell receptor is a T-cell receptor γ chain. Therefore, in embodiments where the protein encoding the allogeneic T-cell target is a TCR component, the gene encoding the allogeneic T-cell target can be, for example, TRAC, TRBC1, TRBC2, CD3D, CD3E, CD3G, or CD247 and combinations thereof.

[0483] In a non-limiting example, the protein mediating or promoting graft-versus-host response or host-versus-graft response is an HLA protein or B2M. Examples of HLA proteins include HLA-A, HLA-B, and HLA-C. Therefore, in embodiments where the allogeneic T-cell target protein is an HLA or B2M protein, the gene encoding the allogeneic T-cell target can be, for example, HLA-A, HLA-B, HLA-C, or B2M, or combinations thereof. In other embodiments, the allogeneic T-cell target protein is NLRC5, and the gene encoding the allogeneic T-cell target can be, for example, NLRC5.

[0484] In a non-limiting example, the protein mediating or promoting graft-versus-host response or host-versus-graft response is a major histocompatibility complex II (MHC II) molecule (e.g., HLA-Dx (where x refers to a letter of the MHC II protein, e.g., HLA-DM, HLA-DO, HLA-DR, HLA-DQ, and / or HLA-DP)), or a regulator of MHC II expression, or a combination thereof. One non-limiting example is CIITA (also referred to herein as C2TA). Thus, in an embodiment where the allogeneic T cell target protein is CIITA, the gene encoding the allogeneic T cell target could be, for example, CIITA. In another non-limiting example, the protein mediating or promoting graft-versus-host response or host-versus-graft response is RFXANK. In another non-limiting example, the protein mediating or promoting graft-versus-host response or host-versus-graft response is RFXAP. In another non-limiting example, the protein mediating or promoting graft-versus-host response or host-versus-graft response is RFX5.

[0485] As used herein, the term "target of an immunosuppressant" refers to the molecular target of an immunosuppressant, such as a receptor or other protein (the terms "immunosuppressant" and "immunosuppressive drug" are used interchangeably herein in connection with a drug or the target of a drug). An immunosuppressant is a substance that inhibits immune function through one of several mechanisms of action. In other words, an immunosuppressant is the action of a compound in which said action is manifested by its ability to weaken the degree and / or gluttony of the immune response. An example of the type of activity exhibited by an immunosuppressant is the elimination of T cell activity (e.g., activated T cells). Another example of the type of activity exhibited by an immunosuppressant is the activity that reduces T cell activity or the level of its activation. As a non-limiting example, an immunosuppressant can be a calcineurin inhibitor, a target of rapamycin, an interleukin-2α-chain blocker, an inosine monophosphate dehydrogenase inhibitor, a dihydrogen phosphate reductase inhibitor, a corticosteroid, cyclosporine, or an immunosuppressive antimetabolite. Classical cytotoxic immunosuppressants act by inhibiting DNA synthesis. Others may act by activating T cells or by inhibiting the activation of helper cells. As limiting examples, the target of an immunosuppressant can be an immunosuppressant receptor such as deoxycytidine kinase, CD52, glucocorticoid receptor (GR), FKBP family gene members (e.g., FKBP12), and cyclic protein family gene members. In one embodiment, the target of the immunosuppressant is deoxycytidine kinase (DCK), and the immunosuppressant is a nucleoside analogue such as cytarabine (pyrimidinyl glycoside) or gemcitabine. In one embodiment, the target of the immunosuppressant is GR, and the immunosuppressant is a corticosteroid such as dexamethasone. In one embodiment, the target of the immunosuppressant is CD52, and the immunosuppressant is an anti-CD52 antibody or its antigen-binding fragment such as alenzumab. In one embodiment, the target of the immunosuppressant is FKBP12, and the immunosuppressant is FK506 (or an analogue thereof or an FKBP12 binding fragment), cyclosporine, rapamycin or a rapamycin analogue, or an mTor inhibitor such as RAD001. Therefore, in embodiments where the allogeneic T cell target is the target of an immunosuppressive protein, the gene encoding the allogeneic T cell target can be, for example, NR3C1, FKBP1A, CD52, or DCK, or combinations thereof.

[0486] The term "rapamycin-resistant mTor" refers to the mTor protein (and the gene encoding the mTor protein) whose binding to FKBP12 is reduced or eliminated (including in the presence of rapamycin, FK506, rapamycin analogs, cyclosporine, and / or other mTor inhibitors such as RAD001). In an exemplary embodiment, rapamycin-resistant mTor comprises one or more mutations to the FRB domain. In one exemplary embodiment, rapamycin-resistant mTor comprises a mutation to S2035, for example, constitutes thereof, for example, comprises an S2035I mutation, for example, constitutes thereof.

[0487] The terms “a” and “an” refer to one or more grammatical objects of the article (i.e., at least one). For example, “an element” means one or more elements.

[0488] When referring to measurable values ​​such as quantity, duration of time, etc., the term "about" is intended to cover variations of ±20% from the specified value, or in some cases ±10%, or in some cases ±5%, or in some cases ±1%, or in some cases ±0.1%, because such variations are suitable for carrying out the disclosed method.

[0489] The term "chimeric antigen receptor" or alternatively "CAR" refers to a group of peptides, typically two peptides in the simplest embodiment, which, in immune effector cells, provide the cell with specificity for a target cell (typically a cancer cell) and facilitate intracellular signaling. In some embodiments, the CAR comprises at least an extracellular antigen-binding domain, a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain"), the cytoplasmic signaling domain comprising functional signaling domains derived from stimulatory molecules and / or co-stimulatory molecules as defined below. In some aspects, the group of peptides is adjacent to each other. In some embodiments, the group of peptides includes a dimerization switch, which, in the presence of a dimerizing molecule, can couple the peptides to each other, for example, couple the antigen-binding domain to the intracellular signaling domain. In one aspect, the stimulatory molecule is a ζ-chain associated with a T-cell receptor complex. In one aspect, the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one co-stimulatory molecule as defined below. In one aspect, the co-stimulatory molecule is selected from the co-stimulatory molecules described herein, such as 41BB (i.e., CD137), CD27, and / or CD28. In one aspect, the CAR comprises a chimeric fusion protein comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the intracellular signaling domain comprises a functional signaling domain derived from the stimulatory molecule. In one aspect, the CAR comprises a chimeric fusion protein comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the intracellular signaling domain comprises a functional signaling domain derived from the co-stimulatory molecule and a functional signaling domain derived from the stimulatory molecule. In one aspect, the CAR comprises a chimeric fusion protein comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the intracellular signaling domain comprises two functional signaling domains derived from one or more co-stimulatory molecules and a functional signaling domain derived from the stimulatory molecule. In one aspect, the CAR comprises a chimeric fusion protein comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the intracellular signaling domain comprises at least two functional signaling domains derived from one or more co-stimulatory molecules and a functional signaling domain derived from a stimulatory molecule. In one aspect, the CAR includes an optional leader sequence at the N-terminus (N-terminus) of the CAR fusion protein. In another aspect, the CAR further includes a leader sequence at the N-terminus of the extracellular antigen-binding domain, wherein the leader sequence is optionally cleaved from the antigen-binding domain (e.g., scFv) during cellular processing and CAR localization to the cell membrane.

[0490] CARs containing an antigen-binding domain (e.g., scFv or TCR) that targets a specific tumor marker X (as described herein) are also called XCARs. For example, a CAR containing an antigen-binding domain that targets CD19 is also called a CD19CAR. As another example, a CAR containing an antigen-binding domain that targets BCMA is also called a BCMACAR.

[0491] The term "signal transduction domain" refers to the functional portion of a protein that plays a role by transmitting information within the cell, either by generating a second messenger or by acting as an effector in response to such a messenger, thereby regulating cellular activity through a defined signal transduction pathway.

[0492] As used herein, the term "antibody" refers to a protein that specifically binds to an antigen, or a polypeptide sequence derived from an antigen-specific immunoglobulin molecule. Antibodies can be polyclonal or monoclonal, multi-chain or single-chain, or intact immunoglobulins and can be derived from natural or recombinant sources. Antibodies can be tetramers of immunoglobulin molecules.

[0493] The term "antibody fragment" refers to at least one portion of an antibody that retains the ability to interact specifically with an epitope of an antigen (e.g., through binding, steric hindrance, stabilization / destabilization, spatial distribution). Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, scFv antibody fragments, disulfide-linked Fvs (sdFv), Fd fragments consisting of a VH domain and a CH1 domain, linear antibodies, single-domain antibodies such as sdAb (or VL or VH), camel-like VHH domains, multispecific antibodies formed from antibody fragments such as bivalent fragments containing two Fab fragments linked by disulfide bonds in a hinge region, and isolated CDR or other epitope-binding fragments of antibodies. Antigen-binding fragments can also be incorporated into single-domain antibodies, macrobodies, microbodies, nanobodies, intrabody antibodies, bispecific antibodies, tripoisome antibodies, tetraspecific antibodies, v-NARs, and bi-scFvs (see, for example, Hollinger and Hudson, Nature Biotechnology, 23:1126-1136, 2005). Antigen-binding fragments can also be grafted onto peptide-based scaffolds such as fibronectin type III (Fn3) (see U.S. Patent No. 6,703,199, which describes fibronectin peptide microbodies).

[0494] The term "scFv" refers to a fusion protein comprising at least one antibody fragment containing a light chain variable region and at least one antibody fragment containing a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region are sequentially linked, for example by means of a synthetic linker, such as a flexible short peptide linker, and are capable of being expressed as a single-chain polypeptide, wherein the scFv retains the specificity of the intact antibody from which it is derived. Unless otherwise specified, as used herein, the scFv may have VL and VH variable regions in any order (e.g., relative to the N-terminus and C-terminus of the polypeptide), and the scFv may comprise a VL-linker-VH or may comprise a VH-linker-VL.

[0495] The CAR of the present invention, comprising an antibody or an antibody fragment thereof, can exist in various forms, wherein the antigen-binding domain is expressed as a continuous polypeptide chain, such as including single-domain antibody fragments (sdAbs), single-chain antibodies (scFvs), humanized antibodies, or bispecific antibodies (Harlow et al., 1999, cited in: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, cited in: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426). In one aspect, the antigen-binding domain of the CAR composition of the present invention comprises an antibody fragment. In yet another aspect, the CAR comprises an antibody fragment constituting an scFv. The precise amino acid sequence boundaries of a given CDR can be determined using any of a number of well-known schemes, including those or combinations thereof described by Kabat et al. (1991), “Sequences of Proteins of Immunological Interest”, 5th edition, Public Health Service, National Institutes of Health, Bethesda, MD (“Kabat” numbering scheme); Al-Lazikani et al., (1997) JMB 273, 927-948 (“Chothia” numbering scheme).

[0496] As used herein, the term "binding domain" or "antibody molecule" refers to a protein containing at least one immunoglobulin variable domain sequence, such as an immunoglobulin chain or fragment thereof. The term "binding domain" or "antibody molecule" encompasses both antibodies and antibody fragments. In one embodiment, the antibody molecule is a multispecific antibody molecule, for example, it contains multiple immunoglobulin variable domain sequences, wherein a first immunoglobulin variable domain sequence of the multiple immunoglobulin variable domain sequences has binding specificity against a first epitope and a second immunoglobulin variable domain sequence of the multiple immunoglobulin variable domain sequences has binding specificity against a second epitope. In one embodiment, the multispecific antibody molecule is a bispecific antibody molecule. A bispecific antibody is specific to no more than two antigens. A bispecific antibody molecule is characterized by a first immunoglobulin variable domain sequence having binding specificity against a first epitope and a second immunoglobulin variable domain sequence having binding specificity against a second epitope.

[0497] The CAR of the present invention, comprising an antibody or an antibody fragment thereof, can exist in various forms, wherein the antigen-binding domain is expressed as a continuous polypeptide chain, such as including single-domain antibody fragments (sdAbs), single-chain antibodies (scFvs), humanized antibodies, or bispecific antibodies (Harlow et al., 1999, cited in: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, cited in: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426). In one aspect, the antigen-binding domain of the CAR composition of the present invention comprises an antibody fragment. In yet another aspect, the CAR comprises an antibody fragment constituting an scFv.

[0498] The term "antibody heavy chain" refers to the larger of two types of polypeptide chains present in an antibody molecule in their natural conformation, which normally determines the class of antibody.

[0499] The term "antibody light chain" refers to the smaller of two types of polypeptide chains present in antibody molecules in their native conformation. The kappa (κ) light chain and the lambda (λ) light chain refer to the two main isotypes of antibody light chains.

[0500] The term "recombinant antibody" refers to an antibody generated using recombinant DNA technology, such as an antibody expressed via a phage or yeast expression system. This term should also be interpreted as referring to an antibody produced by synthesizing a DNA molecule encoding an antibody and expressing an antibody protein or a DNA molecule specifying the amino acid sequence of an antibody, wherein the DNA or amino acid sequence has been obtained using recombinant DNA or amino acid sequencing technologies available and well-known in the art.

[0501] The term "antigen" or "Ag" refers to a molecule that elicits an immune response. This immune response may involve antibody production, activation of specific immune-active cells, or both. Those skilled in the art will understand that any macromolecule, including virtually all proteins or peptides, can act as an antigen. Additionally, antigens can be derived from recombinant DNA or genomic DNA. Those skilled in the art will understand that any DNA containing a nucleotide sequence or a portion of a protein encoding a protein thus encodes an "antigen" as used herein, wherein the protein elicits an immune response. Furthermore, those skilled in the art will understand that an antigen need not be entirely encoded by the full-length nucleotide sequence of a gene. It will be readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences are arranged in various combinations to encode polypeptides that elicit the desired immune response. Furthermore, those skilled in the art will understand that an antigen need not necessarily be encoded by a "gene" at all. It will be apparent that antigens can be generated, synthesized, or derived from biological samples, or may be macromolecules in addition to polypeptides. Such biological samples may include, but are not limited to, tissue samples, tumor samples, cells, or fluids having other biological components.

[0502] The term "anticancer effect" refers to biological effects that can be demonstrated through a variety of means, including but not limited to, reductions in tumor volume, number of cancer cells, number of metastases, life expectancy, cancer cell proliferation, cancer cell survival, or improvement in various physiological symptoms associated with cancer. "Anticancer effect" can also be demonstrated through the ability of peptides, polynucleotides, cells, and antibodies to prevent cancer from appearing at its initial site. The term "antitumor effect" refers to biological effects that can be demonstrated through a variety of means, including but not limited to, reductions in tumor volume, number of tumor cells, tumor cell proliferation, or tumor cell survival.

[0503] The term "self" refers to any substance that is derived from the same individual to which it will be introduced again later.

[0504] The term "allogeneic" refers to any substance derived from a different animal of the same species as the individual from which the substance was introduced. Two or more individuals are allologous to each other when the genes at one or more loci are not identical. In some respects, allologous substances from individuals of the same species can be genetically significantly dissimilar to allow for antigenic interactions.

[0505] The term "heterogeneous" refers to a transplant derived from an animal of a different species.

[0506] The term "cancer" refers to a disease characterized by the uncontrolled growth of abnormal cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers are described in this article, and they include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, etc. The terms "tumor" and "cancer" are used interchangeably in this article; for example, both terms cover solid tumors and fluid-filled tumors, such as diffuse or circulating tumors. As used herein, the terms "cancer" or "tumor" include both pre-malignant and malignant cancers and tumors.

[0507] "Derived from," as the term is used herein, indicates a relationship between the first and second molecules. It generally refers to the structural similarity between the first and second molecules and does not imply or exclude process or source restrictions on the first molecule derived from the second molecule. For example, in the case where an intracellular signal transduction domain is derived from a CD3ζ molecule, the intracellular signal transduction domain retains sufficient CD3ζ structure to possess the required function, i.e., the ability to generate a signal under suitable conditions. It does not imply or exclude restrictions on the specific process for generating the intracellular signal transduction domain; for example, it does not imply that, in order to provide the intracellular signal transduction domain, it is necessary to start from the CD3ζ sequence and delete unwanted sequences, or to mutate it, to obtain the intracellular signal transduction domain.

[0508] The phrase “diseases associated with tumor antigen expression as described herein” includes, but is not limited to, diseases associated with tumor antigen expression as described herein or conditions associated with cells expressing tumor antigens as described herein, such as proliferative disorders like cancer or malignancies or precancerous conditions like myelodysplastic syndromes, myelodysplastic syndromes, or preleukemia; or non-cancer-related indications associated with cells expressing tumor antigens as described herein. In one aspect, cancer associated with tumor antigen expression as described herein is a hematologic cancer. In another aspect, cancer associated with tumor antigen expression as described herein is a solid cancer. Other diseases associated with tumor antigen expression as described herein include, but are not limited to, atypical and / or nonclassical cancers, malignancies, precancerous conditions, or proliferative disorders associated with tumor antigen expression as described herein. Non-cancer-related indications associated with tumor antigen expression as described herein include, but are not limited to, autoimmune diseases (e.g., lupus), inflammatory diseases (allergies and asthma), and transplantation. In some embodiments, cells expressing tumor antigens express or at any time express mRNA encoding tumor antigens. In one embodiment, cells expressing tumor antigens produce tumor antigen proteins (e.g., wild-type or mutant), and the tumor antigen proteins may be present at normal or reduced levels. In another embodiment, cells expressing tumor antigens produce detectable levels of tumor antigen proteins at one point in time and subsequently produce substantially no detectable levels of tumor antigen proteins.

[0509] The term "conserved sequence modification" refers to amino acid modifications that do not significantly affect or alter the binding characteristics of an antibody or antibody fragment containing an amino acid sequence. These types of conserved modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into the antibodies or antibody fragments of the present invention using standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. A conserved amino acid substitution is an amino acid substitution in which an amino acid residue is replaced by an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids having basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), β-side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, one or more amino acid residues within the CAR of this invention can be replaced with other amino acid residues from the same side chain family, and the modified CAR can be tested using the functional assays described herein.

[0510] The term "stimulation" refers to a primary response induced by the binding of a stimulating molecule (e.g., a TCR / CD3 complex or CAR) to its homologous ligand (or, in the case of CAR, a tumor antigen), which thus mediates signal transduction events, such as, but not limited to, signal transduction via the TCR / CD3 complex or via the signal transduction domains of a suitable NK receptor or CAR. Stimulation can mediate changes in the expression of certain molecules.

[0511] The term "stimulatory molecule" refers to a molecule expressed by immune cells (e.g., T cells, NK cells, B cells) that provides a cytoplasmic signaling sequence that stimulatorily regulates immune cell activation relative to at least some aspects of immune cell signaling pathways. In one aspect, the signal is a primary signal that is triggered, for example, by the binding of the TCR / CD3 complex to a peptide-carrying MHC molecule and leads to a T cell response, including but not limited to, proliferation, activation, differentiation, etc. The primary cytoplasmic signaling sequence acting in a stimulatory manner (also referred to as a "primary signaling domain") may contain a signaling motif called an immune receptor tyrosine-based activation motif or ITAM. Examples of ITAMs containing cytoplasmic signaling sequences particularly useful in this invention include, but are not limited to, those derived from CD3ζ, common FcRγ (FCER1G), FcγRIIa, FcRβ (FcεR1b), CD3γ, CD3δ, CD3ε, CD79a, CD79b, DAP10, and DAP12. In a specific CAR of the present invention, the intracellular signal transduction domain of any one or more CARs of the present invention comprises an intracellular signal transduction sequence, for example, a primary signal transduction sequence of CD3-ζ. In a specific CAR of the present invention, the primary signal transduction sequence of CD3-ζ is the sequence provided in SEQ ID NO:18 or an equivalent residue from a non-human species (e.g., mouse, rodent, monkey, ape, etc.). In a specific CAR of the present invention, the primary signal transduction sequence of CD3-ζ is the sequence provided in SEQ ID NO:20 or an equivalent residue from a non-human species (e.g., mouse, rodent, monkey, ape, etc.).

[0512] The term "antigen-presenting cell" or "APC" refers to immune system cells, such as accessory cells (e.g., B cells, dendritic cells, etc.), that present foreign antigens complexed with the major histocompatibility complex (MHC) on their surface. T cells can recognize these complexes using their T cell receptors (TCRs). APCs process antigens and present them to T cells.

[0513] As used herein, the term "intracellular signaling domain" refers to the intracellular portion of a molecule. Intracellular signaling domains generate signals that promote immune effector functions in CAR-containing cells (e.g., CAR-T cells). Examples of immune effector functions (e.g., in CAR-T cells) include cytolytic activity and cofactor activities, including the secretion of cytokines.

[0514] In one embodiment, the intracellular signaling domain may include a primary intracellular signaling domain. Exemplary primary intracellular signaling domains include those derived from molecules responsible for primary or antigen-dependent stimulation. In one embodiment, the intracellular signaling domain may include a co-stimulatory intracellular domain. Exemplary co-stimulatory intracellular signaling domains include those derived from molecules responsible for co-stimulatory signals or antigen-independent stimulation. For example, in the case of CAR-T, the primary intracellular signaling domain may include a cytoplasmic sequence of a T cell receptor, and the co-stimulatory intracellular signaling domain may include a cytoplasmic sequence from a helper receptor or co-stimulatory molecule.

[0515] Primary intracellular signal transduction domains may contain signal transduction motifs called immune receptor tyrosine-based activation motifs or ITAMs. Examples of primary cytoplasmic signal transduction sequences containing ITAMs include, but are not limited to, those derived from CD3ζ, common FcRγ (FCER1G), FcγRIIa, FcRβ (FcεR1b), CD3γ, CD3δ, CD3ε, CD79a, CD79b, DAP10, and DAP12.

[0516] The term “ζ” or alternatively “ζ chain,” “CD3-ζ,” or “TCR-ζ” is defined as a protein or equivalent residue from a non-human species (e.g., mice, rodents, monkeys, apes, etc.) as provided in GenBank accession number BAG36664.1, and “ζ stimulatory domain” or alternatively “CD3-ζ stimulatory domain” or “TCR-ζ stimulatory domain” is defined as an amino acid residue from the ζ chain cytoplasmic domain or a functional derivative thereof, said amino acid residue being sufficient to functionally propagate the initial signal necessary for T cell activation. In one aspect, the ζ cytoplasmic domain comprises residues 52 to 164 of GenBank accession number BAG36664.1 or equivalent residues from a non-human species (e.g., mice, rodents, monkeys, apes, etc.) as its functional ortholog. In one aspect, the “ζ stimulatory domain” or “CD3-ζ stimulatory domain” is the sequence provided as SEQ ID NO:18. In one respect, the “ζ-stimulatory domain” or “CD3-ζ-stimulatory domain” is the sequence provided as SEQ ID NO:20.

[0517] The term "co-stimulatory molecule" refers to a homologous binding partner on a T cell that specifically binds to a co-stimulatory ligand, thereby mediating co-stimulatory responses (such as, but not limited to, proliferation) on the T cell. Co-stimulatory molecules are cell surface molecules, other than antigen receptors or their ligands, that contribute to an efficient immune response. Co-stimulatory molecules include, but are not limited to, MHC class I molecules, BTLA and Toll ligand receptors, as well as OX40, CD27, CD28, CDS, ICAM-1, LFA-1 (CD11a / CD18), ICOS (CD278), and 4-1BB (CD137). Other examples of such co-stimulatory molecules include CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA- 1. ITGB7, NKG2D, NKG2C, TNFR2, TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, and ligands that specifically bind to CD83.

[0518] Co-stimulatory intracellular signal transduction domains can be the intracellular portion of co-stimulatory molecules. Co-stimulatory molecules can be found in the following protein families: TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signal transduction lymphocyte activation molecules (SLAM proteins), and activated NK cell receptors. Examples of these molecules include CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD2, CDS, CD7, CD287, LIGHT, NKG2C, NKG2D, SLAMF7, NKp80, NKp30, NKp44, NKp46, CD160, B7-H3, and ligands that specifically bind to CD83.

[0519] Intracellular signal transduction domains may contain the complete intracellular portion of molecules from which they are derived, or the complete natural intracellular signal transduction domain or its functional fragments or derivatives.

[0520] The term "4-1BB" refers to a member of the TNFR superfamily having the amino acid sequence provided as GenBank accession number AAA62478.2 or equivalent residues from non-human species (e.g., mice, rodents, monkeys, apes, etc.); and the "4-1BB co-stimulatory domain" is defined as amino acid residues 214-255 of GenBank accession number AAA62478.2 or equivalent residues from non-human species (e.g., mice, rodents, monkeys, apes, etc.). In one aspect, the "4-1BB co-stimulatory domain" is the sequence provided as SEQ ID NO:14 or equivalent residues from non-human species (e.g., mice, rodents, monkeys, apes, etc.).

[0521] As used herein, the term "immune effector cell" refers to cells involved in immune responses, such as those involved in promoting immune effector responses. Examples of immune effector cells include T cells, such as α / β T cells and γ / δ T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloid cell-derived phagocytes.

[0522] As used herein, "immune effector function or immune effector response" refers, for example, the enhancement or promotion of immune attack on target cells by immune effector cells. For instance, immune effector function or response refers to T cell or NK cell characteristics that promote the killing of target cells or inhibit the growth or proliferation of target cells. In the case of T cells, primary stimulation and co-stimulation are examples of immune effector function or response.

[0523] The term "encoding" refers to the intrinsic property of a specific nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules having defined nucleotide sequences (e.g., rRNA, tRNA, and mRNA) or defined amino acid sequences during biological processes, and the biological properties resulting from it. Therefore, if the transcription and translation of the mRNA corresponding to a gene produces a protein in a cell or other biological system, the gene, cDNA, or RNA encodes that protein. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and is typically provided in the sequence listing, and the non-coding strand used as a template for gene or cDNA transcription, can be referred to as the protein or other product encoding that gene or cDNA.

[0524] Unless otherwise stated, "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate forms of each other and encode the same amino acid sequence. A phrase encoding a protein or RNA "nucleotide sequence" may also include introns to such an extent that a nucleotide sequence encoding a protein may contain introns in some form.

[0525] The terms “effective amount” or “therapeutic effective amount” are used interchangeably in this document and refer to the amount of a compound, formulation, material or composition that is effective in achieving a particular biological outcome as described herein.

[0526] The term "endogenous" refers to any substance that originates from or is produced within a living organism, cell, tissue, or system.

[0527] The term "exogenous" refers to any substance introduced from or produced outside of a living organism, cell, tissue, or system.

[0528] The term "expression" refers to the transcription and / or translation of a specific nucleotide sequence driven by a promoter.

[0529] The term "transfer vector" refers to a composition of substances containing isolated nucleic acids and capable of delivering those isolated nucleic acids into the interior of cells. Numerous vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides that bind to ions or amphoteric compounds, plasmids, and viruses. Therefore, the term "transfer vector" includes autonomously replicating plasmids or viruses. This term should also be interpreted to further include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as polylysine compounds, liposomes, etc. Examples of viral transfer vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, etc.

[0530] The term "expression vector" refers to a vector containing a recombinant polynucleotide that includes an expression control sequence effectively linked to a nucleotide sequence to be expressed. The expression vector contains sufficient cis-acting elements for expression; other expression elements may be supplied by a host cell or in an in vitro expression system. Expression vectors include all those known in the art, including visceral particles, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) incorporating the recombinant polynucleotide.

[0531] The terms "homologous" or "identical" refer to the identity of secondary unit sequences between two polymer molecules (e.g., between two nucleic acid molecules, such as two DNA molecules or two RNA molecules, or between two polypeptide molecules). When the secondary unit positions in two molecules are occupied by the same monomeric secondary units—for example, if a position in each of two DNA molecules is occupied by adenine—they are homologous or identical at that position. The identity between two sequences varies directly with the number of matching or homologous positions; for example, if half the positions in two sequences (e.g., five positions in a polymer of ten secondary units in length) are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., nine out of ten positions) are matching or homologous, the two sequences are 90% homologous.

[0532] A “humanized” form of a non-human (e.g., mouse) antibody is a chimeric immunoglobulin, immunoglobulin chain, or fragment thereof (such as the Fv, Fab, Fab', F(ab')2, or other antigen-binding sequence of an antibody) containing a minimal sequence derived from a non-human immunoglobulin. In most cases, humanized antibodies and their fragments are these human immunoglobulins (recipient antibodies or antibody fragments) in which residues in the complementarity-determining region (CDR) from the recipient are replaced with residues in the CDR from a non-human species (donor antibody) such as mouse, rat, or rabbit, possessing the desired specificity, affinity, and capability. In some cases, Fv framework region (FR) residues of human immunoglobulins are replaced with corresponding non-human residues. Additionally, humanized antibodies / antibody fragments may contain residues not present in either the recipient antibody or the input CDR or framework sequence. These modifications can further refine and optimize antibody or antibody fragment performance. Typically, humanized antibodies or antibody fragments thereof will substantially contain all of at least one, and generally two, variable domains, wherein all or substantially all of the CDR regions correspond to those CDR regions of non-human immunoglobulins and all or a significant portion of the FR regions are those FR regions having human immunoglobulin sequences. Humanized antibodies or antibody fragments may also contain at least a portion of immunoglobulin constant regions (Fc), typically constant regions of human immunoglobulins. For further details, see Jones et al., Nature, 321:522-525, 1986; Reichmann et al., Nature, 332:323-329, 1988; Presta, Curr. Op. Struct. Biol., 2:593-596, 1992.

[0533] "Whole human" refers to immunoglobulins, such as antibodies or antibody fragments, in which the entire molecule is of human origin or consists of the same amino acid sequence as the human form of the antibody or immunoglobulin.

[0534] The term "isolated" means altered or removed from its natural state. For example, nucleic acids or peptides that are naturally present in living organisms are not "isolated," but the same nucleic acids or peptides that are partially or completely separated from their natural counterparts are "isolated." Isolated nucleic acids or proteins may exist in a substantially purified form or may exist in non-natural environments (such as host cells).

[0535] The term "effective linkage" or "transcriptional control" refers to a functional linkage between a regulatory sequence and a heterologous nucleic acid sequence that results in the expression of the heterologous nucleic acid sequence. For example, the first nucleic acid sequence is effectively linked to the second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. Similarly, if a promoter affects the transcription or expression of a coding sequence, the promoter is effectively linked to the coding sequence. Effectively linked DNA sequences can be adjacent to each other and, for example, within the same reading frame in cases where two protein-coding regions need to be linked.

[0536] The term "parenteral" administration of an immunogenic composition includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im), or intrasternal injection, intratumoral, or infusion techniques.

[0537] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term includes nucleic acids containing known analogs of natural nucleotides, which have similar binding properties to a reference nucleic acid and are metabolized in a manner similar to that of naturally occurring nucleotides. Unless otherwise stated, a particular nucleic acid sequence also inherently includes variants of its conserved modifications (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as explicitly indicated sequences. Specifically, degenerate codon substitution can be achieved by generating a sequence in which the third position of one or more selected (or all) codons is replaced with a mixed set of bases and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081, (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608, (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98, (1994)).

[0538] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limitation on the maximum number of amino acids that can constitute a protein or peptide. A polypeptide includes any peptide or protein containing two or more amino acids linked together by peptide bonds. As used herein, the term refers to a short chain, such as peptides, oligopeptides, and oligomers commonly referred to in the art, and also to a longer chain, typically referred to in the art as a protein, which exists in many types. “Polypeptide” includes, for example, biologically active fragments of polypeptides, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants, modified polypeptides, derivatives, analogs, fusion proteins, and so on. Polypeptides include native peptides, recombinant peptides, or combinations thereof.

[0539] The term "promoter" refers to a DNA sequence that is recognized by the cell's synthetic apparatus or an introduced synthetic apparatus and is required for the specific transcription of a polynucleotide sequence.

[0540] The term "promoter / regulatory sequence" refers to the nucleic acid sequence required to express a gene product that is effectively linked to a promoter / regulatory sequence. In some cases, this sequence may be a core promoter sequence, and in others, it may also contain enhancer sequences and other regulatory elements required to express the gene product. Promoter / regulatory sequences can be, for example, those that express the gene product in a tissue-specific manner.

[0541] The term "constitutive" promoter refers to the nucleotide sequence that, when effectively linked to a polynucleotide encoding or defining a gene product, causes the gene product to be produced in the cell under most or all of the cell's physiological conditions.

[0542] The term "inducible" promoter refers to a nucleotide sequence that, when effectively linked to a polynucleotide encoding or defining a gene product, causes the gene product to be produced in the cell essentially only when an inducer corresponding to that promoter is present in the cell.

[0543] The term "tissue-specific" promoter refers to a nucleotide sequence that, when effectively linked to a gene-encoded or specified polynucleotide, causes the gene product to be produced in cells that are essentially only produced by cells of the tissue type corresponding to that promoter.

[0544] The terms "cancer-associated antigen" or "tumor antigen" are interchangeable in referring to molecules (generally proteins, sugars, or lipids) that are expressed intact or as fragments (e.g., MHC / peptides) on the surface of cancer cells and can be used to preferentially guide pharmacological substances to cancer cells. In some embodiments, the tumor antigen is a marker expressed by both normal cells and cancer cells, such as a lineage marker, for example, CD19 on B cells. In some embodiments, the tumor antigen is a cell surface molecule that is overexpressed in cancer cells compared to normal cells, for example, by 1-fold, 2-fold, 3-fold, or more. In some embodiments, the tumor antigen is a cell surface molecule that is not suitably synthesized in cancer cells, for example, containing molecules with deletions, additions, or mutations compared to molecules expressed on normal cells. In some embodiments, the tumor antigen will be exclusively expressed intact or as fragments (e.g., MHC / peptides) on the surface of cancer cells and will not be synthesized or expressed on the surface of normal cells. In some embodiments, the CAR of the present invention comprises an antigen-binding domain (e.g., an antibody or antibody fragment) that binds to a peptide presented by MHC. Typically, peptides derived from endogenous proteins fill the pockets of major histocompatibility complex (MHC) class I molecules and are recognized by T cell receptors (TCRs) on CD8+ T lymphocytes. MHC class I complexes are constitutively expressed by all nucleated cells. In cancer, virus-specific and / or tumor-specific peptide / MHC complexes represent a unique class of cell surface targets for immunotherapy. TCR-like antibody targeting peptides derived from viral or tumor antigens in the context of human leukocyte antigen (HLA)-A1 or HLA-A2 have been described (see, for example, Sastry et al., J Virol. 2011 85(5):1935-1942; Sergeeva et al., Blood, 2011 117(16):4262-4272; Verma et al., J Immunol 2010 184(4):2156-2165; Willemsen et al., Gene Ther 2001 8(21):1601-1608; Dao et al., Sci Transl Med 2013 5(176):176ra33; Tassev et al., Cancer Gene Ther 2012 19(2):84-100). For example, TCR-like antibodies can be identified by screening libraries, such as human scFv phage display libraries.

[0545] The terms "tumor support antigen" or "cancer support antigen" are interchangeable terms for molecules (typically proteins, sugars, or lipids) expressed on the surface of cells that are not cancerous themselves but support cancer cells, for example, by promoting their growth or survival (e.g., immune cell resistance). Exemplary cells of this type include mesenchymal cells and myeloid-derived suppressor cells (MDSCs). The tumor support antigen itself does not need to function on cells supporting tumors; its mere presence on cells supporting cancer cells is sufficient.

[0546] As used in the context of scFv, the term "flexible peptide linker" or "linker" refers to a peptide linker composed of amino acid residues such as glycine and / or serine, wherein the peptide linker is used alone or in combination to link a variable heavy chain region and a variable light chain region together. In one embodiment, the flexible peptide linker is a Gly / Ser linker and comprises the amino acid sequence (Gly-Gly-Gly-Ser)n, where n is a positive integer equal to or greater than 1. For example, n = 1, n = 2, n = 3, n = 4, n = 5 and n = 6, n = 7, n = 8, n = 9 and n = 10 (SEQ ID NO: 6592). In one embodiment, the flexible peptide linker comprises, but is not limited to, (Gly4Ser)4 (SEQ ID NO: 6593) or (Gly4Ser)3 (SEQ ID NO: 6594). In another embodiment, the linker comprises a plurality of repeating sequences of (Gly2Ser), (GlySer), or (Gly3Ser) (SEQ ID NO: 6595). The scope of this invention also includes connectors described in WO 2012 / 138475, which is incorporated herein by reference.

[0547] As used in this article in relation to messenger RNA (mRNA), the 5' cap (also called the RNA cap, RNA 7-methylguanosine cap, or RNA m7G cap) is a modified guanine nucleotide added immediately after the transcription start point to the "front" or 5' end of eukaryotic messenger RNA. The 5' cap consists of a terminal group attached to the first nucleotide transcribed. Its presence is crucial for ribosome recognition and protection from RNase activity. Cap addition is transcription-coupled and occurs in a co-transcriptional manner, with each influencing the other. Shortly after transcription initiation, the 5' end of the synthesizing mRNA is constrained by a cap-synthesis complex bound to RNA polymerase. This enzymatic complex catalyzes the chemical reactions required for mRNA capping. The synthesis process proceeds as a multi-step biochemical reaction. The capping portion can be modified to regulate mRNA function, such as its stability or translation efficiency.

[0548] As used herein, "in vitro transcribed RNA" refers to RNA, preferably mRNA, that has been synthesized in vitro. Typically, in vitro transcribed RNA is produced from an in vitro transcription vector. The in vitro transcription vector includes a template used to produce the in vitro transcribed RNA.

[0549] As used herein, "polyadenylation" refers to a series of adenosines linked to mRNA via polyadenylation. In a preferred embodiment of the transient expression construct, the number of polyadenylations is between 50 and 5000 (SEQ ID NO: 6596), preferably greater than 64, more preferably greater than 100, and most preferably greater than 300 or 400. The polyadenylation sequence can be chemically or enzymatically modified to modulate mRNA functions such as localization, stability, or translation efficiency.

[0550] As used herein, “polyadenylation” refers to the covalent attachment of a polyadenylated moiety or its modified variant to a messenger RNA molecule. In eukaryotes, most messenger RNA (mRNA) molecules are polyadenylated at the 3' end. The 3' polyadenylated tail is added to a long adenine nucleotide sequence (often several hundred) of the pre-mRNA by the action of an enzyme (polyadenylate polymerase). In higher eukaryotes, the polyadenylated tail is added to transcripts containing a specific sequence (polyadenylation signal). The polyadenylated tail and the proteins bound to it help protect mRNA from exonuclease degradation. Polyadenylation is also important for transcription termination, mRNA export from the nucleus, and translation. Polyadenylation occurs immediately in the nucleus after DNA is transcribed into RNA, but can also occur later in the cytoplasm. After transcription has terminated, the mRNA chain is cleaved by an endonuclease complex bound to RNA polymerase. The cleavage site is typically characterized by the presence of the base sequence AAUAAA near the cleavage site. After the mRNA has been cleaved, adenosine residues are added to the free 3' end at the cleavage site.

[0551] As used in this article, “transient” refers to the expression of a non-integrated transgene over a period of hours, days, or weeks, which is shorter than the expression period if the gene is integrated into the genome in the host cell or contained within a stable plasmid replicon.

[0552] As used herein, the terms “treatment,” “therapy,” and “therapist” refer to the reduction or improvement of the progression, severity, and / or duration of proliferative disease, or the improvement of one or more symptoms (preferably one or more perceptible symptoms) of proliferative disease resulting from the application of one or more therapies (e.g., one or more therapeutic agents such as the CAR of the present invention). In specific embodiments, “treatment,” “therapy,” and “therapist” refer to the improvement of at least one measurable bodily parameter of proliferative disease, such as tumor growth, which is not necessarily perceptible to the patient. In other embodiments, “treatment,” “therapy,” and “therapist” refer to the inhibition of the progression of proliferative disease physically (e.g., by stabilizing perceptible symptoms), physiologically (e.g., by stabilizing bodily parameters), or both. In other embodiments, “treatment,” “therapy,” and “therapist” refer to a reduction or stabilization of tumor size or cancer cell count.

[0553] The term "signal transduction pathway" refers to the biochemical relationships among various signal transduction molecules that play a role in transmitting signals from one part of the cell to another. The phrase "cell surface receptor" includes molecules and molecular complexes capable of receiving signals and transmitting signals across the cell membrane.

[0554] The term "subject" is intended to include living organisms (e.g., mammals, humans) in which an immune response can be elicited.

[0555] The term "substantially purified" cells refer to cells that are substantially free of other cell types. Substantially purified cells also refer to cells that have been separated from other cell types that they normally associate with in their natural state. In some cases, a substantially purified cell population refers to a homogeneous cell population. In other cases, the term simply refers to cells that have been separated from the cells that naturally associate with them in their natural state. In some respects, the cells are cultured in vitro. In other respects, the cells are not cultured in vitro.

[0556] As used in this article, the term "therapeutic" means treatment. Therapeutic effects are achieved by reducing, suppressing, alleviating, or eradicating a disease state.

[0557] As used in this article, the term "prevention" refers to the prevention or protective treatment of a disease or disease state.

[0558] In the context of this invention, "tumor antigen," "hyperproliferative disease antigen," or "antigen associated with hyperproliferative disease" refers to antigens commonly found in specific hyperproliferative diseases. In some aspects, the hyperproliferative disease antigens of this invention are derived from cancers, including but not limited to primary or metastatic melanoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, non-Hodgkin lymphoma, Hodgkin lymphoma, leukemia, uterine cancer, cervical cancer, bladder cancer, kidney cancer, and adenocarcinomas such as breast cancer, prostate cancer, ovarian cancer, and pancreatic cancer.

[0559] The terms "transfection," "transformation," or "transduction" refer to the process of transferring or introducing exogenous nucleic acids into host cells. "Transfected," "transformed," or "transduced" cells are cells that have been transfected, transformed, or transduced with exogenous nucleic acids. Cells include primary host cells and their progeny.

[0560] The term "specific binding" refers to a molecule that recognizes and binds to a binding partner (e.g., a protein or nucleic acid) present in a sample, but does not substantially recognize or bind to other molecules in the sample.

[0561] As used herein, “membrane anchor” or “membrane-binding domain” refers to a polypeptide or portion sufficient to anchor an extracellular or intracellular domain to the plasma membrane, such as myristoyl.

[0562] The term "bioequivalent" refers to the amount of drug other than the reference compound (e.g., RAD001) required to produce an effect equivalent to that produced by a reference dose or reference amount of the reference compound (e.g., RAD001). In one embodiment, the effect is an mTOR inhibition level, for example, as measured by P70 S6 kinase inhibition, for example, as evaluated in vivo or in vitro assays, for example, as measured by the assays described herein (e.g., Boulay assay). In one embodiment, the effect is a change in the ratio of PD-1 positive / PD-1 negative T cells, as measured by cell sorting. In one embodiment, the bioequivalent amount or dose of the mTOR inhibitor is the amount or dose that achieves the same P70 S6 kinase inhibition level as the reference dose or reference amount of the reference compound. In one embodiment, the bioequivalent amount or dose of the mTOR inhibitor is the amount or dose that achieves the same level of change in the PD-1 positive / PD-1 negative T cell ratio as the reference dose or reference amount of the reference compound.

[0563] When referring to the use of mTOR inhibitors (e.g., allosteric mTOR inhibitors, such as RAD001 or rapamycin, or catalytic mTOR inhibitors), the term "immunoenhancing low dose" refers to an mTOR inhibitor dose that partially, but not completely, inhibits mTOR activity (e.g., as measured by inhibition of P70 S6 kinase activity). Methods for evaluating mTOR activity (e.g., by inhibition of P70 S6 kinase) are discussed herein. This dose is insufficient to cause complete immunosuppression but sufficient to enhance the immune response. In one embodiment, an immunoenhancing low dose of the mTOR inhibitor results in a decrease in the number of PD-1 positive T cells and / or an increase in the number of PD-1 negative T cells, or an increase in the ratio of PD-1 negative T cells to PD-1 positive T cells. In one embodiment, an immunoenhancing low dose of the mTOR inhibitor results in an increase in the number of naive T cells. In one embodiment, an immunoenhancing low dose of the mTOR inhibitor results in one or more of the following:

[0564] Increased expression of one or more of the following markers: for example, CD62Lhigh, CD127high, CD27+, and BCL2 on memory T cells (e.g., memory T cell precursors);

[0565] Reduced expression of KLRG1 on memory T cells (e.g., memory T cell precursors); and

[0566] An increase in the number of memory T cell precursors, which are, for example, cells having any one or a combination of the following characteristics: CD62L high Add, CD127 high Add, CD27 + Increase, KLRG1 decreases and BCL2 increases;

[0567] For example, any of the changes described above may occur, for instance, at least temporarily, compared to untreated subjects.

[0568] As used herein, "refractory" refers to a disease that does not respond to treatment, such as cancer. In one implementation, refractory cancer may be resistant to treatment before or at the start of treatment. In other implementations, refractory cancer may become resistant to treatment during treatment. Refractory cancer is also known as drug-resistant cancer.

[0569] As used herein, “relapse” means the return of disease (e.g., cancer) or disease (e.g., cancer) signs and symptoms after a phase of improvement (e.g., after prior treatment with a therapy (e.g., cancer therapy)).

[0570] Scope: Throughout this disclosure, various aspects of the invention may be shown in a scope format. It should be understood that the scope format description is for convenience and brevity purposes only and should not be construed as rigidly limiting the scope of the invention. Therefore, a scope description should be considered to have all possible sub-scopes specifically disclosed and various numerical values ​​within that scope. For example, a scope such as 1 to 6 should be considered to have specifically disclosed sub-scopes such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., and various numerical values ​​within that scope, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. As another example, a scope (such as 95-99% identity) includes scopes having 95%, 96%, 97%, 98%, or 99% identity, and includes sub-scopes such as 96-99%, 96-98%, 96-97%, 97-99%, 97-98%, and 98-99% identity. This applies regardless of the width of the scope. Invention Details

[0572] The gRNA molecules, compositions, and methods described herein relate to genome editing in eukaryotic cells using a CRISPR / Cas system (e.g., the Cas9 system). Specifically, the gRNA molecules, compositions, and methods described herein relate to regulating the expression (or the expression of a functional form thereof) of target molecules that affect the function of transplanted cells (e.g., cells used for cancer immunotherapy). In one aspect, the transplanted cells are immune effector cells, such as NK cells or T cells. In another aspect, the cells are allogeneic cells. In another aspect, the cells have been, are being, or will be engineered to express chimeric antigen receptors. Therefore, this document provides compositions and methods for altering (e.g., suppressing or reducing) the expression and / or function (e.g., the expression level of the functional form) of gene products that can improve the efficacy (e.g., by reducing or eliminating adverse immunogenicity (such as host-graft resistance or graft-versus-host disease)), function, proliferation, stimulation, or survival of transplanted cells (e.g., transplanted immune effector cells, such as NK cells or T cells, such as T cells engineered to express chimeric antigen receptor (CAR), such as allogeneic T cells expressing CAR for immunotherapy).

[0573] In several respects, the gene product is an allogeneic T cell target, such as T cell receptor components, for example, CD3ζ, CD3ε, CD3γ, CD3δ, T cell receptor (TCR) α or TCRβ; HLA molecules or β-2 microglobulin (B2M), for example, HLA-A, HLA-B, HLA-C or B2M; CIITA molecules; or targets of immunosuppressants such as glucocorticoid receptors, deoxycytidine kinases, FKBP, CD52 or members of the cyclic protein family; and combinations thereof. Without being bound by theory, it is believed that inhibiting or eliminating the level of allogeneic T cell targets or the expression level of allogeneic T cell target gene products (e.g., by gene alteration) can improve cell function (e.g., transplanted cells, such as transplanted immune effector cells, such as CAR-T cells, such as allogeneic CAR-T cells) by reducing or eliminating graft-versus-host response, host-versus-graft response, or making said transplanted cells resistant to immunosuppressant treatment.

[0574] In one aspect, the compositions and methods described herein can be used to improve the function (e.g., by reducing or eliminating adverse immunogenicity (such as host-to-graft or graft-versus-host disease)), survival, proliferation, and / or efficacy of cells (e.g., T cells, such as CAR-engineered T cells, such as CAR-engineered allogeneic T cells) by altering genes of T cell receptor (TCR) components (e.g., CD3ζ, CD3ε, CD3γ, CD3δ, T cell receptor (TCR) α, such as the constant region of TCRα or TCRβ), such as the constant region 1 or constant region 2 gene of TCRβ. While not wishing to be bound by theory, it is believed that by eliminating T cell receptor recognition and response to host tissues, the reduced or absent expression of functional T cell receptor components reduces or eliminates the presence of TCRs on the cell surface, thereby reducing or preventing graft-versus-host disease. Therefore, this method can be used to generate “ready-made” T cells (Torikai et al., 2012 Blood 119, 5697-5705).

[0575] In one aspect, the compositions and methods described herein can be used to improve the function (e.g., by reducing or eliminating adverse immunogenicity (such as host resistance to graft-versus-host disease)), survival, proliferation, and / or efficacy of cells (e.g., T cells, such as CAR-engineered T cells, such as CAR-engineered allogeneic T cells) by altering genes of components of the major histocompatibility complex (e.g., HLA proteins or B2Ms, such as HLA-A, HLA-B, HLA-C, or B2M (encoded by the B2M gene)) or regulating genes of proteins expressed by one or more components of the major histocompatibility complex (e.g., NLRC5). While not wishing to be bound by theory, it is believed that reducing or eliminating host resistance to graft-versus-host disease by eliminating host T cell receptor recognition and response to mismatched (e.g., allogeneic) graft tissues, or by reducing or eliminating the expression of mismatched (e.g., mismatched types of subjects receiving cell therapy) HLA proteins (or components). Therefore, this approach can be used to generate “off-the-shelf” T cells.

[0576] In one aspect, the compositions and methods described herein can be used to improve the function (e.g., by reducing or eliminating adverse immunogenicity (such as host-graft resistance or graft-versus-host disease)), survival, proliferation, and / or efficacy of cells (e.g., T cells, such as CAR-engineered T cells, such as CAR-engineered allogeneic T cells) by altering the genes of major histocompatibility complex II components or MHC class II expression regulators (e.g., CIITA (encoded by the CIITA gene), RFXANK, RFX5, or RFXAP, and combinations thereof, such as CIITA). While not wishing to be bound by theory, it is believed that reducing or eliminating the expression of regulators of MHC class II expression (e.g., CIITA) will reduce or eliminate the expression of MHC class II molecules on allogeneic cells, thereby reducing or eliminating the expression of mismatched (e.g., mismatched types of subjects receiving cell therapy) MHC class II proteins (or components), and thus reducing or eliminating host resistance to graft disease, for example, by eliminating the recognition and response of host T cell receptors to mismatched (e.g., allogeneic) graft tissues (e.g., allogeneic T cells, such as allogeneic CAR-T cells). Therefore, this approach can be used to generate “ready-made” T cells.

[0577] In one aspect, it may be beneficial to reduce or eliminate the expression of one or more MHC class I molecules and one or more MHC class II molecules, for example, in T cells (e.g., allogeneic T cells, such as allogeneic CART cells as described herein), to further reduce or eliminate host resistance to graft-versus-graft disease upon cell administration. Therefore, in embodiments of the cells and methods of the present invention, cells may be contacted with the compositions of the present invention containing, for example, gRNA molecules targeting B2M as described herein (e.g., compositions containing gRNA and Cas9 molecules) (e.g., such contact reduces or eliminates the expression of one or more MHC class I molecules in the cells) and with the compositions of the present invention containing, for example, gRNA molecules targeting CIITA as described herein (e.g., compositions containing gRNA and Cas9 molecules) (e.g., such contact reduces or eliminates the expression of one or more MHC class II molecules). In embodiments of the cells and methods of the present invention, the cells may also be contacted with the compositions of the present invention (e.g., compositions comprising gRNA and Cas9 molecules) containing gRNA molecules targeting TCR components (e.g., targeting TRAC and / or TRBC) as described herein (e.g., such contact reduces or eliminates the expression of T cell receptors (e.g., one or more TCR components)). In one embodiment, the cells of the present invention have reduced or eliminated TCR expression (e.g., as detected by flow cytometry), reduced or eliminated expression of one or more MHC class I molecules (e.g., as detected by flow cytometry), and reduced or eliminated expression of one or more MHC class II molecules (e.g., as detected by flow cytometry). In one embodiment, the cells of the present invention have reduced or eliminated TRAC expression, reduced or eliminated B2M expression, and reduced or eliminated CIITA expression. In one embodiment, the cells of the present invention have reduced or eliminated TRAC expression, reduced or eliminated NLRC5 expression, and reduced or eliminated CIITA expression. In embodiments, the reduced or eliminated expression is measured relative to similar cells that have not been treated with the compositions of the present invention or the CRISPR system. In one embodiment, the cell is an immune effector cell, such as a T cell or NK cell, for example, the T cell described herein. In another embodiment, the cell is a T cell engineered to express a chimeric antigen receptor (CAR), for example, as described herein. In yet another embodiment, the CAR is, for example, BCMACAR as described herein. In one embodiment, the invention provides cells engineered to express BCMACAR, such as immune effector cells, such as T cells or NK cells, for example, T cells that are TCR- / B2M- / CIITA- or TCR- / NLRC5- / CIITA-. In yet another embodiment, the cell is a human cell. In yet another embodiment, the cell is allogeneic relative to the subject to whom the cell is to be administered.In the embodiments, reduced or eliminated expression of TCR, B2M, NLRC5, and / or CIITA is achieved by introducing, for example, the composition of the present invention described herein, a CRISPR system, or gRNA into the cells, or by methods as described herein.

[0578] In one aspect, the compositions and methods described herein can be used to improve the function (e.g., by reducing or eliminating adverse immunogenicity (such as host resistance to graft-versus-host disease)), survival, proliferation, and / or efficacy of cells (e.g., T cells, such as CAR-engineered T cells, such as CAR-engineered allogeneic T cells) by altering the genes of the target of an immunosuppressant (e.g., glucocorticoid receptor (GR) (encoded by NR3C1)). Without being bound by theory, it is believed that the absence or reduction of functional GR expression on a cell therapy product allows the cell therapy product to function in the presence of immunosuppressants such as corticosteroids such as dexamethasone, for example, when said immunosuppressants are being administered to reduce or eliminate host resistance to graft-versus-host disease. Therefore, this method can be used to generate “off-the-shelf” T cells.

[0579] In one aspect, the compositions and methods described herein can be used to improve the function (e.g., by reducing or eliminating adverse immunogenicity (such as host-to-graft or graft-to-host response)), survival, proliferation, and / or efficacy of cells (e.g., T cells, such as CAR-engineered T cells, such as CAR-engineered allogeneic T cells) by altering the gene of the target of immunosuppressants (e.g., CD52 (encoded by CD52)). Without being bound by theory, it is believed that the absence or reduction of functional CD52 expression on cell therapy products allows the cell therapy product to be used in conjunction with immunosuppressants such as anti-CD52 antibodies or their antigen-binding fragments (e.g., alenzuszczukic acid). These cells function in the presence of conditions such as when the immunosuppressant is being administered to reduce or eliminate host resistance to graft-versus-graft disease. Therefore, this method can be used to generate "ready-made" T cells.

[0580] In one aspect, the compositions and methods described herein can be used to improve the function (e.g., by reducing or eliminating adverse immunogenicity (such as host-versus-graft or graft-versus-host disease)), survival, proliferation, and / or efficacy of cells (e.g., T cells, such as CAR-engineered T cells, such as CAR-engineered allogeneic T cells) by altering the genes of the target of an immunosuppressant (e.g., a member of the FKBP family, such as FKBP12 (encoded by FKBP1A)). Without being bound by theory, it is believed that the absence or reduction of functional FKBP12 expression on a cell therapy product allows the cell therapy product to function in the presence of immunosuppressants such as FK506 (or an FKBP12-binding fragment or an analogue thereof), cyclosporine, rapamycin or rapamycin analogues, or mTor inhibitors such as RAD001, for example, when said immunosuppressants are being administered to reduce or eliminate host-versus-graft disease. Therefore, this method can be used to generate “off-the-shelf” T cells.

[0581] In one aspect, the compositions and methods described herein can be used to improve the function (e.g., by reducing or eliminating adverse immunogenicity (such as host resistance to graft-versus-host disease)), survival, proliferation, and / or efficacy of cells (e.g., T cells, such as CAR-engineered T cells, such as CAR-engineered allogeneic T cells) by altering the genes of the target of an immunosuppressant (e.g., deoxycytidine kinase (encoded by DCK)). Without being bound by theory, it is believed that the absence or reduction of functional deoxycytidine kinase expression on cell therapy products allows the cell therapy products to function in the presence of immunosuppressants such as nucleoside analogues (e.g., cytarabine (pyrimidinyl glycoside) or gemcitabine), for example, when said immunosuppressants are being administered to reduce or eliminate host resistance to graft-versus-host disease or to treat cancer. Therefore, this method can be used to generate “off-the-shelf” T cells.

[0582] In many respects, the gene products are repressive molecules, such as immune checkpoint proteins, including PD-1, PD-L1, PD-L2, CTLA4, TIM3, LAG3, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFβ. Unbound by theory, it is believed that inhibiting or eliminating the level of inhibitory molecules or the expression level of inhibitory molecule gene products (e.g., by altering genes) can improve the function of cells (e.g., transplanted cells, such as transplanted immune effector cells, such as CAR-T cells, such as allogeneic CAR-T cells) by reducing or eliminating the inhibitory effects mediated by said inhibitory molecules.

[0583] In one aspect, the compositions and methods described herein can be used to reduce the effects of immunosuppressive factors on cells (e.g., CAR-engineered T cells) by altering the genes of inhibitory molecules (e.g., PD1). Without wishing to be bound by theory, it is believed that reduced or absent expression of programmed cell death 1 (PD-1) (encoded by PDCD1) eliminates the induction of a repressed or unresponsive state (“anallergic”).

[0584] In one respect, the compositions and methods described herein can be used to reduce the effects of immunosuppressive factors on cells (e.g., CAR-engineered T cells) by altering the genes of inhibitory molecules (e.g., Tim3). Without wishing to be bound by theory, it is believed that reduced or absent expression of Tim3 (encoded by HAVCR2) eliminates the induction of a repressed or unresponsive state (“anallergic”).

[0585] In one aspect, the compositions and methods described herein can be used to reduce the effects of immunosuppressive factors on cells (e.g., CAR-engineered T cells) by altering the genes of inhibitory molecules (e.g., the CTLA4 gene). While not wishing to be bound by theory, it is believed that reduced or absent expression of cytotoxic T-lymphocyte-associated antigen 4 (encoded by CTLA4) eliminates the induction of a repressed or unresponsive state (“anallergic”).

[0586] In one respect, the compositions and methods described herein can be used to reduce the effects of immunosuppressive factors on cells (e.g., CAR-engineered T cells) by altering the genes of repressive molecules (e.g., the Lag3 gene). While not wishing to be bound by theory, it is believed that reduced or absent expression of the lymphocyte activation gene 3 (Lag3) (encoded by LAG3) eliminates the induction of a repressed or unresponsive state (“anallergic”).

[0587] In one aspect, the compositions and methods described herein can be used to reduce the effects of immunosuppressive factors on cells (e.g., CAR-engineered T cells) by altering the genes of repressive molecules (e.g., the PD-L1 gene). Without wishing to be bound by theory, it is believed that reduced or absent expression of programmed death-ligand 1 (PD-L1, also known as CD274 and B7-H1) (encoded by CD274) eliminates the induction of a repressed or unresponsive state (“anallergic”).

[0588] In one aspect, the compositions and methods described herein can be used to reduce the effects of immunosuppressive factors on cells (e.g., CAR-engineered T cells) by altering the genes of downstream effector molecules of inhibitory molecules (e.g., the tyrosine-protein phosphatase non-receptor type 1 gene). Without wishing to be bound by theory, it is believed that by influencing signal transduction via inhibitory molecules, reduced or absent expression of functional tyrosine-protein phosphatase non-receptor type 1 (also known as protein tyrosine phosphatase 1B) (encoded by PTPN1) eliminates the induction of a repressed or unresponsive state (“anallergic”).

[0589] In several respects, the compositions and methods described herein can be combined for generating cells, such as transplanted cells, allogeneic cells, immune effector cells, such as NK cells or T cells, such as CAR-engineered T cells, which have enhanced efficacy (e.g., by reducing or eliminating adverse immunogenicity (such as host-graft resistance or graft-versus-host resistance)), survival, proliferation, and / or stimulatory effects relative to unmodified cells.

[0590] In one embodiment, the compositions and methods described herein can be used to generate cells that have had reduced or eliminated levels or expression levels of functional TCR components and wherein levels or expression levels of functional MHC have been reduced or eliminated. In one embodiment, the cells have reduced or eliminated TCRα and HLA-A levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRα and HLA-B levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRα and HLA-C levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRα and B2M levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRα and NLRC5 levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRβ and HLA-A levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRβ and HLA-B levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRβ and HLA-C levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRβ and B2M levels or expression levels. In one embodiment, the cells have reduced or eliminated TCRβ and NLRC5 levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3ζ and HLA-A levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3ζ and HLA-B levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3ζ and HLA-C levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3ζ and B2M levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3ζ and NLRC5 levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3ε and HLA-A levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3ε and HLA-B levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3ε and HLA-C levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3ε and B2M levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3ε and NLRC5 levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3γ and HLA-A levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3γ and HLA-B levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3γ and HLA-C levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3γ and B2M levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3γ and NLRC5 levels or expression levels.In one embodiment, the cells have reduced or eliminated CD3δ and HLA-A levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3δ and HLA-B levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3δ and HLA-C levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3δ and B2M levels or expression levels. In one embodiment, the cells have reduced or eliminated CD3δ and NLRC5 levels or expression levels. In any of the foregoing embodiments, the cells may have reduced or eliminated CIITA levels or expression levels. In one embodiment, the cells have reduced or eliminated TRBC, B2M, and CIITA levels or expression levels. In one embodiment, the cells have reduced or eliminated TRBC, TRBC, B2M, and CIITA levels or expression levels. In one embodiment, the cells have reduced or eliminated TRBC, TRBC, B2M, and CIITA levels or expression levels. In one embodiment, the cells have reduced or eliminated TRBC, NLRC5, and CIITA levels or expression levels. In one embodiment, the cells have reduced or eliminated levels or expression levels of TRBC, NLRC5, and CIITA. In one embodiment, the cells have reduced or eliminated levels or expression levels of TRAC, TRBC, NLRC5, and CIITA. In any of the foregoing embodiments, the cells may additionally have reduced or eliminated levels or expression levels of one or more inhibitory molecules or downstream effectors of inhibitory molecules. In one aspect, one or more inhibitory molecules include PD-1. In one aspect, one or more inhibitory molecules include PD-L1. In one aspect, one or more inhibitory molecules include Lag3. In one aspect, one or more inhibitory molecules include Tim3. In one aspect, one or more inhibitory molecules include CTLA4. In one aspect, one or more inhibitory molecules include PTPN1. In one aspect, one or more inhibitory molecules include PD-1 and PD-L1. In one aspect, one or more inhibitory mo...

Claims

1. A gRNA molecule containing tracr and crRNA, wherein the crRNA contains a guide domain that is complementary to a target sequence of an allogeneic T cell target selected from B2M, CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, TRBC2, HLA-A, HLA-B, HLA-C, DCK, CD52, FKBP1A, CIITA, NLRC5, RFXANK, RFX5, RFXAP, or NR3C1.

2. A gRNA molecule comprising tracr and crRNA, wherein the crRNA comprises a guidance domain complementary to a target sequence of an inhibitory molecule or a downstream effector that signals via an inhibitory molecule, the target sequence of which is selected from CD274, HAVCR2, LAG3, PDCD1, PD-L2, CTLA4, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD113), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFβ or PTPN11.

3. A composition comprising a first gRNA molecule according to any one of claims 1-2, and further comprising a Cas9 molecule.

4. A composition comprising: a) A first gRNA molecule according to any one of claims 1-2, wherein the guiding domain of the first gRNA molecule is the guiding domain according to any one of claims 2(a), 2(i), 2(j) or 2(k); and b) The second gRNA molecule according to any one of claims 1-2, wherein the guiding domain of the second gRNA molecule is the guiding domain according to any one of claims 2(b), 2(c), 2(d), 2(f), 2(g), 2(h) or 2(i).

5. A nucleic acid sequence encoding a gRNA molecule according to any one of claims 1-2 or a component of the composition according to claim 3 or 4, for example, all components.

6. A vector comprising the nucleic acid according to claim 5.

7. A composition comprising a gRNA molecule according to any one of claims 1-2 and a nucleic acid encoding a Cas9 molecule.

8. A composition comprising a nucleic acid encoding a gRNA molecule according to any one of claims 1-2 and a Cas9 molecule.

9. A method of altering a cell's target sequence, for example, altering its structure, such as altering its sequence, comprising contacting the cell with: a) gRNA molecules (e.g., more than one type of gRNA molecule) and Cas9 molecules according to any one of claims 1-2; b) The gRNA molecule (e.g., more than one type of gRNA molecule) according to any one of claims 1-2 and the nucleic acid encoding the Cas9 molecule; c) Nucleic acid and Cas9 molecule encoding the gRNA molecule (e.g., more than one gRNA molecule) according to any one of claims 1-2; d) Nucleic acid encoding a gRNA molecule (e.g., more than one gRNA molecule) according to any one of claims 1-2 and nucleic acid encoding a Cas9 molecule; e) Any of the items from a) to d) above and the template nucleic acid; f) Any of the items in a) to d) above and nucleic acids containing sequences that encode template nucleic acids; g) The composition according to any one of claims 3 or 7-8; or h) The carrier according to claim 6.

10. Cells, modified by means of the method according to claim 9.

11. A cell comprising a first gRNA molecule according to any one of claims 1-2, or a composition according to any one of claims 3 or 7-8, a nucleic acid according to claim 5, or a vector according to claim 6.

12. A method for providing antitumor immunity in a subject, the method comprising administering to the subject an effective amount of the cells according to claim 10 or 11.

13. A method for treating a subject with a disease associated with tumor antigen expression, such as proliferative diseases associated with tumor antigen expression, precancerous symptoms, cancer and non-cancer related indications, said method comprising administering to the subject an effective amount of the cells according to claim 10 or 11.

14. A method for preparing cells (e.g., cell populations) for immunotherapy, comprising: (a) Modulating cells by reducing or eliminating the expression of T cell receptor (TCR) components, including introducing gRNA molecules according to any one of claims 2b to 2h, for example, more than one gRNA molecule, for example, the gRNA molecule according to claim 1, for example, more than one gRNA molecule; (b) Modulating cells by reducing or eliminating the expression of HLA (e.g., HLA-A, HLA-B, and / or HLA-C) or B2M, including introducing gRNA molecules according to claim 1, for example, more than one gRNA molecule, for example, the gRNA molecule according to claim 1, for example, more than one gRNA molecule; and (c) Expanding the cells.

15. A method for preparing cells (e.g., cell populations) for immunotherapy, comprising: (a) Modulating cells by reducing or eliminating the expression of components of the T cell receptor (TCR), including introducing the cells with a gRNA molecule according to claim 1, for example, more than one gRNA molecule, for example, a gRNA molecule according to claim 1, for example, more than one gRNA molecule; (b) Modulating cells by reducing or eliminating the target expression of an immunosuppressant, including introducing the cells with a gRNA molecule according to claim 1, for example, more than one gRNA molecule, for example, a gRNA molecule according to claim 1, for example, more than one gRNA molecule; and (c) Expanding the cells.

16. A method for preparing cells (e.g., cell populations) for immunotherapy, comprising: (a) Modulating the cell by reducing or eliminating the expression of a first inhibitory molecule or a downstream effector that signals via an inhibitory molecule, including introducing the cell with a gRNA molecule according to claim 2, for example, more than one gRNA molecule, for example, a gRNA molecule according to claim 2, for example, more than one gRNA molecule; and (c) expanding the cell.

17. A method for treating a subject in need, comprising administering cells (e.g., a cell population) prepared according to any one of claims 13-16.

18. A method of treating a subject in need, comprising administering, in combination with an immunosuppressant, cells (e.g., a population of cells) prepared according to the method of claim 14.

19. Methods of treating patients suffering from diseases include: (a) Providing cell populations from allogeneic donors; (b) Introducing a CRISPR system (e.g., the Streptococcus pyogenes Cas9CRISPR system) containing a first gRNA molecule (or a nucleic acid encoding the gRNA molecule) into a cell, the first gRNA molecule containing a guide domain complementary to a target sequence selected from genes CD247, CD3D, CD3E, CD3G, TRAC, TRBC1 and TRBC2. (c) Optionally, select cells in which functional TCR expression has been reduced or eliminated; (d) Transducing cells with nucleic acids encoding CAR; and (e) Administer cells to patients in need, such as those with diseases associated with the expression of antigens recognized by CAR.

20. Methods of treating patients with diseases include: (a) Provide a population of immune effector cells; (b) Introducing a CRISPR system (e.g., the Streptococcus pyogenes Cas9CRISPR system) containing a first gRNA molecule (or a nucleic acid encoding the gRNA molecule) into a cell population, the first gRNA molecule containing a guide domain complementary to a target sequence selected from genes CD247, CD3D, CD3E, CD3G, TRAC, TRBC1, and TRBC2. (c) Introducing a CRISPR system (e.g., the Streptococcus pyogenes Cas9CRISPR system) containing a second gRNA molecule (or a nucleic acid encoding the gRNA molecule) into a cell population, wherein the second gRNA molecule contains a guide domain complementary to a target sequence selected from genes of B2M, HLA-A, HLA-B and HLA-C. (d) Optionally, select cells in which the expression of functional TCR, functional B2M, or both functional TCR and B2M has been reduced or eliminated; (d) Introducing nucleic acids encoding CAR into the cell population; and (e) Administer cell populations to patients in need, such as those with diseases associated with the expression of antigens recognized by CAR.

21. Modified cells, compared to unmodified cells of the same type, exhibit reduced or eliminated expression of the following: a) T cell receptor components; b) B2M; and / or c)CIITA.

22. Modified cells, relative to unmodified cells of the same type, contain, or are near, the insertion or deletion of base pairs (e.g., more than one base pair): a) Genes encoding T-cell receptor components; b) B2M; and / or c)CIITA.

23. Cell, comprising (e.g., comprising one cell; e.g., comprising more than one cell); cell population, comprising: (a) A nucleic acid sequence encoding a CAR, for example, a nucleic acid sequence encoding a CAR as described herein; (b) Optionally, a nucleic acid sequence encoding an NK repressor molecule, such as a nucleic acid sequence encoding an NK repressor molecule as described herein, for example, a nucleic acid encoding an HLA-G or HLA-G:B2M fusion as described herein; (c) Insertion / deletion at or near the sequence of a gene encoding a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3E, CD3D, or CD3G, such as TRAC) or its regulatory element, for example, insertion / deletion at or near the target sequence of a gRNA containing a guide domain for a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3E, CD3D, or CD3G, such as TRAC), for example, containing the guide domains listed in Tables 1, 4, 5, 6e, 6f, or 6g; (d) Insertion / deletion at or near the sequence of a gene encoding B2M or its regulatory element, for example, insertion / deletion at or near the target sequence of a gRNA containing a guide domain for B2M, for example, a guide domain listed in Table 1 or Table 3. (e) Optionally, an insertion / deletion at or near the sequence encoding CIITA in a gene or its regulatory element, for example, an insertion / deletion at or near the target sequence of a gRNA containing a guide domain for CIITA, for example, a guide domain listed in Table 1 or Table 6c; and (f) Optionally, an insertion / deletion at or near the sequence encoding LILRB1 or its regulatory element, for example, an insertion / deletion at or near the target sequence of a gRNA containing a guide domain for LILRB1, for example, containing the guide domains listed in Table 6d. The cells (or cell populations containing said cells) express CAR and, optionally, NK inhibitory molecules, and exhibit reduced or eliminated expression or function of one or more of the following: i) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC), ii) B2M, iii) CIITA, and / or iv) LILRB1.

24. Cell, containing (e.g., containing one cell; or, more than one cell); cell population, containing): (a) A nucleic acid sequence encoding a CAR, for example, a nucleic acid sequence encoding the CAR described herein; (b) Optionally, a nucleic acid sequence encoding (e.g., as described herein) an NK repressive molecule, such as a nucleic acid encoding HLA-G as described herein; (c) Insertion / deletion at or near the sequence of a gene encoding a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC), for example, insertion / deletion at or near the target sequence of a gRNA containing a guide domain for a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC), for example, containing the guide domains listed in Tables 1, 4, 5, 6e, 6f, or 6g. (d) Insertion / deletion at or near the sequence of the gene encoding NLRC5 or its regulatory element, for example, insertion / deletion at or near the target sequence of a gRNA containing a guide domain for NLRC5, for example, containing the guide domains listed in Table 1. (e) Optionally, an insertion / deletion at or near the sequence encoding CIITA in a gene or its regulatory element, for example, an insertion / deletion at or near the target sequence of a gRNA containing a guide domain for CIITA, for example, a guide domain listed in Table 1 or Table 6c; and (f) Optionally, an insertion / deletion at or near the sequence encoding LILRB1 or its regulatory element, for example, an insertion / deletion at or near the target sequence of a gRNA containing a guide domain for LILRB1, for example, containing the guide domains listed in Table 6d. The cells (or cell populations containing one or more of the cells) express CAR and, optionally, NK inhibitory molecules, and exhibit reduced or eliminated expression or function of one or more of the following: i) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC), ii) B2M, iii) NLRC5, and / or iv) LILRB1.

25. Cell, comprising (e.g., comprising one cell; or, for example, comprising more than one cell); cell population, comprising: (a) A nucleic acid sequence encoding a CAR, for example, a nucleic acid sequence encoding a CAR as described herein; (b) Insertion / deletion at or near the sequence of a gene encoding a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g., TRAC) or its regulatory element, for example, insertion / deletion at or near the target sequence of a gRNA containing a guide domain targeting a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, e.g., TRAC), for example, containing guide domains listed in Tables 1, 4, 5, 6e, 6f, or 6g; and (c) Insertion / deletion at or near the sequence of the gene encoding FKBP1A or its regulatory element, for example, insertion / deletion at or near the target sequence of a gRNA containing a guide domain for FKBP1A, for example, a guide domain listed in Table 1 or Table 6b. The cells (or a cell population containing one cell (e.g., more than one cell) contain) express CAR and exhibit reduced or eliminated expression and / or function of one or more of the following: i) TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC) and / or ii) FKBP12.

26. Cell, comprising (e.g., comprising one cell; e.g., comprising more than one cell); cell population, comprising: (a) A nucleic acid sequence encoding a CAR, for example, a nucleic acid sequence encoding a CAR as described herein; (b) A nucleic acid sequence encoding (e.g., as described herein) a mTor resistant to rapamycin, for example, a nucleic acid sequence encoding an mTor containing an S2035 mutation (e.g., an S2035I mutation); and; (c) Insertion / deletion at or near the sequence of a gene encoding a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC), for example, insertion / deletion at or near the target sequence of a gRNA containing a guide domain for a TCR component (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC), for example, containing the guide domains listed in Tables 1, 4, 5, 6e, 6f, or 6g. The cells (or cell populations containing said cells, for example, more than one said cell) express CAR and mTor resistant to rapamycin, and show reduced or eliminated expression and / or function of TCR components (e.g., TRAC, TRBC1, TRBC2, CD3D, CD3E, or CD3G, such as TRAC).

27. A cell population, wherein at least about 30% of the cells in the population are cells according to any one of claims 22-26.

28. A cell population, wherein at least about 50% of the cells in the population are cells according to any one of claims 22-26.

29. A cell population, wherein at least about 75% of the cells in the population are cells according to any one of claims 22-26.

30. A cell population, wherein at least about 90% of the cells in the population are cells according to any one of claims 22-26.

31. A cell population comprising cells according to any one of claims 22-26, wherein in at least about 30% of the cells (e.g., in at least about 40%, for example, in at least about 50%, for example, in at least about 60%, for example, in at least about 70%, for example, in at least about 80%, for example, in at least about 90%, for example, in at least about 95%, for example, in at least about 99%), each of the insertions / deletions is a frameshift mutation.

32. A cell population comprising cells according to any one of claims 22-26.

33. A cell population, wherein at least about 20% of the cells in the cell population are cells according to any one of claims 22-26.

34. A method of treating a disease (e.g., cancer) in patients in need, comprising administering cells according to any one of claims 20-33.

35. The gRNA molecule according to any one of claims 1-2, the composition according to any one of claims 3-4 or 6-7, the nucleic acid according to claim 5, the vector according to claim 6, or the cell (or cell population) according to any one of claims 10-11 or 20-32, used as a drug.

36. The gRNA molecule according to any one of claims 1-2, the composition according to any one of claims 3-4 or 6-7, the nucleic acid according to claim 5, the vector according to claim 6, or the cell (or cell population) according to any one of claims 10-11 or 20-32, for the manufacture of a drug.

37. The gRNA molecule according to any one of claims 1-2, the composition according to any one of claims 3-4 or 6-7, the nucleic acid according to claim 5, the vector according to claim 6, or the cell (or cell population) according to any one of claims 10-11 or 20-32, for the treatment of a disease.

38. The gRNA molecule according to any one of claims 1-2, the composition according to any one of claims 3-4 or 6-7, the nucleic acid according to claim 5, the vector according to claim 6, or the cell (or cell population) according to any one of claims 10-11 or 20-32, for the treatment of a disease, wherein the disease is a disease associated with tumor antigen expression, for example, proliferative diseases associated with tumor antigen expression, precancerous symptoms, cancer and non-cancer related indications.

39. The gRNA molecule according to any one of claims 1-2, the composition according to any one of claims 3-4 or 6-7, the nucleic acid according to claim 5, the vector according to claim 6, or the cell (or cell population) according to any one of claims 10-11 or 20-32, for the treatment of cancer, wherein the cancer is a hematologic malignancy selected from: chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoblastic leukemia (ALL), B-cell acute lymphoblastic leukemia (B-ALL), T-cell acute lymphoblastic leukemia (T-ALL), chronic myeloid leukemia. CML, Acute Myeloid Leukemia (AML), B-cell lymphoblastic leukemia, plasmacytoid dendritic cell tumor, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, spinal dysplasia and myelodystrophy syndrome, non-Hodgkin lymphoma, Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell tumor, Waldenstrom macroglobulinemia, and preleukemia.

40. A gRNA molecule according to any one of claims 1-2, a composition according to any one of claims 3-4 or 6-7, a nucleic acid according to claim 5, a vector according to claim 6, or a cell (or cell population) according to any one of claims 10-11 or 20-32, for the treatment of cancer, for example, wherein the cancer is selected from mesothelioma, adenocarcinoma, glioblastoma, colon cancer, rectal cancer, renal cell carcinoma, liver cancer, non-small cell lung cancer, small bowel cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, malignant melanoma of the skin or eye, uterine cancer, ovarian cancer. Cancer, rectal cancer, anal cancer, gastric cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, pediatric solid tumors, bladder cancer, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS) tumors, primary CNS lymphoma, tumor angiogenesis, spinal cord tumors, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancer, combinations of the aforementioned cancers, and metastatic lesions of the aforementioned cancers.

Images