Construction method of escherichia coli engineering bacteria with high yield of N-acetylglucosamine
By stepwise knockout and gene optimization, a high-yield Escherichia coli strain SXK207 was constructed, solving the problems of product decomposition and by-product accumulation, and achieving efficient and stable GlcNAc production, which is suitable for industrial applications.
Patent Information
- Application Number
- CN202511578460.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-31
- Publication Date
- 2026-01-09
AI Technical Summary
Existing Escherichia coli strains suffer from product re-decomposition cycles and byproduct accumulation issues in the production of N-acetylglucosamine (GlcNAc), resulting in low yields and poor genetic stability. Traditional modification methods are inefficient and time-consuming, making it difficult to meet industrial-scale requirements.
By using the CRISPR-Cas9 gene editing system to knock out the manXYZ, poxB, and ldhA genes stepwise, and optimizing the expression of GlmS, Gna1, glnA, and yqaB genes, the strains were integrated into the chromosome to construct a high-efficiency and high-yield engineered strain SXK207, ensuring genetic stability and optimized metabolic pathways.
It achieves efficient accumulation of GlcNAc with a yield of ≥120 g/L, sugar-acid conversion rate of ≥65%, good genetic stability, and is suitable for industrial continuous fermentation. It solves the problems of product decomposition and by-product accumulation, and meets industrial needs.
Smart Images

Figure CN121294482A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial metabolic engineering, specifically a method for constructing an engineered Escherichia coli strain that produces high levels of N-acetylglucosamine. Background Technology
[0002] N-acetylglucosamine (GlcNAc) is an important amino sugar compound widely used in pharmaceuticals, food, cosmetics, and other fields. Currently, the industrial production of GlcNAc mainly relies on microbial fermentation, with Escherichia coli being the preferred host bacterium due to its clear genetic background, convenient metabolic regulation, and rapid growth rate.
[0003] However, two major issues hinder the efficient accumulation of GlcNAc in native Escherichia coli: First, E. coli possesses an efficient GlcNAc catabolism pathway—taking extracellular GlcNAc into the cell via the mannose transport system (ManXYZ) and the glucose-phosphoric acid transport system (PTS), then converting it into fructose-6-phosphate (Fru6P) via NagB and NagA enzymes, and reintroducing it into the glycolysis pathway, forming a "product re-decomposition" cycle, which makes it difficult for GlcNAc to accumulate in the fermentation broth; Second, E. coli fermentation easily produces byproducts such as acetic acid and lactic acid, which not only consume carbon sources and reduce sugar-acid conversion rates, but also inhibit cell growth and metabolic homeostasis, further reducing yield.
[0004] Traditional methods for modifying bacterial strains rely on random mutagenesis and multiple rounds of screening, which have drawbacks such as long cycles (usually 2-3 months), low efficiency (positive mutation rate less than 0.1%), and difficulty in specifically regulating metabolic pathways. Although some studies have attempted to improve yield by overexpressing key synthetic genes (such as GlmS and Gna1) using plasmids, plasmid vectors are prone to problems such as copy number instability and loss during passage, resulting in poor genetic stability of the strains and failing to meet the industrial requirements of large-scale continuous fermentation. Summary of the Invention
[0005] To address the aforementioned issues, this invention proposes a method for constructing an engineered Escherichia coli strain that produces high levels of N-acetylglucosamine. This method improves upon the poor genetic stability of natural strains and overcomes the shortcomings of traditional strain modification methods, which rely on random mutagenesis and multiple rounds of screening, resulting in long cycles, low efficiency, and difficulty in targeted regulation of metabolic pathways. This enables the efficient industrial production of GlcNAc.
[0006] The specific steps are as follows:
[0007] (I) Amplification of key target genes
[0008] Template and gene selection: Using Escherichia coli XK2 strain genomic DNA as a template, PCR amplification of key genes for GlcNAc synthesis was performed using KOD Plus Neo enzyme: GlmS (fructose-6-phosphoaminotransferase gene), Gna1 (glucosamine-6-phosphoacetyltransferase gene), glnA (glutamine synthase gene), and yqaB (dephosphorylase gene). The high fidelity of KOD Plus Neo enzyme can minimize base mismatches during amplification, ensuring the accuracy of the promoter and RBS-modified gene sequence, and providing a reliable guarantee for the stability of subsequent gene expression regulation.
[0009] Amplification method and primer design: GlmS and Gna1 were amplified together (they are adjacent in the genome to ensure fragment continuity), while glnA and yqaB were amplified separately; BamHI and NotI restriction sites were introduced at both ends of all amplification primers, providing uniform and efficient restriction sites for the directional ligation of different fragments, reducing non-specific binding when the vector is ligated to the target fragment, and facilitating subsequent cloning and integration operations.
[0010] PCR reagents and products: KOD Plus Neo high-fidelity PCR enzyme was used (to ensure no mutations in the gene sequence). The amplified product sizes met expectations: GlmS-Gna1 approximately 3.2kb, glnA approximately 1.2kb, and yqaB approximately 0.8kb, providing reliable target fragments for subsequent enzyme digestion, cloning, and gene integration. The products were purified by agarose gel electrophoresis after verification.
[0011] (II) Optimization of target gene expression
[0012] Host gene optimization: For the glnA, yqaB, and GlmS genes from strain XK2, their original promoters were replaced with the T7 strong promoter (to improve transcription efficiency), and the ribosome binding site (RBS) was modified (to enhance translation initiation ability) to strengthen gene expression levels.
[0013] Heterologous gene optimization: The Gna1 gene is of heterologous origin. The gene sequence was adjusted and codon optimized according to the codon usage preferences of E. coli. Based on the original heterologous Gna1 gene sequence (GenBank: NM_001181741.1), rare codons of E. coli were replaced with codon analysis tools to avoid rare codons affecting translation efficiency and ensure adaptation to the host gene expression level.
[0014] (III) Knockout of metabolic regulatory genes
[0015] Knockout system and vectors: The CRISPR-Cas9 gene editing system was used, employing two core vectors: the Cas9 expression plasmid pEcCas (carrying the kanamycin resistance gene for expressing the Cas9 nuclease) and the gRNA expression plasmid pTargetF (carrying the ampicillin resistance gene for expressing gRNA targeting the gene).
[0016] Knockout genes and donor fragments: Targeted knockout of the manXYZ, poxB, and ldhA genes in the XK2 strain solves the three core bottlenecks in the fermentation production of N-acetylglucosamine (GlcNAc) from natural E. coli, ensuring that the engineered strain achieves "efficient product retention, precise inhibition of byproducts, and targeted utilization of carbon sources"; homologous recombination donor fragments for each target gene are prepared using overlap PCR technology to guide homologous recombination repair and achieve gene knockout.
[0017] Knockout process and strain acquisition: Knockout was performed step by step in the order of “manXYZ→poxB→ldhA”. The knockout effect was confirmed by resistance screening and PCR verification at each step. This avoided screening interference or strain metabolic disorders that may be caused by simultaneous knockout of multiple genes, which is conducive to the efficient accumulation of target products and improves the production performance of the strain. Finally, the knockout strain SXK203 was obtained.
[0018] Knockout of the manXYZ (blocking product degradation), poxB (reducing acetic acid production), and ldhA (reducing lactic acid production) genes in the host bacteria. As a key and preferred approach, the knockout order is "manXYZ→poxB→ldhA". This order follows a metabolic logic of "first plugging leaks, then throttling, then optimizing," effectively avoiding metabolic stress and growth inhibition caused by simultaneous knockout of multiple genes, and significantly improving the success rate of strain construction and production performance.
[0019] This invention selects the specific knockout order "manXYZ→poxB→ldhA," not arbitrarily, but based on a deep understanding and rational design of the central carbon metabolism and GlcNAc synthesis pathway in *E. coli*. Its aim is to minimize the impact on cellular metabolic homeostasis and gradually guide carbon flow towards the efficient conversion of the target product. Its core logic is as follows:
[0020] The first step: blocking product leakage (knockout of manXYZ). The fundamental reason why GlcNAc cannot accumulate is that it is immediately re-taken up and broken down by the manXYZ transport system after synthesis. Therefore, knocking out manXYZ is the "foundational" step to resolve the core problem. This step can immediately remove the feedback inhibition of the synthetic pathway by the product and establish a "one-in-no-out" metabolic basis for subsequent modifications. If other genes are knocked out first, the "loophole" of product breakdown still exists, and the problem of carbon source loss is not fundamentally solved.
[0021] Secondary step: Optimizing central carbon metabolism (knockout of poxB). After plugging the main leakage point, the next step is to address the most important byproduct—acetic acid. PoxB is one of the key enzymes in acetic acid production. Knocking out poxB on top of manXYZ knockout allows the carbon flow originally used for acetic acid synthesis and GlcNAc breakdown to be synergistically directed towards GlcNAc synthesis. Knocking out poxB at this stage places less metabolic stress on the cell because the carbon source has a more defined destination (GlcNAc synthesis). If poxB is knocked out first, with the product breakdown pathway unobstructed, it may lead to abnormal accumulation of intermediate metabolites, causing metabolic disorders.
[0022] Final step: Fine-tuning the redox balance (knockout of ldhA). This final ldhA knockout is a fine-tuning process performed after the main carbon flow direction has been established (towards GlcNAc) and the main secondary pathway has been disrupted (acetic acid). This further reduces carbon loss and optimizes intracellular NAD+ regeneration. Knocking out ldhA too early, before the metabolic network is stable, may disrupt the cell's redox balance and inhibit cell growth.
[0023] In summary, the knockout sequence of this invention is a progressive process that optimizes step by step, from the superficial to the essential, and from the primary to the secondary. It follows the basic principles of metabolic engineering: first address the most limiting bottleneck, and then address the secondary bottlenecks in turn. In contrast, other knockout sequences (such as knocking out byproduct genes first) may not fundamentally address the core contradiction of "product re-decomposition," and may even cause metabolic network imbalance due to improper modification sequence, leading to impaired cell growth or construction failure.
[0024] (iv) Integration of the target gene into the chromosome
[0025] Integration fragment construction: The optimized target gene (GlmS, Gna1, glnA, yqaB) is combined with the "T7 promoter-RBS" element to construct a complete expression unit of "T7 promoter-RBS-target gene". Then, it is spliced with the homologous arms of the knockout sites (manXYZ, poxB, ldhA sites) of the SXK203 strain to ensure the accuracy of the integration process and form a homologous recombination integrated fragment.
[0026] Integration System and Induction Conditions: Using λ-Red homologous recombination technology, a plasmid carrying the λ-Red recombinase gene was introduced into the SXK203 strain. Recombinase expression was induced in a medium containing 0.2% arabinose. The timing and level of λ-Red recombinase expression were precisely regulated by arabinose to avoid non-specific recombination that may result from continuous recombinase expression, ensuring that the homologous recombination reaction is efficient and directional.
[0027] Obtaining engineered bacteria: The integrated fragment was transferred into SXK203 competent cells containing recombinase, so that the target gene was integrated into the corresponding knockout site. After eliminating the recombinase plasmid, engineered bacteria SXK207 were obtained, which further enhanced the metabolic pathway of GlcNAc synthesis. At the same time, by enhancing acetyl-CoA production and optimizing nitrogen assimilation, the supply of precursors required for GlcNAc synthesis was simultaneously improved.
[0028] (v) Performance verification of engineered bacteria
[0029] Genetic stability verification: The SXK207 strain was continuously passaged in LB liquid medium without selection pressure for 30-50 generations. Samples were taken every 5-10 generations. The integrity of the integrated gene was detected by PCR and the gene expression level was detected by qRT-PCR to ensure that there were no gene deletions and that the expression was stable.
[0030] Acid production performance verification: Fermentation experiments were conducted in shake flasks (LB medium, 37℃, 200 rpm, fermentation for 48 h) and 50 L bioreactors (dedicated fermentation medium, 37℃, stirring speed 500 rpm, aeration rate 1.0 vvm, fermentation for 72 h) to detect GlcNAc yield, sugar-acid conversion rate and by-product concentration.
[0031] Beneficial effects:
[0032] 1. Metabolic pathway reconstruction for high yield and efficiency: By optimizing the expression of key synthetic genes (GlmS, Gna1, glnA, yqaB) and knocking out decomposition and byproduct genes (manXYZ, poxB, ldhA), the two core bottlenecks of "product re-decomposition" and "byproduct accumulation" were solved, laying the foundation for achieving high yield and high conversion rate of GlcNAc.
[0033] 2. Stable chromosome integration ensures genetic stability: By integrating optimized genes into chromosomes, the unstable plasmid expression system is replaced, ensuring the stable inheritance and persistent expression of exogenous genes during the passage process, enabling engineered bacteria to meet the genetic stability requirements of industrial continuous fermentation.
[0034] 3. The engineered strain exhibits superior performance and possesses industrial application value: The final engineered strain SXK207, at a 50L fermentation scale, achieved the following key performance indicators: GlcNAc yield ≥120 g / L, sugar-acid conversion rate ≥65%, and no performance degradation after 50 consecutive generations. These data collectively demonstrate the potential and reliability of this strain for direct industrial production. Attached Figure Description
[0035] Figure 1 Sequencing results of IdhA knockout in SXK203 strain
[0036] Figure 2 Sequence alignment and sequencing results of the glnA gene integrated into strain SXK203 Detailed Implementation
[0037] Example 1: Amplification and Optimization of Key Target Genes
[0038] Preparation of experimental materials
[0039] Escherichia coli XK2 strain was selected, and single colonies were inoculated into 5 mL of LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.0). The culture was carried out at 37°C and 200 rpm for 12 h. Genomic DNA was extracted using a bacterial genomic DNA extraction kit. The concentration was ≥50 ng / μL and the A260 / A280 ratio was 1.8-2.0 as determined by Nanodrop.
[0040] Primers: Sequences are as follows:
[0041] GlmS-GNA1-F: tggtggacagcaaatgggtcggatccgaactgcaggtcgacggatcc (BamHI)
[0042] GlmS-GNA1-R: gcggccgcactcgagcaccaccaccagcgtccggcgtagaggatgcggccgc (NotI)
[0043] glnA-F: tggtggacagcaaatgggtcggatccatgtccgctgaacacgtactgac (BamHI)
[0044] glnA-R: tggtggtggtgctcgagtgcgcggccgcttagacgctgtagtacagctcaaact (NotI)
[0045] yqaB-F: ggtggacagcaaatgggtcggatccatgtacgagcgttatgcaggt (BamHI)
[0046] yqaB-R: tggtggtggtgctcgagtgcgcggccgctcacagcaagcgaacatccacg (NotI)
[0047] Reagents: KODPlusNeo high-fidelity DNA polymerase, dNTPs, 1% agarose gel, DNA recovery kit.
[0048] CR reaction system and procedure
[0049] System configuration (50μL): 2×KOD Buffer 25μL, dNTPs 10μL, upstream primer (10μM) 1μL, downstream primer (10μM) 1μL, template DNA (50ng / μL) 2μL, KOD enzyme 1μL, enzyme-free water 10μL. Mix gently and centrifuge briefly.
[0050] Reaction procedure (Applied Biosystems Veriti 96-well PCR instrument):
[0051] GlmS-Gna1 co-amplification: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 2 min, 35 cycles; 72℃ final extension for 5 min; store at 4℃.
[0052] glnA / yqaB amplification alone: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ final extension for 5 min; store at 4℃.
[0053] Product validation and purification
[0054] Electrophoresis verification: Mix 5 μL of PCR product with 1 μL of 6× Loading Buffer, load onto a 1% agarose gel, add 1×TAE buffer, electrophoresis at 120V for 30 min, and observe with a gel imaging system to confirm product size: GlmS-Gna1 approximately 3.2kb, glnA approximately 1.2kb, yqaB approximately 0.8kb, with no extraneous bands.
[0055] Gel recovery and purification: Cut off the target band (avoid removing excess agarose), follow the instructions of the DNA recovery kit, elute with a volume of 30 μL, and use Nanodrop to detect a concentration ≥30 ng / μL. Store at -20℃ for later use.
[0056] Step 2: Experimental procedures for optimizing target gene expression
[0057] 1. Host gene (glnA, yqaB, GlmS) promoter and RBS modification
[0058] The promoters of the host genes (glnA, yqaB, GlmS) and RBS were modified to create fusion primers containing a T7 promoter (sequence: TAATACGACTCACTATAGGG) and an optimized RBS (sequence: AAGGAGG). The upstream primer integrated the promoter and RBS sequences, while the downstream primer retained the BamHI and NotI restriction sites. Using the original gene PCR product as a template, PCR amplification was performed using KOD PlusNeo enzyme (50 μL system containing 25 μL of 2×KOD Buffer, 1 μL of each primer, etc., program: 98℃ pre-denaturation for 3 min, 35 cycles (98℃ for 10 s, 60℃ for 30 s, 72℃ for 1-2 min, final extension at 72℃ for 5 min). Amplification was verified by 1% agarose gel electrophoresis (fragment sizes approximately 1.4 kb, 1.0 kb, 2.2 kb), and the fragments were recovered from the gel and stored (concentration ≥30 ng / μL).
[0059] 2. Codon optimization and synthesis of heterologous Gna1 gene
[0060] Based on the original heterologous Gna1 gene sequence (GenBank: NM_001181741.1), rare codons of E. coli were replaced using codon analysis tools to regulate the GC content to 40%-60% and avoid complex secondary structures. The optimized gene (with BamHI and NotI sites at both ends) was synthesized, cloned into the pUC57 vector, transformed into TOP10, and single clones were selected for verification. After correct sequencing, a fragment of about 1.0 kb was recovered by enzyme digestion.
[0061] 3. Validation of optimized gene expression efficiency
[0062] The modified host gene and the optimized Gna1 gene were inserted into the pET-28a vector and transformed into BL21(DE3). Single clones were picked and induced with IPTG (0.5 mM) for 4 h. The cells were then sonicated and the supernatant was collected for SDS-PAGE analysis (target protein molecular weights were approximately 45 kDa, 30 kDa, 75 kDa, and 35 kDa). Gray-scale analysis confirmed that the expression level of each protein was ≥15% of the total soluble protein.
[0063] Example 2: Stepwise knockout of metabolic regulatory genes
[0064] 1. gRNA vector construction
[0065] Template: pTargetF vector, the concentration of plasmid was adjusted to 100 ng / μL after extraction.
[0066] Primers: gRNA primers targeting the manXYZ, poxB, and ldhA genes (sequences below), synthesized by Sangon Biotech.
[0067] manXYZ-gF:cccaagaacgatacccaccagttttagagctagaaatagcaag
[0068] manXYZ-gR:tggtgggtatcgttcttgggactagtattatacctaggac
[0069] poxB-gF:ggtgaaaatagcgtcatcgggttttagagctagaaatagcaag
[0070] poxB-gR:ccgatgacgctattttcaccactagtattatacctaggac
[0071] ldhA-gF:gatacgcgcggtgaatacgggttttagagctagaaatagcaag
[0072] ldhA-gR:ccgtattcaccgcgcgtatcactagtattatacctaggac
[0073] PCR amplification of gRNA vector: KOD Plus Neo enzyme was used, with a system of 50 μL (same as in Example 1). The program was as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 2 min, for 30 cycles; and 72℃ final extension for 5 min.
[0074] Vector circularization: PCR products were digested with DpnI enzyme at 37°C for 1 h (to remove template plasmid), recovered from gel, and ligated overnight with T4 DNA ligase at 16°C. The ligation products were then transformed into TOP10 competent cells, plated on LB plates containing ampicillin (100 μg / mL), and cultured at 37°C for 16 h. Single clones were picked and sequenced for verification to obtain gRNA vectors pTargetF-manXYZ, pTargetF-poxB, and pTargetF-ldhA.
[0075] 2. Preparation of homologous recombination donor fragments
[0076] Primer design: For each knockout gene, upstream and downstream homologous arm primers (UP-F / UP-R, DN-F / DN-R) were designed. UP-R and DN-F have a 20bp overlap region, and the sequences are as follows:
[0077] manXYZ-UP-F:ccaaatgagggcgcaaccttaac
[0078] manXYZ-UP-R:gagcaggaaaacgtcatcggtatcgctggttacgcttg
[0079] manXYZ-DN-F:gataccgatgacgttttcctgctcgcctaacagc
[0080] manXYZ-DN-R:gttttggcggcagtttgtcagc
[0081] Overlap PCR: The first step was to amplify the upstream and downstream homologous arms (the system was the same as in Example 1, with an extension time of 40 s). After gel recovery, the mixture was used as a template at a 1:1 ratio. The second step of PCR was performed using UP-F / DN-R primers (with an extension time of 1 min) to obtain the donor fragments: manXYZ-Donor (1.4 kb), poxB-Donor (1.3 kb), and ldhA-Donor (1.0 kb). The fragments were then purified by gel recovery for later use.
[0082] 3. Step-by-step removal operation
[0083] Preparation of competent cells: pEcCas plasmid was electroporated into XK2 competent cells (homemade, washed with 10% glycerol). The cells were plated on LB agar plates containing kanamycin (50 μg / mL) and incubated at 37°C for 16 h. Single colonies were picked and seeded into 5 mL LB agar plates (containing 50 μg / mL Kan + 0.2% arabinose). The cells were then shaken at 37°C and 200 rpm until OD600 = 0.5-0.6. After centrifugation at 4°C and 4000 rpm for 10 min, the cells were washed three times with pre-cooled 10% glycerol to prepare electroporation competent cells (concentration ≥10). 8 (CFU / mL).
[0084] Electroporation: Take 100 μL of competent cells, add 1 μg gRNA vector + 1 μg donor fragment, mix well and transfer to a 0.1 cm electroporation cuvette (Bio-Rad). Electroporation conditions: 18 kV / cm, 5 ms (Bio-Rad Gene Pulser Xcell). Immediately add 1 mL LB recovery medium and incubate at 37°C for 1 h. Take 200 μL and spread it on a plate containing Kan (50 μg / mL) + Amp (100 μg / mL) antibiotics. Incubate at 37°C for 16 h.
[0085] Screening and verification: Single clones were selected and colony PCR was performed using outer primers (e.g., manXYZ verification primers: manXYZ-CF: tcgcgttcatgcaggcatag, manXYZ-CR: caacataatcaggtcgcgtc). The sizes of the positive clone bands were: manXYZ knockout strain 1.7kb (original strain 4.3kb), poxB knockout strain 0.9kb (original strain 2.4kb), ldhA knockout strain 1.2kb (original strain 2.2kb). After sequencing verification, the tool plasmid was eliminated by shaking in LB broth containing 0.2% arabinose for 8 hours to obtain the knockout strain SXK203.
[0086] Example 3: Optimization of Chromosomal Integration and Precursor Optimization of Genes
[0087] 1. Fragment integration and construction
[0088] Expression unit preparation: The T7 promoter (sequence: TAATACGACTCACTATAGGG) and the optimized RBS (sequence: AAGGAGG) were amplified by PCR and spliced with the target gene (GlmS-Gna1, glnA, yqaB) purified in Example 1 by overlap PCR to form the "T7 promoter-RBS-target gene" expression unit.
[0089] Homologous arm splicing: Using SXK203 genomic DNA as a template, upstream and downstream homologous arms (ldhA-UP / ldhA-DN, manXYZ-UP / manXYZ-DN, poxB-UP / poxB-DN) of each knockout site were amplified and spliced with the corresponding expression units by overlap PCR to obtain integrated fragments: glnA-integrated fragment (2.5kb, containing ldhA homologous arm), yqaB-integrated fragment (2.1kb, containing manXYZ homologous arm), and GlmS-Gna1-integrated fragment (4.5kb, containing poxB homologous arm). The fragments were purified by gel extraction (concentration ≥50ng / μL).
[0090] 2. λ-Red homologous recombination
[0091] Recombinase induction: pKD46 plasmid was electroporated into SXK203, plated on LB plates containing Amp (100 μg / mL), and cultured at 37℃ for 16 h. Single colonies were picked and inoculated into 5 mL LB (containing 100 μg / mL Amp + 0.2% arabinose), and shaken at 30℃ and 200 rpm until OD600 = 0.6-0.8 (to induce recombinase expression). Electroporation competent cells were prepared (same as in Example 2).
[0092] Integration procedure: Take 100 μL of competent cells, add 2 μg of integrated fragment, electroporate and thaw for 1 h, plate on antibiotic-free LB plates (to avoid selection pressure affecting recombination), incubate at 37℃ for 16 h, pick single clones and perform PCR verification using "inner primer of integrated fragment + outer primer of homologous arm", and confirm positive clones by sequencing.
[0093] Plasmid elimination: Positive clones were inoculated into antibiotic-free LB liquid medium and incubated at 37°C and 200 rpm for 12 h (pKD46 plasmid is unstable at 37°C). After three consecutive passages, pKD46 was confirmed to have been eliminated by PCR detection. The integration of glnA, yqaB, and GlmS-Gna1 was completed in sequence to obtain engineered bacteria SXK207.
[0094] 3. Optimization of precursor supply
[0095] Culture medium adjustment: Add 0.5 g / L sodium glutamate to the seed culture medium (to increase glutamine precursor), and add 0.2 g / L acetyl-CoA precursor (such as sodium pyruvate) to the fermentation culture medium.
[0096] Feed control: During 50L fermentation, the ratio of glucose to yeast extract in the feed solution should be controlled at 4:1 to avoid carbon-nitrogen imbalance affecting the production of acetyl-CoA.
[0097] Example 4: Comparison of the effects of sequential knockout versus simultaneous knockout and different gene knockout sequences
[0098] To verify the technical advantages of the specific knockout sequence "manXYZ→poxB→ldhA" of this invention, a comparative example is set up.
[0099] Comparative Example 4-1: Attempting to simultaneously knock out the manXYZ, poxB, and ldhA genes.
[0100] Vector construction: gRNA expression cassettes that simultaneously target the manXYZ, poxB and ldhA genes were designed and tandemly cloned into a single pTargetF vector through gene synthesis to form pTargetF-triple.
[0101] Donor fragment preparation: The donor fragments manXYZ, poxB and ldhA prepared in Example 2 were ligated into a large linear donor fragment (approximately 3.7 kb) by overlap PCR.
[0102] Knockout procedure: pEcCas plasmid and pTargetF-triple plasmid were co-transfected into XK2 competent cells, and the aforementioned large donor fragment was added to attempt to knock out three genes at once. The screening conditions were the same as in Example 2.
[0103] Results: The stepwise knockout method of this invention achieved a positive clone yield rate of over 80% at each step. In contrast, the simultaneous knockout method in the comparative experiment failed to yield any correct triple knockout positive clones in three independent replicate experiments. Colony PCR showed that the vast majority of clones were partially knocked out or did not undergo recombination, indicating that introducing three double-strand breaks at once and completing their repair would be too cytotoxic, leading to construction failure.
[0104] Comparative Example 4-2: Try the sequence "poxB → ldhA → manXYZ"
[0105] Following this sequence, the corresponding genes were knocked out step by step using the method described in Example 2.
[0106] Results: The knockout of poxB and ldhA was successfully achieved. However, in the final step of knocking out the crucial manXYZ gene, positive clone selection proved extremely difficult, and the few clones obtained grew slowly. Fermentation tests showed that the final GlcNAc yield of the engineered strain in shake flasks was only 68-75 g / L, significantly lower than the sequence in this invention (82-86 g / L). Analysis suggests that knocking out the byproduct pathway first resulted in an unclear carbon flow direction, which, with the manXYZ pathway remaining open, may have increased metabolic stress, affecting the final performance.
[0107] Comparative Example 4-3: Try the order "manXYZ → ldhA → poxB"
[0108] Perform the knockouts in this order.
[0109] Results: Although the strain was successfully constructed, shake-flask fermentation results showed that its acetic acid accumulation (1.2-1.5 g / L) was significantly higher than that of the sequence in this invention (0.4-0.6 g / L). Analysis suggests that the failure to promptly knock out the major acetic acid synthesis gene poxB after knocking out manXYZ led to an excessive flow of carbon sources to the acetic acid pathway, resulting in carbon waste and inhibition of byproducts.
[0110] Comparative Example 4-4: Attempt to simultaneously knock out manXYZ and poxB
[0111] Try knocking out manXYZ and poxB simultaneously in the first round, and then knocking out ldhA.
[0112] Results: The success rate of construction (positive clone rate <20%) was significantly lower than that of each step of the knockout process in this invention (>80%). The resulting engineered bacteria had a prolonged lag phase and a lower final cell density. This indicates that simultaneously knocking out two key genes placed significant metabolic stress on the cells.
[0113] Conclusion: The comparative experiments above demonstrate that the gene knockout sequence has a decisive impact on the constructability, growth status, and final fermentation performance of the engineered bacteria. The "manXYZ→poxB→ldhA" sequence adopted in this invention has proven to be the preferred scheme with the highest construction efficiency, the most stable metabolism, and the best GlcNAc production performance. Other sequences either lead to construction difficulties, poor byproduct control, or low final yield, and none of them can achieve the technical effects of this invention.
[0114] Example 5: Performance Verification of Engineered Bacteria
[0115] 1. Verification of genetic stability
[0116] Continuous subculturing: Inoculate SXK207 into 5 mL LB liquid medium and incubate at 37°C and 200 rpm for 12 h (1 generation). Transfer to fresh LB at a 1:100 inoculation rate and repeat the operation to 50 generations. Take samples every 10 generations, aliquot them with 20% glycerol (final concentration), and store at -80°C.
[0117] Genomic analysis: Genomic DNA was extracted from the 1st, 10th, 30th, and 50th generations of the strains and amplified using PCR with target gene-specific primers (same primers as in step 1). The target bands were amplified in all cases, with no deletions. The integrated region was sequenced (BGI Genomics, PE150), and the sequence was consistent with the original integrated fragment, with no mutations.
[0118] Transcription level detection: Logarithmic phase bacterial culture of each generation of strains was collected, and total RNA was extracted using an RNA extraction kit (Axygen, catalog number AP-MN-MS-RNA-250). The RNA was reverse transcribed into cDNA, and the relative expression level of the target gene (internal reference gene 16S rRNA) was detected by qRT-PCR. The expression level fluctuation of each generation was <5%.
[0119] 2. Verification of acid production performance
[0120] Shake-flask fermentation validation: SXK207 seed culture (OD600=5.0) was inoculated at a 5% inoculation rate into 50 mL of fermentation medium (formulation: glucose 40 g / L, yeast extract 10 g / L, tryptone 15 g / L, KH2PO4 3 g / L, K2HPO4 6 g / L, MgSO4·7H2O 0.5 g / L, pH 7.0), and cultured at 37℃ and 200 rpm for 48 h. Results showed that the GlcNAc yield was stable at 82-86 g / L, the sugar-acid conversion rate was 58%-62%, the acetic acid concentration was 0.4-0.6 g / L, and the lactic acid concentration was 0.1-0.2 g / L, providing basic data for reactor scale-up.
[0121] Validation of fed-batch fermentation in a 50L bioreactor:
[0122] Equipment and parameters: A BBrauun Biostat C-type 50L reactor was used, with a liquid volume of 30L, an inoculum amount of 10% (seed liquid OD600=6.0), a controlled temperature of 37℃, a stirring speed of 500rpm, an aeration rate of 1.0vvm, and pH 7.0 maintained by automatic addition of 25% ammonia.
[0123] Feeding strategy: Feeding is started 12 hours after fermentation by adding 500 g / L glucose solution (containing 0.1% MgSO4) and maintaining the glucose concentration of the fermentation broth at 5-10 g / L using an online glucose sensor. The fermentation cycle is 72 hours.
[0124] Detection method: HPLC (Agilent 1260) was used for detection. The chromatographic column was Aminex HPX-87H (Bio-Rad), the mobile phase was 5 mM H2SO4, the flow rate was 0.6 mL / min, the column temperature was 65 ℃, and the RID detector was used.
[0125] Key results:
[0126] GlcNAc yield: 121-125 g / L (average 123 g / L), meeting the requirement of ≥120 g / L;
[0127] Sugar-acid conversion rate: 65.2%-66.8% (average 66%), meeting the requirement of ≥65%;
[0128] Byproduct concentrations: Acetic acid 0.3-0.45 g / L (all < 0.5 g / L), lactic acid 0.12-0.18 g / L (all < 0.2 g / L);
[0129] Continuous batch stability: After running for 5 consecutive batches (72 hours per batch), the fluctuation range of each indicator was less than 3%, which proves the stability between batches.
[0130] Validation of Subculture Stability and Industrial Suitability: The SXK207 strain, continuously passaged for 50 generations, was validated through fermentation in a 50L reactor. Results showed that the GlcNAc yield was 120-122 g / L, with a conversion rate of 65%-65.5%. The byproduct concentration remained consistent with the original generation, and acid production performance showed no significant decrease (p>0.05, t-test). Furthermore, the strain exhibited good resistance to contamination during fermentation (no contamination after 72 hours of continuous culture) and strong tolerance to fluctuations in culture medium composition (glucose concentration ±5%, yeast extract ±10%), meeting the requirements for strain stability and adaptability for large-scale industrial production.
[0131] In summary, this method addresses the problems of "product re-decomposition," byproduct accumulation, and poor genetic stability in natural strains by directionally modifying the metabolic network of Escherichia coli through metabolic engineering, thereby enabling the efficient industrial production of GlcNAc.
[0132] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. A method for constructing an engineered Escherichia coli strain that produces high levels of N-acetylglucosamine, characterized in that, Includes the following steps: (1) Using Escherichia coli XK2 strain genomic DNA as a template, the GlmS, Gna1, glnA and yqaB genes were amplified by PCR, and the primers were all introduced with BamHI and NotI restriction sites; (2) Optimize the expression of glnA, yqaB, and GlmS genes, replace the T7 promoter in the host gene and modify RBS, and optimize the codons of the Gna1 gene; (3) The manXYZ, poxB, and ldhA genes of XK2 were knocked out using the CRISPR-Cas9 gene editing system to obtain strain SXK203; (4) The optimized gene was integrated into the corresponding knockout site of SXK203 by λ-Red recombination to obtain the engineered strain SXK207; (5) Verify the genetic stability of SXK2030-50 generation and the acid production performance of shake flask and 50L reactor.
2. The method for constructing engineered Escherichia coli with high N-acetylglucosamine production according to claim 1, characterized in that, In step (1), the GlmS and Gna1 genes were amplified together, and the product was about 3.2kb; the glnA and yqaB genes were amplified separately, and the products were about 1.2kb and 0.8kb, respectively.
3. The method for constructing engineered Escherichia coli with high N-acetylglucosamine production according to claim 1, characterized in that, The PCR amplification process in step (1) requires the use of KOD Plus Neo enzyme.
4. The method for constructing engineered Escherichia coli with high N-acetylglucosamine production according to claim 1, characterized in that, In step (2), the Gna1 gene is of heterologous origin.
5. The method for constructing a high-yield N-acetylglucosamine-producing engineered Escherichia coli strain according to claim 1, characterized in that, In step (2), when optimizing the Gna1 codon, use a codon analysis tool to replace the rare codons of E. coli.
6. The method for constructing engineered Escherichia coli with high N-acetylglucosamine production according to claim 1, characterized in that, In step (3), the CRISPR-Cas9 gene editing system uses pEcCas (cannabinoid) and pTargetF (ampicillin) vectors, and the donor fragment is prepared by overlap PCR.
7. The method for constructing a high-yield N-acetylglucosamine-producing engineered Escherichia coli strain according to claim 1, characterized in that, In step (3), when knocking out the manXYZ, poxB, and ldhA genes of strain XK2, the knockout operation is performed step by step in the order of "manXYZ→poxB→ldhA".
8. The method for constructing engineered Escherichia coli with high N-acetylglucosamine production according to claim 1, characterized in that, In step (4), the λ-Red recombinase inducer is LB medium containing 0.2% arabinose.
9. The method for constructing a high-yield N-acetylglucosamine-producing engineered Escherichia coli strain according to claim 1, characterized in that, In step (4), homologous arm splicing is performed at the knockout site of the SXK203 strain.
10. The method for constructing a high-yield N-acetylglucosamine-producing engineered Escherichia coli strain according to claim 1, characterized in that, In step (5), when verifying genetic stability, the integrity of the integrated gene is detected by PCR and the gene expression level is detected by qRT-PCR.
Citation Information
Cited By
Engineering bacterium for synthesizing N-acetylglucosamine as well as construction method and application of engineering bacterium
CN122060658A
N-acetylglucosamine fermentation method based on oxygen uptake rate regulation
CN122128377A
A method for improving the reliability of shake flask screening of N-acetylglucosamine engineering bacteria
CN122588202A